Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cma16g01176 ATGAGCTTTCAAGATATCGAGGCTGGTCGCCCGTTTGCTTCTTCGAGGAGAGACCTCATCAATGGCAAACAAGATCCCACGCAAGCCGTTGCCTCAGGTATATTTCAGATTAATACTGCCGTTGCTACGTTTCAGAGGCTTGTTAACACCCTAGGTACGCCGAAGGATACGCCTGAGCTACGCGAGAAGCTGCACAAGACCAGGTTACATATTGGACAGTTGGTTAAAGATACCTCTGCCAAACTTAAACAAGCCAGTGAAATAGATCATCACGCAGAAGTTAATGCCAGCAAGAAAATTGCAGATGCTAAACTTGCAAAAGATTTTCAAGCAGTGTTGAAAGAATTTCAGAAGGCTCAACGACTTGCAGCTGAGAGGGAAACAGCATATACACCTTTTGTTCCCCAGACTGTTCTACCTTCTAGCTACACAGCAGGCGAATCAGATGCAAGCTCGGAAAAAAATTTTGAACAGCGTGCTCTCCTTGTGGAATCCAGGAGACAAGAGGTCTTGCTGTTGGACAATGAAATCGCCTTCAATGAGGCAATAATTGAGGAAAGAGAGCAAGGTATTCATGAAATCCAGCACCAAATTGGAGAAGTGAATGAAATTTTTAAAGATCTTGCAGTTTTAGTCCATGAACAGGGAGCCATGATTGATGATATTGGATCCAACATAGAGGGCTCCCATGCTGCAACATCACAGGGAACAACTCAGCTGGTAAAAGCTTCAAAGACGCAAAGATCAAATTCATCTCTGGCTTGCTTACTTTTGGTGATATTTGGTATTATCCTCCTCATTGTGATCATAATAGTTGTTGCTTAA 825 43.15 MSFQDIEAGRPFASSRRDLINGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSAKLKQASEIDHHAEVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYTPFVPQTVLPSSYTAGESDASSEKNFEQRALLVESRRQEVLLLDNEIAFNEAIIEEREQGIHEIQHQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIEGSHAATSQGTTQLVKASKTQRSNSSLACLLLVIFGIILLIVIIIVVA 274
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
16 9005154 9009976 - CmaCh16G011760.1 Cma16g01176 311774

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cma16g01176 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
Cma16g01176 274 CDD SynN 24 160 IPR006011 GO:0016020
Cma16g01176 274 Pfam Syntaxin-like protein 31 130 IPR006011 GO:0016020
Cma16g01176 274 SMART tSNARE_6 176 243 IPR000727 -
Cma16g01176 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484|GO:0006886|GO:0016020
Cma16g01176 274 PANTHER SYNTAXIN 5 272 IPR045242 -
Cma16g01176 274 Gene3D - 21 134 - -
Cma16g01176 274 CDD SNARE_Qa 184 242 - -
Cma16g01176 274 SMART SynN_4 16 128 IPR006011 GO:0016020
Cma16g01176 274 Gene3D - 174 274 - -
Cma16g01176 274 PANTHER SYNTAXIN OF PLANTS PROTEIN 5 272 - -
Cma16g01176 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020|GO:0016192
Cma16g01176 274 Pfam SNARE domain 218 269 IPR000727 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cma16g01176 - - K08488 bhj:120089793 473.396
       

WGDs- Genes

Select Gene_1 Gene_2 Event_name
Cma06g00638 Cma16g01176 CST
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cma12g01045 Cma-Chr12:8277641 Cma16g01176 Cma-Chr16:9005154 1.51E-11 dispersed
Cma16g01176 Cma-Chr16:9005154 Cma07g00822 Cma-Chr7:3806629 1.42E-11 dispersed
Cma16g01176 Cma-Chr16:9005154 Cma06g00638 Cma-Chr6:3134427 0 wgd
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cma05g00643 . 22 353 SNARE and Associated Proteins AT3G24350 65.1 2.7e-103 372.9
Cma12g00301 . 443 750 SNARE and Associated Proteins AT3G24350 62.3 3.1e-91 332.8
Cma07g01172 . 1 308 SNARE and Associated Proteins AT1G08560 67.5 1.5e-99 360.1
Cma03g00248 . 1 312 SNARE and Associated Proteins AT1G08560 67.7 3.0e-95 345.9
Cma03g00740 . 1 303 SNARE and Associated Proteins AT2G18260 53.4 2.6e-83 306.2
Cma14g00365 . 1330 1590 SNARE and Associated Proteins AT3G11820 80.8 4.6e-115 411.8
Cma06g00530 . 19 264 SNARE and Associated Proteins AT3G11820 72.4 1.9e-100 363.2
Cma07g00822 . 21 278 SNARE and Associated Proteins AT3G11820 69.4 1.7e-98 356.7
Cma18g00344 . 31 281 SNARE and Associated Proteins AT3G11820 67.3 2.6e-94 342.8
Cma13g00676 . 31 281 SNARE and Associated Proteins AT3G11820 66.1 2.1e-91 333.2
Cma14g01106 . 67 325 SNARE and Associated Proteins AT3G11820 52.1 6.5e-69 258.5
Cma14g00365 . 1312 1590 SNARE and Associated Proteins AT3G52400 63.9 2.0e-92 336.7
Cma07g00822 . 1 277 SNARE and Associated Proteins AT3G52400 59.4 2.6e-84 309.7
Cma13g00676 . 1 281 SNARE and Associated Proteins AT3G52400 56.5 2.7e-81 299.7
Cma06g00530 . 14 264 SNARE and Associated Proteins AT3G52400 60.7 8.8e-80 294.7
Cma18g00344 . 1 281 SNARE and Associated Proteins AT3G52400 55.3 1.5e-79 293.9
Cma14g01106 . 77 325 SNARE and Associated Proteins AT3G52400 50.2 4.5e-60 229.2
Cma18g00344 . 1 295 SNARE and Associated Proteins AT4G03330 69.8 9.9e-107 384.0
Cma13g00676 . 1 299 SNARE and Associated Proteins AT4G03330 67.5 1.3e-106 383.6
Cma14g00365 . 1312 1591 SNARE and Associated Proteins AT4G03330 57.7 9.9e-83 304.3
Cma07g00822 . 1 278 SNARE and Associated Proteins AT4G03330 52.7 2.0e-75 280.0
Cma06g00530 . 1 269 SNARE and Associated Proteins AT4G03330 54.1 1.3e-74 277.3
Cma14g01106 . 77 325 SNARE and Associated Proteins AT4G03330 55.4 1.8e-68 256.9
Cma18g00344 . 1 303 SNARE and Associated Proteins AT1G61290 78.9 2.6e-128 455.7
Cma13g00676 . 1 303 SNARE and Associated Proteins AT1G61290 77.2 7.2e-126 447.6
Cma14g00365 . 1312 1591 SNARE and Associated Proteins AT1G61290 61.0 7.1e-89 324.7
Cma06g00530 . 1 279 SNARE and Associated Proteins AT1G61290 56.4 1.5e-83 307.0
Cma07g00822 . 1 296 SNARE and Associated Proteins AT1G61290 54.4 6.4e-82 301.6
Cma14g01106 . 75 325 SNARE and Associated Proteins AT1G61290 51.0 4.6e-64 242.3
Cma18g00344 . 1 303 SNARE and Associated Proteins AT1G11250 78.2 3.2e-126 448.7
Cma13g00676 . 1 303 SNARE and Associated Proteins AT1G11250 76.6 4.3e-123 438.3
Cma14g00365 . 1312 1591 SNARE and Associated Proteins AT1G11250 61.8 3.9e-92 335.5
Cma06g00530 . 1 279 SNARE and Associated Proteins AT1G11250 57.5 3.2e-86 315.8
Cma07g00822 . 1 291 SNARE and Associated Proteins AT1G11250 55.0 3.3e-83 305.8
Cma14g01106 . 60 325 SNARE and Associated Proteins AT1G11250 51.1 8.8e-68 254.6
Cma14g01106 . 48 344 SNARE and Associated Proteins AT3G03800 74.4 1.9e-113 406.4
Cma20g00629 . 1 270 SNARE and Associated Proteins AT3G03800 57.3 4.5e-75 278.9
Cma14g01106 . 48 243 SNARE and Associated Proteins AT5G08080 77.6 7.0e-78 287.7
Cma20g00629 . 1 204 SNARE and Associated Proteins AT5G08080 58.8 1.6e-53 206.8
Cma06g00638 CST 1 256 SNARE and Associated Proteins AT5G16830 59.9 1.1e-75 280.8
Cma16g01176 CST 1 256 SNARE and Associated Proteins AT5G16830 59.9 1.1e-75 280.8
Cma06g00638 CST 1 256 SNARE and Associated Proteins AT5G46860 66.8 2.8e-81 299.3
Cma16g01176 CST 1 256 SNARE and Associated Proteins AT5G46860 66.8 1.8e-80 296.6
Cma06g00638 CST 1 256 SNARE and Associated Proteins AT4G17730 61.3 3.2e-74 275.8
Cma16g01176 CST 1 256 SNARE and Associated Proteins AT4G17730 61.7 9.5e-74 274.2
Cma16g01176 CST 65 256 SNARE and Associated Proteins AT1G32270 60.9 7.0e-53 205.3
Cma06g00638 CST 65 256 SNARE and Associated Proteins AT1G32270 60.4 1.3e-51 201.1
Cma04g01124 CST 1 334 SNARE and Associated Proteins AT5G05760 66.0 8.6e-112 401.0
Cma04g00161 CST 1 334 SNARE and Associated Proteins AT5G05760 60.9 1.6e-102 370.2
Cma05g00643 . 22 353 SNARE and Associated Proteins AT3G24350 65.1 2.7e-103 372.9
Cma12g00301 . 443 750 SNARE and Associated Proteins AT3G24350 62.3 3.1e-91 332.8
Cma12g01045 CST 1 327 SNARE and Associated Proteins AT5G26980 74.9 6.5e-125 444.5
Cma05g01087 CST 1 318 SNARE and Associated Proteins AT5G26980 75.5 2.3e-122 436.0
Cma17g01060 . 1 320 SNARE and Associated Proteins AT5G26980 65.2 8.5e-101 364.4
Cma12g01045 CST 1 329 SNARE and Associated Proteins AT4G02195 63.1 1.6e-102 370.2
Cma05g01087 CST 1 318 SNARE and Associated Proteins AT4G02195 63.0 3.5e-102 369.0
Cma17g01060 . 1 320 SNARE and Associated Proteins AT4G02195 64.4 2.9e-101 365.9
Cma12g01045 CST 1 328 SNARE and Associated Proteins AT3G05710 73.9 1.2e-126 450.3
Cma05g01087 CST 1 318 SNARE and Associated Proteins AT3G05710 74.6 1.5e-124 443.4
Cma17g01060 . 1 320 SNARE and Associated Proteins AT3G05710 63.4 2.4e-98 356.3
Cma01g01111 CCT,CST 1 233 SNARE and Associated Proteins AT1G16240 73.4 3.4e-91 332.0
Cma09g00975 CCT,CST 66 294 SNARE and Associated Proteins AT1G16240 70.4 6.2e-85 311.2
Cma16g00924 CCT 3 188 SNARE and Associated Proteins AT1G16240 53.7 6.0e-56 214.9
Cma01g01111 CCT,CST 1 233 SNARE and Associated Proteins AT1G79590 73.0 1.9e-90 329.7
Cma09g00975 CCT,CST 51 294 SNARE and Associated Proteins AT1G79590 68.7 5.4e-85 311.6
Cma16g00924 CCT 2 188 SNARE and Associated Proteins AT1G79590 53.7 1.4e-56 217.2
Cma01g00944 . 5 199 SNARE and Associated Proteins AT1G28490 69.7 1.9e-66 249.6
Cma17g00042 . 162 352 SNARE and Associated Proteins AT1G28490 70.2 1.8e-64 243.0
Cma14g00203 . 1 261 SNARE and Associated Proteins AT3G09740 77.6 2.4e-109 392.5
Cma01g01054 . 1 261 SNARE and Associated Proteins AT3G09740 77.6 9.2e-109 390.6
Cma02g00885 . 1 264 SNARE and Associated Proteins AT3G09740 67.5 4.9e-94 341.7
Cma01g01054 . 1 261 SNARE and Associated Proteins AT3G45280 64.0 2.2e-86 316.2
Cma02g00885 . 1 264 SNARE and Associated Proteins AT3G45280 63.8 3.8e-86 315.5
Cma14g00203 . 1 261 SNARE and Associated Proteins AT3G45280 63.6 1.4e-85 313.5
Cma01g01054 . 1 261 SNARE and Associated Proteins AT3G61450 69.3 2.0e-95 346.3
Cma14g00203 . 1 261 SNARE and Associated Proteins AT3G61450 68.6 4.3e-95 345.1
Cma02g00885 . 1 261 SNARE and Associated Proteins AT3G61450 60.5 2.2e-83 306.2
Cma04g02924 CST 65 309 SNARE and Associated Proteins AT1G51740 73.6 6.5e-93 337.8
Cma15g00119 CST 302 531 SNARE and Associated Proteins AT1G51740 72.7 4.5e-86 315.1
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Cma16g01176 Cma_Chr16 FPKM 64.543541 68.467896 76.119148 81.767036 33.192101 34.928432 37.104111 43.422859 43.075615 43.985992