Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Cma20g00171 TTCCCAGAATTCAATAACCCAATCGCCATGGTTCCTCCAAATCGCTCTGATTCCGGTGATCGTCTTTCCACCGGAATAAATAGTACCCCTGCAGCAGCCCCCGCTGTTGGATCGCCCGGAGATTTTGGCGGCGGAGCTGAGAAATCGAAGGGTTGTTGTGGGTTTCGAGAAAGGCTGAAGAGGCACCGTGAGGAGGTGGCCGGAAAAGTAACGGTACCGGAGAAATGGGGAAAAGAGGAACTGCTAAAGGATTGGATCGATTACTCGGCGTTCGACAGAATCTTGGCCGCTGGCAGAATTGCGTCGGCAAGGGCGTCGCTTGTGGCGGAGGGACGGAGGGTAGAAAGTAGCAAGCTTCAGAGCGAAGCCTTGAGAGAAGCCATTTCCTCTATCTTCGGTGATAGCAGTGAAAAGAAACGCAACTTTACTGAGACCATTGAACTTCAAATTGGACTGAAGAACTATGATCCACAGAAGGACAAGCGTTTCAGTGGATCAGTGAAGTTGCCCCATATCCCTCGCCCTAAAATGAAGATTTGCATGCTTGGAGATGCTTTGCACGTTGAAGAGGCAGAGAAGATTGGTTTAGATTATATGGACGTGGAAGGTCTGAAGAAGCTAAACAAGAACAAGAAATTGGTGAAGAAACTTGCCAAAAAATATCACGCCTTTTTAGCTTCTGAAGCTGTTATCAAGCAAATTCCCCGTCTTCTGGGCCCTGGGCTCAACAAGGCAGGCAAGTGTGTTCATGACTTTAGTCATTCGGAAGTTACCCTTTATCTGAAGCAGTCTGTTTTGTTTGTAGTTCGTACTAATATGGATATCTACATTGCCATTACAGGAAAGTTCCCTACCCTGGTTACTCACCAAGAATCCCTCGAGTCTAAAGTAAATGAGACGAAGGCAATGGTTAAGTTCCAATTGAAGAAGGTTCTTTGCATGGGTGTGGCCGTGGGCAATGTTGCCATGGAAGAGAAGCAAGTTTTTCAGAACGTTCAAATGAGTGTCAATTTCCTCGTTTCCTTGTTGAAAAAGAACTGGCAAAACGTAAGTGAGATGCTTGTACCTGAAGAGTACTATGGGGAAGGCATATCGAGTCTTCTGAGGAATTTTCAAAACTTAGAACAGTACTCTAGGGTTTTGCCTGATTCATACCTTCAGGGTTTAGTTCTGGTCCTCATTCTACGGTTCTATGTTGAAAATTTTGTTTCTTACTCCAAGTGTTTGGATGTTTTTCTCTCTGTTGTTTCTGGTTGGGCATTCGTACTGAGTTGTTTTATTTTGTTGGAAAACTATGAATTGACAAGAAACAGCCTGAGGGGGGAGGGTTTGTTGCTGTGTTCGGACTTAGAGATGATTGCAGAGAAACCTAGTTGGGTTAGGCATGAGGGCACGCAAATTTTCTCGATTGATGTCCAACCTGGTGGACTGAGATTTGCTACTGGAGGAGGCGACCACAAGGTTCGGATATGGAATGTGAAATCTGTTGGTAGGAGTTTAGAAGATGATGACTCAAATCAGAGGCTTCTTGCAACTCTGCGTGATCACTTTGGGTCAGTTAATTGTGTAAGATGGGCTAAGCATGGTCGTTATGTGGCATCAGGGTCTGATGATCAAACAATTCTTGTTCATGAAAAGAAACCTGGTTCAGGGACCACTGAATTTGGAAGTGGAGAGCCCCCAGATGTCGAGAACTGGAAAGTTGCTATGACTTTGAGGGGGCACACAGCTGATGTGGTGGATCTTAACTGGTCGCCTGATGACTCGACATTAGCAAGTGGGAGTTTAGATAACACAGTTCACATATGGAATATGAGCAATGGTATTTGTACAGCCGTTTTGAGGGGTCACTCTAGCCTTGTTAAAGGAGTTGCCTGGGATCCCATAGGTTCTTTCATAGCCAGTCAATCGGATGACAAGACAGTTATTATATGGCGAACAAGTGACTGGAGCCTTGCTCACCGAACTGATGGACATTGGACAAAATCTCTTGGTTCTACATTTTTCCGGCGTCTAGGCTGGTCACCTTGTGGACATTTCATCACTACTACACATGGTTTTCAGAAGCCCAGACATTCTGCACCAGTCTTGGAGAGAGGGGAATGGTCTGCCACGTTTGATTTCTTAGGACACAATGCTCCTGTTATTGTTGTCAAATTTAATCATTCTATGTTTCGGAGGAATTTAACTAATGCTAACGAGATGAAGGCTGTTCCTGTTGGGTGGACAAATGGAGCTTCGAAAATTGGAGGCAAAGAATCCCCATCATACAATGTGATTGCAATTGGGAGTCAGGATCGCACTATAACTGTATGGACGACAGCAAGTCCTCGCCCACTTTTTGTTGCCAAACATTTCTTTACTCAAAGTGTTGTTGATTTATCTTGGAGTCCTGATGGATATTCACTCTTTGCATGTTCCTTGGATGGGTCAGTAGCAACTTTCCATTTTGAGGTGAAAGAAATTGGACAGAGGTTACCTGACGTAGAACTTGATGAGATTAAGAGAAGTCGTTATGGTGATGTTAGAGGCCGGCAAGTGAATTTAGCTGAAACTCCTGCTCAGCTGATGCTTGAAGCAGCTTCATTAAGGCAAGTCTCAAGCAAGAAAGTTGTTTCAGAATCTCAACTAAACCAGACCCTGTCAAAATCTTCAATAGATGCAAGGGATGCCTCCAAGACTTTGGAGGCCCAAGTTGATGATTCAAAGAAGAGTGGGGGAGCTGGTGGGGATGGTTTGAATAAGGTTTCGTCAGCTTCCCAAAAGATTTCTAGTCCTGTGAAGCAAAGAGAATATAGACGACCTGATGGAAGAAAGAGAATTATTCCAGAAGCAGTTGGAGGACCTGTTCTGCAGGAAAATAAGTCTGGTGGGATTCAGAGTAGCAATGCACTTGATTTCCCATCTATGTCATCTGACCAAAAAAAGGATAATAATGGGGTAGCTGCCCCTGAATGTGTCAGGGAAAGTTCCATGAGGGGAATGCCTAGCAAACGCACTGATTTAAAGGAGCGTACAGGGGTCACTGCTCGAGCAACAATCACTGATAGTTTAGTCATTGAGAAGGTTCCACTCTCTGTAGTTAATGATGCAAATATCGTAATGGATCATTCTGGGAATTTGAAGACGTCGAATTCATTGGCTACTTGTAGTTCTGTACTTTCAATTAGGGTGTTTGATAAGAAAGAAGGGGAATATAATGAACCAATTTGCTTGGAAGCTCGACCAAAGGAGAATGCTGCCAATGACATTATTGGGGCTGGAAACACATCGATGTTGAAAGAAACAGTTATTTCTTGTACTAATGGATCAAGAAATCTGTGGTCTGATAGGGTCTCAGGGAAAGTCACTGTTTTGGCTGGAAATGCAAATTTCTGGGCAGTAGGGTGTGAAGATGGATGCCTACAGGTTTATACCAAGTGTGGTAGACGTTCTATGCCAACCATGATGATAGGATCTGCTGCTACGTTTATCGATTGTGATGATTCCTGGAAATTGTTGCTGGTGACAAGGAAAGGTTCCTTGTACGTATGGGATCTCTTCAACCGCAGTTGTCTCCTTCATGACTCGCTGGCATCACTGATTCCTTTGAATCCTAACTCATCTACAAAAGATTCTGGCACTATTAAAGTTATATCTGCCAAGCTGTCAAAATCTGGTTCTCCTCTAGTTGTTTTGGCCACTCGCCATGCTTTTCTCTTTGATACAAACCTTAAGTGTTGGCTGAGAGTAGCAGACGACTGTTTCCCTGCATCAAATTTTTCCAGCTCTTGGAACTTGGGGTCTATTCAGAGCGGAGAGCTTGCTGCACTGCAGGTTGATATCAGGAAATATTTAGCTAGAAAGCCAGGTTGGAGCAGGGTCACCGATGATGGGATGCAGACACGTGCTCACCTAGAAACTCAGATGGCATCCTCACTAGCATTGAAGTCACCTAATGAGTATCGCCAATGGCTTCTATCATACATACGCTTTTTGGCAAGAGAAGCAGATGAATCTCGGCTACGTGAGGTTTGTGAGAGTTTGCTAGGACCCCCAACTGGGATGGCTGGAGATGCATCCGCGGATTCAAAGAATCAAGCCTGGGATCCTTGTGTGCTTGGAATGAGAAAGCACAAACTTCTAAGAGAAGATATACTTCCTGCCATGGCATCAAATAGAAAAGTCCAACGACTGCTTAACGAATTCATGGATCTTCTTTCCGAGTATGAAAATGTTGAAAACAATGTTGAGCCAAAAGCTTCCCTCCCTGCAGCATCAAGCCCTCTGGAACCAGATCATGAGCAGTTTGCTTCACATCAAGCAGATAAAATGGAAACTGACCCTACAGTTATTCATCCAAAGGATTCCTCCAAGTTGGTAAATTATCAAACGAGTTTTGCTCCATCTGTTGATCTGGGCCAGCCAGTAAAGGATCCTGTTAACCTAGCTTCAGAAGCAAAAGACTGA 4449 44.26 FPEFNNPIAMVPPNRSDSGDRLSTGINSTPAAAPAVGSPGDFGGGAEKSKGCCGFRERLKRHREEVAGKVTVPEKWGKEELLKDWIDYSAFDRILAAGRIASARASLVAEGRRVESSKLQSEALREAISSIFGDSSEKKRNFTETIELQIGLKNYDPQKDKRFSGSVKLPHIPRPKMKICMLGDALHVEEAEKIGLDYMDVEGLKKLNKNKKLVKKLAKKYHAFLASEAVIKQIPRLLGPGLNKAGKCVHDFSHSEVTLYLKQSVLFVVRTNMDIYIAITGKFPTLVTHQESLESKVNETKAMVKFQLKKVLCMGVAVGNVAMEEKQVFQNVQMSVNFLVSLLKKNWQNVSEMLVPEEYYGEGISSLLRNFQNLEQYSRVLPDSYLQGLVLVLILRFYVENFVSYSKCLDVFLSVVSGWAFVLSCFILLENYELTRNSLRGEGLLLCSDLEMIAEKPSWVRHEGTQIFSIDVQPGGLRFATGGGDHKVRIWNVKSVGRSLEDDDSNQRLLATLRDHFGSVNCVRWAKHGRYVASGSDDQTILVHEKKPGSGTTEFGSGEPPDVENWKVAMTLRGHTADVVDLNWSPDDSTLASGSLDNTVHIWNMSNGICTAVLRGHSSLVKGVAWDPIGSFIASQSDDKTVIIWRTSDWSLAHRTDGHWTKSLGSTFFRRLGWSPCGHFITTTHGFQKPRHSAPVLERGEWSATFDFLGHNAPVIVVKFNHSMFRRNLTNANEMKAVPVGWTNGASKIGGKESPSYNVIAIGSQDRTITVWTTASPRPLFVAKHFFTQSVVDLSWSPDGYSLFACSLDGSVATFHFEVKEIGQRLPDVELDEIKRSRYGDVRGRQVNLAETPAQLMLEAASLRQVSSKKVVSESQLNQTLSKSSIDARDASKTLEAQVDDSKKSGGAGGDGLNKVSSASQKISSPVKQREYRRPDGRKRIIPEAVGGPVLQENKSGGIQSSNALDFPSMSSDQKKDNNGVAAPECVRESSMRGMPSKRTDLKERTGVTARATITDSLVIEKVPLSVVNDANIVMDHSGNLKTSNSLATCSSVLSIRVFDKKEGEYNEPICLEARPKENAANDIIGAGNTSMLKETVISCTNGSRNLWSDRVSGKVTVLAGNANFWAVGCEDGCLQVYTKCGRRSMPTMMIGSAATFIDCDDSWKLLLVTRKGSLYVWDLFNRSCLLHDSLASLIPLNPNSSTKDSGTIKVISAKLSKSGSPLVVLATRHAFLFDTNLKCWLRVADDCFPASNFSSSWNLGSIQSGELAALQVDIRKYLARKPGWSRVTDDGMQTRAHLETQMASSLALKSPNEYRQWLLSYIRFLAREADESRLREVCESLLGPPTGMAGDASADSKNQAWDPCVLGMRKHKLLREDILPAMASNRKVQRLLNEFMDLLSEYENVENNVEPKASLPAASSPLEPDHEQFASHQADKMETDPTVIHPKDSSKLVNYQTSFAPSVDLGQPVKDPVNLASEAKD 1482
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
20 824360 835831 + CmaCh20G001710.1 Cma20g00171 315985

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Cma20g00171 1482 Gene3D - 116 234 - -
Cma20g00171 1482 Gene3D - 286 359 - -
Cma20g00171 1482 CDD Ribosomal_L1 124 355 IPR028364 -
Cma20g00171 1482 MobiDBLite consensus disorder prediction 1 47 - -
Cma20g00171 1482 Coils Coil 1389 1409 - -
Cma20g00171 1482 SUPERFAMILY Ribosomal protein L1 117 355 IPR023674 -
Cma20g00171 1482 MobiDBLite consensus disorder prediction 1415 1450 - -
Cma20g00171 1482 Gene3D - 693 837 IPR015943 GO:0005515
Cma20g00171 1482 MobiDBLite consensus disorder prediction 879 1006 - -
Cma20g00171 1482 PANTHER PROTEIN HIRA 452 1412 - -
Cma20g00171 1482 ProSiteProfiles Trp-Asp (WD) repeats circular profile. 572 608 - -
Cma20g00171 1482 PANTHER MEMBER OF THE HIR1 FAMILY OF WD-REPEAT PROTEINS 452 1412 IPR031120 GO:0005634|GO:0006325|GO:0006351
Cma20g00171 1482 ProSiteProfiles Trp-Asp (WD) repeats profile. 614 655 IPR001680 GO:0005515
Cma20g00171 1482 CDD WD40 462 812 - -
Cma20g00171 1482 SUPERFAMILY DPP6 N-terminal domain-like 754 1185 - -
Cma20g00171 1482 MobiDBLite consensus disorder prediction 1429 1446 - -
Cma20g00171 1482 MobiDBLite consensus disorder prediction 1462 1482 - -
Cma20g00171 1482 Gene3D - 430 651 IPR015943 GO:0005515
Cma20g00171 1482 ProSiteProfiles Trp-Asp (WD) repeats profile. 572 613 IPR001680 GO:0005515
Cma20g00171 1482 MobiDBLite consensus disorder prediction 954 978 - -
Cma20g00171 1482 MobiDBLite consensus disorder prediction 17 31 - -
Cma20g00171 1482 ProSiteProfiles Trp-Asp (WD) repeats profile. 460 495 IPR001680 GO:0005515
Cma20g00171 1482 Pfam WD domain, G-beta repeat 570 604 IPR001680 GO:0005515
Cma20g00171 1482 Pfam WD domain, G-beta repeat 462 492 IPR001680 GO:0005515
Cma20g00171 1482 Pfam WD domain, G-beta repeat 610 645 IPR001680 GO:0005515
Cma20g00171 1482 Pfam WD domain, G-beta repeat 509 543 IPR001680 GO:0005515
Cma20g00171 1482 ProSitePatterns Trp-Asp (WD) repeats signature. 591 605 IPR019775 -
Cma20g00171 1482 ProSiteProfiles Trp-Asp (WD) repeats circular profile. 460 495 - -
Cma20g00171 1482 Pfam TUP1-like enhancer of split 1142 1342 IPR011494 GO:0006355
Cma20g00171 1482 ProSiteProfiles Trp-Asp (WD) repeats circular profile. 614 645 - -
Cma20g00171 1482 MobiDBLite consensus disorder prediction 927 941 - -
Cma20g00171 1482 Pfam Ribosomal protein L1p/L10e family 138 354 IPR028364 -
Cma20g00171 1482 ProSiteProfiles Trp-Asp (WD) repeats profile. 513 543 IPR001680 GO:0005515
Cma20g00171 1482 SUPERFAMILY WD40 repeat-like 465 813 IPR036322 GO:0005515
Cma20g00171 1482 SMART WD40_4 452 492 IPR001680 GO:0005515
Cma20g00171 1482 SMART WD40_4 776 816 IPR001680 GO:0005515
Cma20g00171 1482 SMART WD40_4 506 545 IPR001680 GO:0005515
Cma20g00171 1482 SMART WD40_4 565 604 IPR001680 GO:0005515
Cma20g00171 1482 SMART WD40_4 701 773 IPR001680 GO:0005515
Cma20g00171 1482 SMART WD40_4 607 646 IPR001680 GO:0005515
Cma20g00171 1482 MobiDBLite consensus disorder prediction 992 1006 - -
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cma20g00171 K11293 HIRA, HIR1; protein HIRA/HIR1 - csv:101217458 1902.1
       

WGDs- Genes


Select Gene_1 Gene_2 Event_name
Cma02g01331 Cma20g00171 CST
       

Dupl-types


Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cma03g01090 Cma-Chr3:7468367 Cma20g00171 Cma-Chr20:824360 6.69E-34 dispersed
Cma06g00470 Cma-Chr6:2226615 Cma20g00171 Cma-Chr20:824360 8.28E-18 dispersed
Cma13g00306 Cma-Chr13:3271085 Cma20g00171 Cma-Chr20:824360 2.82E-111 dispersed
Cma18g00657 Cma-Chr18:5989154 Cma20g00171 Cma-Chr20:824360 6.67E-106 dispersed
Cma20g00171 Cma-Chr20:824360 Cma09g00415 Cma-Chr9:1771752 7.06E-12 dispersed
Cma02g01331 Cma-Chr2:7786096 Cma20g00171 Cma-Chr20:824360 0 transposed
Cma02g01330 Cma-Chr2:7782656 Cma20g00171 Cma-Chr20:824360 9.60E-128 wgd
       

Deco-Alignment


Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi6g1195 . . Bda02g00712 . Bpe01g00241 . . . . . . . . . . Cpe05g00416 . . . . . . . . Cla02g02149 Cam02g2285 Cec02g2322 . Clacu02g2261 Cmu02g2194 Cre02g2519 . . . . . Csa06g01297 . . . Blo14g00225 . . . . . Bma11g00220 . Cmo02g01371 Cmo20g00188 Cma02g01331 Cma20g00171 Car02g01119 Car20g00150 Cpe16g00802 . Bhi10g00050 . . . . . . . . . . . . . . . . .
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cma08g00432 . 1 211 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 85.0 4.0e-91 331.6
Cma17g01077 CCT,ECH 1 186 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 91.4 9.8e-90 327.0
Cma01g00301 CST 1 209 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 84.4 1.3e-89 326.6
Cma14g00917 CST 1 186 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 90.9 6.4e-89 324.3
Cma10g00333 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 69.3 5.6e-61 231.5
Cma01g00301 CST 1 209 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 85.6 5.2e-91 331.3
Cma08g00432 . 1 208 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 85.6 1.2e-90 330.1
Cma14g00917 CST 1 196 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 88.8 3.7e-89 325.1
Cma17g01077 CCT,ECH 1 191 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 90.6 8.3e-89 323.9
Cma10g00333 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 72.3 6.6e-62 234.6
Cma01g00301 CST 1 193 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 90.7 4.8e-92 334.7
Cma08g00432 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 89.2 3.5e-90 328.6
Cma17g01077 CCT,ECH 1 186 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 91.9 1.7e-89 326.2
Cma14g00917 CST 1 197 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 88.8 2.2e-89 325.9
Cma10g00333 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 72.3 4.0e-62 235.3
Cma01g00929 . 1 299 Cytoplasmic Ribosomal Protein Gene Family AT1G72370 74.8 3.7e-119 425.2
Cma09g01284 . 1 289 Cytoplasmic Ribosomal Protein Gene Family AT1G72370 76.3 8.3e-119 424.1
Cma01g00014 . 9 298 Cytoplasmic Ribosomal Protein Gene Family AT1G72370 73.6 4.3e-115 411.8
Cma04g00777 . 9 296 Cytoplasmic Ribosomal Protein Gene Family AT1G72370 72.7 2.8e-114 409.1
Cma14g01207 . 9 252 Cytoplasmic Ribosomal Protein Gene Family AT1G72370 82.0 8.0e-114 407.5
Cma09g01284 . 2 289 Cytoplasmic Ribosomal Protein Gene Family AT3G04770 76.2 5.7e-117 417.9
Cma01g00929 . 9 288 Cytoplasmic Ribosomal Protein Gene Family AT3G04770 75.4 3.7e-116 415.2
Cma01g00014 . 5 286 Cytoplasmic Ribosomal Protein Gene Family AT3G04770 75.4 1.5e-114 409.8
Cma04g00777 . 5 290 Cytoplasmic Ribosomal Protein Gene Family AT3G04770 72.1 4.5e-114 408.3
Cma14g01207 . 4 252 Cytoplasmic Ribosomal Protein Gene Family AT3G04770 81.6 1.7e-113 406.4
Cma03g00071 . 33 260 Cytoplasmic Ribosomal Protein Gene Family AT1G58380 88.2 8.3e-116 414.1
Cma07g01320 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G58380 88.9 1.8e-115 412.9
Cma14g00478 . 13 226 Cytoplasmic Ribosomal Protein Gene Family AT1G58380 86.4 8.6e-105 377.5
Cma06g00049 . 1 157 Cytoplasmic Ribosomal Protein Gene Family AT1G58380 79.9 5.6e-64 241.9
Cma03g00071 . 33 260 Cytoplasmic Ribosomal Protein Gene Family AT1G59359 88.2 8.3e-116 414.1
Cma07g01320 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G59359 88.9 1.8e-115 412.9
Cma14g00478 . 13 226 Cytoplasmic Ribosomal Protein Gene Family AT1G59359 86.4 8.6e-105 377.5
Cma06g00049 . 1 157 Cytoplasmic Ribosomal Protein Gene Family AT1G59359 79.9 5.6e-64 241.9
Cma03g00071 . 33 258 Cytoplasmic Ribosomal Protein Gene Family AT2G41840 88.9 1.1e-115 413.7
Cma07g01320 . 36 259 Cytoplasmic Ribosomal Protein Gene Family AT2G41840 89.3 3.2e-115 412.1
Cma14g00478 . 13 233 Cytoplasmic Ribosomal Protein Gene Family AT2G41840 85.1 2.5e-104 375.9
Cma06g00049 . 1 157 Cytoplasmic Ribosomal Protein Gene Family AT2G41840 79.9 5.7e-64 241.9
Cma03g00071 . 33 259 Cytoplasmic Ribosomal Protein Gene Family AT3G57490 89.9 1.5e-117 419.9
Cma07g01320 . 37 260 Cytoplasmic Ribosomal Protein Gene Family AT3G57490 90.7 3.3e-117 418.7
Cma14g00478 . 13 225 Cytoplasmic Ribosomal Protein Gene Family AT3G57490 86.9 1.9e-104 376.3
Cma06g00049 . 1 157 Cytoplasmic Ribosomal Protein Gene Family AT3G57490 78.6 9.3e-64 241.1
Cma03g00071 . 33 260 Cytoplasmic Ribosomal Protein Gene Family AT1G58684 88.2 8.3e-116 414.1
Cma07g01320 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G58684 88.9 1.8e-115 412.9
Cma14g00478 . 13 226 Cytoplasmic Ribosomal Protein Gene Family AT1G58684 86.4 8.6e-105 377.5
Cma06g00049 . 1 157 Cytoplasmic Ribosomal Protein Gene Family AT1G58684 79.9 5.6e-64 241.9
Cma03g00071 . 33 260 Cytoplasmic Ribosomal Protein Gene Family AT1G58983 88.2 8.3e-116 414.1
Cma07g01320 . 37 261 Cytoplasmic Ribosomal Protein Gene Family AT1G58983 88.9 1.8e-115 412.9
Cma14g00478 . 13 226 Cytoplasmic Ribosomal Protein Gene Family AT1G58983 86.4 8.6e-105 377.5
Cma06g00049 . 1 157 Cytoplasmic Ribosomal Protein Gene Family AT1G58983 79.9 5.6e-64 241.9
Cma12g01313 . 1 230 Cytoplasmic Ribosomal Protein Gene Family AT2G31610 88.7 3.7e-112 401.7
Cma05g01406 . 395 632 Cytoplasmic Ribosomal Protein Gene Family AT2G31610 86.1 6.4e-112 401.0
Cma01g00042 CCT,ECH 1 239 Cytoplasmic Ribosomal Protein Gene Family AT2G31610 82.4 2.1e-110 396.0
Cma17g00695 CCT,ECH 1 241 Cytoplasmic Ribosomal Protein Gene Family AT2G31610 83.4 5.6e-108 387.9
Cma08g00792 . 28 324 Cytoplasmic Ribosomal Protein Gene Family AT2G31610 66.7 1.4e-98 356.7
Cma12g01313 . 1 234 Cytoplasmic Ribosomal Protein Gene Family AT3G53870 88.9 3.4e-113 405.2
Cma05g01406 . 395 613 Cytoplasmic Ribosomal Protein Gene Family AT3G53870 92.2 8.3e-112 400.6
Cma01g00042 CCT,ECH 1 217 Cytoplasmic Ribosomal Protein Gene Family AT3G53870 91.2 4.6e-110 394.8
Cma17g00695 CCT,ECH 1 244 Cytoplasmic Ribosomal Protein Gene Family AT3G53870 83.6 8.6e-109 390.6
Cma08g00792 . 28 327 Cytoplasmic Ribosomal Protein Gene Family AT3G53870 67.0 3.6e-99 358.6
Cma01g00042 CCT,ECH 1 226 Cytoplasmic Ribosomal Protein Gene Family AT5G35530 88.9 6.3e-112 401.0
Cma12g01313 . 1 217 Cytoplasmic Ribosomal Protein Gene Family AT5G35530 91.7 1.1e-111 400.2
Cma05g01406 . 395 611 Cytoplasmic Ribosomal Protein Gene Family AT5G35530 91.7 1.8e-111 399.4
Cma17g00695 CCT,ECH 1 254 Cytoplasmic Ribosomal Protein Gene Family AT5G35530 81.5 5.9e-110 394.4
Cma08g00792 . 28 331 Cytoplasmic Ribosomal Protein Gene Family AT5G35530 66.4 8.6e-101 364.0
Cma14g01738 CCT,CST,ECH 20 280 Cytoplasmic Ribosomal Protein Gene Family AT3G04840 85.9 3.3e-127 451.8
Cma06g01379 CCT,CST,ECH 1 261 Cytoplasmic Ribosomal Protein Gene Family AT3G04840 85.9 9.6e-127 450.3
Cma08g01132 CCT,CST,ECH 1 260 Cytoplasmic Ribosomal Protein Gene Family AT3G04840 85.9 6.2e-126 447.6
Cma17g00218 CCT,CST,ECH 1 260 Cytoplasmic Ribosomal Protein Gene Family AT3G04840 85.1 1.2e-124 443.4
Cma14g01738 CCT,CST,ECH 20 280 Cytoplasmic Ribosomal Protein Gene Family AT4G34670 86.3 4.3e-127 451.4
Cma06g01379 CCT,CST,ECH 1 261 Cytoplasmic Ribosomal Protein Gene Family AT4G34670 86.3 1.3e-126 449.9
Cma08g01132 CCT,CST,ECH 1 260 Cytoplasmic Ribosomal Protein Gene Family AT4G34670 86.3 6.2e-126 447.6
Cma17g00218 CCT,CST,ECH 1 260 Cytoplasmic Ribosomal Protein Gene Family AT4G34670 85.5 1.2e-124 443.4
Cma04g01104 CST,ECH 1 181 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 93.4 5.6e-97 350.9
Cma04g01946 . 1 181 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 91.7 5.6e-97 350.9
Cma09g01137 . 1 181 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 91.7 1.2e-96 349.7
Cma04g00136 CST,ECH 1 181 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 91.7 1.6e-96 349.4
Cma04g00835 . 671 850 Cytoplasmic Ribosomal Protein Gene Family AT2G17360 92.2 2.1e-96 349.0
Cma04g01946 . 19 261 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 92.6 1.4e-132 469.5
Cma04g01104 CST,ECH 19 261 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 92.6 3.2e-132 468.4
Cma04g00136 CST,ECH 19 262 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 92.2 9.3e-132 466.8
Cma04g00835 . 688 930 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 92.2 2.1e-131 465.7
Cma09g01137 . 19 261 Cytoplasmic Ribosomal Protein Gene Family AT5G07090 91.8 2.7e-131 465.3
Cma04g01946 . 1 261 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 93.1 8.7e-144 506.9
Cma04g01104 CST,ECH 1 261 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 93.1 1.9e-143 505.8
Cma04g00136 CST,ECH 1 262 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 92.7 5.6e-143 504.2
Cma09g01137 . 1 261 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 92.3 1.6e-142 502.7
Cma04g00835 . 671 930 Cytoplasmic Ribosomal Protein Gene Family AT5G58420 92.7 4.8e-142 501.1
Cma11g01163 . 23 228 Cytoplasmic Ribosomal Protein Gene Family AT2G37270 87.9 1.1e-98 356.7
Cma06g00560 CST 455 663 Cytoplasmic Ribosomal Protein Gene Family AT2G37270 86.1 1.3e-97 353.2
Cma14g00391 CST 656 861 Cytoplasmic Ribosomal Protein Gene Family AT2G37270 86.5 4.8e-97 351.3
Cma06g00561 CST 1 205 Cytoplasmic Ribosomal Protein Gene Family AT2G37270 86.9 1.4e-96 349.7
Cma11g01163 . 23 228 Cytoplasmic Ribosomal Protein Gene Family AT3G11940 87.0 4.8e-97 351.3
Cma14g00391 CST 656 861 Cytoplasmic Ribosomal Protein Gene Family AT3G11940 87.4 6.3e-97 350.9
Cma06g00560 CST 455 663 Cytoplasmic Ribosomal Protein Gene Family AT3G11940 85.6 3.1e-96 348.6
Cma06g00561 CST 1 205 Cytoplasmic Ribosomal Protein Gene Family AT3G11940 85.9 2.6e-95 345.5
Cma06g00997 . 63 249 Cytoplasmic Ribosomal Protein Gene Family AT4G31700 88.8 1.9e-84 309.3
Cma05g00506 CST 63 249 Cytoplasmic Ribosomal Protein Gene Family AT4G31700 88.3 5.5e-84 307.8
Cma12g00166 CST 76 269 Cytoplasmic Ribosomal Protein Gene Family AT4G31700 85.1 6.8e-82 300.8
Cma06g00997 . 1 249 Cytoplasmic Ribosomal Protein Gene Family AT5G10360 71.9 7.8e-89 323.9
Cma05g00506 CST 1 249 Cytoplasmic Ribosomal Protein Gene Family AT5G10360 71.9 7.8e-89 323.9
Cma12g00166 CST 1 269 Cytoplasmic Ribosomal Protein Gene Family AT5G10360 66.5 3.1e-85 312.0
Cma10g00302 CCT,ECH 1 191 Cytoplasmic Ribosomal Protein Gene Family AT1G48830 80.6 8.7e-85 310.5
Cma18g00044 CCT,ECH 1 191 Cytoplasmic Ribosomal Protein Gene Family AT1G48830 80.1 2.8e-83 305.4
Cma13g01022 CCT,ECH 288 478 Cytoplasmic Ribosomal Protein Gene Family AT1G48830 78.0 3.1e-82 302.0
Cma11g00280 CCT,ECH 329 481 Cytoplasmic Ribosomal Protein Gene Family AT1G48830 80.4 1.7e-64 243.0
Cma10g00302 CCT,ECH 1 191 Cytoplasmic Ribosomal Protein Gene Family AT3G02560 78.5 2.1e-83 305.8
Cma18g00044 CCT,ECH 1 191 Cytoplasmic Ribosomal Protein Gene Family AT3G02560 78.5 2.4e-82 302.4
Cma13g01022 CCT,ECH 288 478 Cytoplasmic Ribosomal Protein Gene Family AT3G02560 78.0 2.0e-81 299.3
Cma11g00280 CCT,ECH 329 481 Cytoplasmic Ribosomal Protein Gene Family AT3G02560 81.0 1.4e-66 250.0
Cma10g00302 CCT,ECH 1 188 Cytoplasmic Ribosomal Protein Gene Family AT5G16130 77.7 2.2e-80 295.8
Cma18g00044 CCT,ECH 1 188 Cytoplasmic Ribosomal Protein Gene Family AT5G16130 78.7 4.9e-80 294.7
Cma13g01022 CCT,ECH 288 475 Cytoplasmic Ribosomal Protein Gene Family AT5G16130 78.2 1.4e-79 293.1
Cma11g00280 CCT,ECH 329 481 Cytoplasmic Ribosomal Protein Gene Family AT5G16130 79.1 2.9e-64 242.3
Cma12g00886 . 1 216 Cytoplasmic Ribosomal Protein Gene Family AT5G20290 83.3 4.8e-95 344.7
Cma05g00689 . 1 216 Cytoplasmic Ribosomal Protein Gene Family AT5G20290 77.4 4.8e-95 344.7
Cma04g02373 . 1 218 Cytoplasmic Ribosomal Protein Gene Family AT5G20290 83.7 1.6e-93 339.7
Cma15g00667 . 1 218 Cytoplasmic Ribosomal Protein Gene Family AT5G20290 82.8 1.6e-90 329.7
Cma05g00689 . 1 219 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 83.6 6.8e-99 357.5
Cma12g00886 . 1 219 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 82.6 3.4e-98 355.1
Cma04g02373 . 1 221 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 81.4 1.9e-96 349.4
Cma15g00667 . 1 221 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 79.2 9.5e-93 337.0
Cma06g01650 . 2 191 Cytoplasmic Ribosomal Protein Gene Family AT5G59240 51.7 2.5e-45 179.5
Cma18g01161 CCT,ECH 1 137 Cytoplasmic Ribosomal Protein Gene Family AT5G15200 91.2 1.1e-66 250.0
Cma01g00854 . 1 137 Cytoplasmic Ribosomal Protein Gene Family AT5G15200 91.2 1.1e-66 250.0
Cma04g01649 CCT,ECH 365 493 Cytoplasmic Ribosomal Protein Gene Family AT5G15200 91.5 6.5e-62 234.2
Cma09g01310 . 32 169 Cytoplasmic Ribosomal Protein Gene Family AT5G15200 86.2 2.5e-61 232.3
Cma04g01884 . 6 132 Cytoplasmic Ribosomal Protein Gene Family AT5G15200 92.1 4.2e-61 231.5
Cma04g01649 CCT,ECH 365 553 Cytoplasmic Ribosomal Protein Gene Family AT5G39850 91.0 8.6e-96 347.1
Cma18g01161 CCT,ECH 1 197 Cytoplasmic Ribosomal Protein Gene Family AT5G39850 87.8 5.6e-95 344.4
Cma01g00854 . 1 197 Cytoplasmic Ribosomal Protein Gene Family AT5G39850 87.8 5.6e-95 344.4
Cma09g01310 . 43 229 Cytoplasmic Ribosomal Protein Gene Family AT5G39850 91.4 7.3e-95 344.0
Cma04g01884 . 6 176 Cytoplasmic Ribosomal Protein Gene Family AT5G39850 93.0 3.9e-88 321.6
Cma15g01250 CCT,CST,ECH 20 195 Cytoplasmic Ribosomal Protein Gene Family AT4G25740 64.2 7.3e-55 210.7
Cma04g00729 . 1 161 Cytoplasmic Ribosomal Protein Gene Family AT4G25740 62.7 3.5e-49 191.8
Cma16g00584 CCT,ECH 1 155 Cytoplasmic Ribosomal Protein Gene Family AT4G25740 62.6 6.6e-48 187.6
Cma02g01428 CCT,CST,ECH 1 99 Cytoplasmic Ribosomal Protein Gene Family AT4G25740 86.9 1.3e-46 183.3
Cma15g01250 CCT,CST,ECH 65 177 Cytoplasmic Ribosomal Protein Gene Family AT5G41520 73.5 1.7e-39 159.5
Cma15g01250 CCT,CST,ECH 20 147 Cytoplasmic Ribosomal Protein Gene Family AT5G52650 83.7 3.8e-58 221.9
Cma02g01428 CCT,CST,ECH 1 128 Cytoplasmic Ribosomal Protein Gene Family AT5G52650 81.4 3.0e-55 212.2
Cma16g00584 CCT,ECH 1 129 Cytoplasmic Ribosomal Protein Gene Family AT5G52650 77.7 5.9e-51 198.0
Cma04g00729 . 1 129 Cytoplasmic Ribosomal Protein Gene Family AT5G52650 76.9 5.0e-50 194.9
Cma12g00348 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT3G48930 91.3 1.5e-82 302.8
Cma05g00370 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT3G48930 90.6 2.0e-82 302.4
Cma12g01160 . 729 893 Cytoplasmic Ribosomal Protein Gene Family AT3G48930 83.8 3.6e-76 281.6
Cma19g00802 . 29 163 Cytoplasmic Ribosomal Protein Gene Family AT3G48930 88.0 6.6e-70 260.8
Cma12g00348 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT4G30800 91.2 9.8e-82 300.1
Cma05g00370 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT4G30800 90.6 1.3e-81 299.7
Cma12g01160 . 729 893 Cytoplasmic Ribosomal Protein Gene Family AT4G30800 83.7 2.6e-74 275.4
Cma19g00802 . 29 163 Cytoplasmic Ribosomal Protein Gene Family AT4G30800 87.3 6.2e-68 254.2
Cma12g00348 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT5G23740 91.8 1.5e-82 302.8
Cma05g00370 . 1 159 Cytoplasmic Ribosomal Protein Gene Family AT5G23740 91.8 1.5e-82 302.8
Cma12g01160 . 729 893 Cytoplasmic Ribosomal Protein Gene Family AT5G23740 84.3 3.1e-75 278.5
Cma19g00802 . 29 163 Cytoplasmic Ribosomal Protein Gene Family AT5G23740 89.4 8.6e-70 260.4
Cma20g00789 . 48 186 Cytoplasmic Ribosomal Protein Gene Family AT1G15930 70.6 3.6e-51 198.4
Cma08g00592 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT1G15930 70.6 3.6e-51 198.4
Cma02g00350 . 19 154 Cytoplasmic Ribosomal Protein Gene Family AT1G15930 70.7 6.9e-50 194.1
Cma17g00893 . 104 227 Cytoplasmic Ribosomal Protein Gene Family AT1G15930 75.8 9.0e-50 193.7
Cma17g00893 . 100 228 Cytoplasmic Ribosomal Protein Gene Family AT2G32060 74.4 7.3e-52 200.7
Cma08g00592 . 12 140 Cytoplasmic Ribosomal Protein Gene Family AT2G32060 73.6 9.6e-52 200.3
Cma20g00789 . 59 187 Cytoplasmic Ribosomal Protein Gene Family AT2G32060 73.6 2.8e-51 198.7
Cma02g00350 . 27 155 Cytoplasmic Ribosomal Protein Gene Family AT2G32060 72.9 1.4e-50 196.4
Cma06g00757 CCT,ECH 1 151 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 93.4 2.6e-76 282.0
Cma17g00035 CCT,CST,ECH 1 151 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 94.0 3.4e-76 281.6
Cma15g01163 CST 1 151 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 92.1 2.9e-75 278.5
Cma02g01499 . 1 151 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 92.1 2.9e-75 278.5
Cma08g00957 CCT,CST,ECH 1 141 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 93.6 4.3e-71 264.6
Cma16g01045 . 22 163 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 87.3 8.5e-67 250.4
Cma02g01012 CST 1 132 Cytoplasmic Ribosomal Protein Gene Family AT3G60770 75.9 1.4e-50 196.4
Cma06g00757 CCT,ECH 1 151 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 94.0 1.2e-76 283.1
Cma17g00035 CCT,CST,ECH 1 151 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 94.7 1.5e-76 282.7
Cma15g01163 CST 1 151 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 92.7 1.3e-75 279.6
Cma02g01499 . 1 151 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 92.7 1.3e-75 279.6
Cma08g00957 CCT,CST,ECH 1 141 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 94.3 1.9e-71 265.8
Cma16g01045 . 22 163 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 87.3 8.5e-67 250.4
Cma02g01012 CST 1 132 Cytoplasmic Ribosomal Protein Gene Family AT4G00100 76.6 6.5e-51 197.6
Cma14g00327 CST 1 150 Cytoplasmic Ribosomal Protein Gene Family AT2G36160 92.0 6.4e-75 277.3
Cma06g00489 CST 1 150 Cytoplasmic Ribosomal Protein Gene Family AT2G36160 91.3 8.4e-75 276.9
Cma18g00461 CST 45 193 Cytoplasmic Ribosomal Protein Gene Family AT2G36160 91.9 2.4e-74 275.4
Cma14g00328 CST 130 309 Cytoplasmic Ribosomal Protein Gene Family AT2G36160 76.7 3.6e-70 261.5
Cma13g00557 CST 552 678 Cytoplasmic Ribosomal Protein Gene Family AT2G36160 90.6 2.4e-61 232.3
Cma14g00327 CST 1 150 Cytoplasmic Ribosomal Protein Gene Family AT3G11510 93.3 9.9e-76 280.0
Cma06g00489 CST 1 150 Cytoplasmic Ribosomal Protein Gene Family AT3G11510 92.7 1.3e-75 279.6
Cma18g00461 CST 45 193 Cytoplasmic Ribosomal Protein Gene Family AT3G11510 93.3 3.8e-75 278.1
Cma14g00328 CST 130 309 Cytoplasmic Ribosomal Protein Gene Family AT3G11510 77.8 5.6e-71 264.2
Cma13g00557 CST 552 678 Cytoplasmic Ribosomal Protein Gene Family AT3G11510 92.1 3.7e-62 235.0
Cma14g00327 CST 1 150 Cytoplasmic Ribosomal Protein Gene Family AT3G52580 92.7 2.2e-75 278.9
Cma06g00489 CST 1 150 Cytoplasmic Ribosomal Protein Gene Family AT3G52580 92.0 2.9e-75 278.5
Cma18g00461 CST 45 193 Cytoplasmic Ribosomal Protein Gene Family AT3G52580 92.6 8.4e-75 276.9
Cma14g00328 CST 130 309 Cytoplasmic Ribosomal Protein Gene Family AT3G52580 77.2 1.3e-70 263.1
Cma13g00557 CST 552 678 Cytoplasmic Ribosomal Protein Gene Family AT3G52580 91.3 8.1e-62 233.8
Cma17g00178 CST 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G04270 90.1 2.1e-73 272.3
Cma08g01105 CST 51 201 Cytoplasmic Ribosomal Protein Gene Family AT1G04270 90.7 3.5e-73 271.6
Cma06g01340 . 296 447 Cytoplasmic Ribosomal Protein Gene Family AT1G04270 90.8 1.8e-72 269.2
Cma14g01779 CCT 527 679 Cytoplasmic Ribosomal Protein Gene Family AT1G04270 89.5 3.9e-72 268.1
Cma17g00178 CST 1 152 Cytoplasmic Ribosomal Protein Gene Family AT5G09490 81.6 2.2e-67 252.3
Cma08g01105 CST 51 201 Cytoplasmic Ribosomal Protein Gene Family AT5G09490 82.1 3.8e-67 251.5
Cma14g01779 CCT 527 679 Cytoplasmic Ribosomal Protein Gene Family AT5G09490 81.7 1.1e-66 250.0
Cma06g01340 . 296 447 Cytoplasmic Ribosomal Protein Gene Family AT5G09490 81.6 4.2e-66 248.1
Cma06g01340 . 299 447 Cytoplasmic Ribosomal Protein Gene Family AT5G09500 88.6 2.4e-69 258.8
Cma14g01779 CCT 531 679 Cytoplasmic Ribosomal Protein Gene Family AT5G09500 88.6 4.0e-69 258.1
Cma08g01105 CST 54 201 Cytoplasmic Ribosomal Protein Gene Family AT5G09500 87.8 9.0e-69 256.9
Cma17g00178 CST 1 152 Cytoplasmic Ribosomal Protein Gene Family AT5G09500 87.5 1.2e-68 256.5
Cma17g00178 CST 35 152 Cytoplasmic Ribosomal Protein Gene Family AT5G09510 94.1 5.1e-59 224.2
Cma06g01340 . 330 447 Cytoplasmic Ribosomal Protein Gene Family AT5G09510 94.1 5.1e-59 224.2
Cma08g01105 CST 84 201 Cytoplasmic Ribosomal Protein Gene Family AT5G09510 94.1 5.1e-59 224.2
Cma14g01779 CCT 562 679 Cytoplasmic Ribosomal Protein Gene Family AT5G09510 94.1 5.1e-59 224.2
Cma14g01779 CCT 532 679 Cytoplasmic Ribosomal Protein Gene Family AT5G43640 87.8 9.9e-68 253.4
Cma06g01340 . 300 447 Cytoplasmic Ribosomal Protein Gene Family AT5G43640 87.2 1.7e-67 252.7
Cma08g01105 CST 53 201 Cytoplasmic Ribosomal Protein Gene Family AT5G43640 85.9 1.7e-67 252.7
Cma17g00178 CST 4 152 Cytoplasmic Ribosomal Protein Gene Family AT5G43640 85.2 3.7e-67 251.5
Cma14g01779 CCT 527 679 Cytoplasmic Ribosomal Protein Gene Family AT5G63070 61.3 5.1e-46 181.4
Cma08g01105 CST 54 201 Cytoplasmic Ribosomal Protein Gene Family AT5G63070 63.6 6.7e-46 181.0
Cma06g01340 . 296 447 Cytoplasmic Ribosomal Protein Gene Family AT5G63070 62.3 8.7e-46 180.6
Cma17g00178 CST 5 152 Cytoplasmic Ribosomal Protein Gene Family AT5G63070 63.0 1.5e-45 179.9
Cma01g00566 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT1G07770 98.5 1.9e-70 262.3
Cma15g00407 CST 1 130 Cytoplasmic Ribosomal Protein Gene Family AT1G07770 97.7 1.9e-70 262.3
Cma13g00156 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT1G07770 98.5 1.9e-70 262.3
Cma04g02626 CST 75 200 Cytoplasmic Ribosomal Protein Gene Family AT1G07770 95.2 6.8e-65 243.8
Cma08g00079 . 1 129 Cytoplasmic Ribosomal Protein Gene Family AT2G19720 80.6 4.2e-59 224.6
Cma15g00407 CST 1 130 Cytoplasmic Ribosomal Protein Gene Family AT2G39590 90.8 1.5e-64 242.7
Cma01g00566 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT2G39590 90.8 2.0e-64 242.3
Cma13g00156 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT2G39590 90.8 2.0e-64 242.3
Cma04g02626 CST 75 200 Cytoplasmic Ribosomal Protein Gene Family AT2G39590 88.1 1.1e-59 226.5
Cma01g00566 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT3G46040 98.5 1.9e-70 262.3
Cma15g00407 CST 1 130 Cytoplasmic Ribosomal Protein Gene Family AT3G46040 97.7 1.9e-70 262.3
Cma13g00156 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT3G46040 98.5 1.9e-70 262.3
Cma04g02626 CST 75 200 Cytoplasmic Ribosomal Protein Gene Family AT3G46040 95.2 6.8e-65 243.8
Cma08g00079 . 1 129 Cytoplasmic Ribosomal Protein Gene Family AT4G29430 81.4 2.5e-59 225.3
Cma01g00566 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT5G59850 98.5 1.9e-70 262.3
Cma15g00407 CST 1 130 Cytoplasmic Ribosomal Protein Gene Family AT5G59850 97.7 1.9e-70 262.3
Cma13g00156 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT5G59850 98.5 1.9e-70 262.3
Cma04g02626 CST 75 200 Cytoplasmic Ribosomal Protein Gene Family AT5G59850 95.2 6.8e-65 243.8
Cma11g01742 CST 6 144 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 89.2 1.3e-69 259.6
Cma04g00481 . 682 820 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 89.2 1.3e-69 259.6
Cma04g00510 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 89.2 1.3e-69 259.6
Cma19g00599 CST 6 144 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 89.2 1.3e-69 259.6
Cma16g00352 . 6 138 Cytoplasmic Ribosomal Protein Gene Family AT2G09990 89.5 1.8e-66 249.2
Cma11g01742 CST 6 144 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 84.9 1.5e-65 246.1
Cma04g00481 . 682 820 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 84.9 1.5e-65 246.1
Cma04g00510 . 6 144 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 84.9 1.5e-65 246.1
Cma19g00599 CST 6 144 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 84.9 1.5e-65 246.1
Cma16g00352 . 6 138 Cytoplasmic Ribosomal Protein Gene Family AT3G04230 84.2 6.1e-62 234.2
Cma11g01742 CST 6 113 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 86.1 2.1e-51 199.1
Cma04g00481 . 682 789 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 86.1 2.1e-51 199.1
Cma04g00510 . 6 113 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 86.1 2.1e-51 199.1
Cma19g00599 CST 6 113 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 86.1 2.1e-51 199.1
Cma16g00352 . 6 113 Cytoplasmic Ribosomal Protein Gene Family AT5G18380 86.1 2.1e-51 199.1
Cma04g02510 CST 1 131 Cytoplasmic Ribosomal Protein Gene Family AT2G04390 88.6 1.9e-57 219.2
Cma06g00499 . 1 138 Cytoplasmic Ribosomal Protein Gene Family AT2G04390 82.5 2.0e-54 209.1
Cma15g00529 CST 647 774 Cytoplasmic Ribosomal Protein Gene Family AT2G04390 85.9 4.5e-54 208.0
Cma04g02510 CST 1 131 Cytoplasmic Ribosomal Protein Gene Family AT2G05220 89.4 1.1e-57 219.9
Cma15g00529 CST 647 776 Cytoplasmic Ribosomal Protein Gene Family AT2G05220 86.2 1.5e-54 209.5
Cma06g00499 . 1 138 Cytoplasmic Ribosomal Protein Gene Family AT2G05220 81.9 2.0e-54 209.1
Cma04g02510 CST 1 140 Cytoplasmic Ribosomal Protein Gene Family AT3G10610 83.7 7.4e-57 217.2
Cma15g00529 CST 647 777 Cytoplasmic Ribosomal Protein Gene Family AT3G10610 84.7 1.4e-55 213.0
Cma06g00499 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT3G10610 81.4 4.5e-54 208.0
Cma04g02510 CST 1 131 Cytoplasmic Ribosomal Protein Gene Family AT5G04800 90.2 7.9e-59 223.8
Cma15g00529 CST 647 776 Cytoplasmic Ribosomal Protein Gene Family AT5G04800 86.9 1.1e-55 213.4
Cma06g00499 . 1 137 Cytoplasmic Ribosomal Protein Gene Family AT5G04800 82.5 5.3e-55 211.1
Cma01g00968 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G22780 96.7 2.1e-81 298.9
Cma15g00578 . 36 187 Cytoplasmic Ribosomal Protein Gene Family AT1G22780 96.1 4.6e-81 297.7
Cma04g02461 . 29 180 Cytoplasmic Ribosomal Protein Gene Family AT1G22780 96.1 4.6e-81 297.7
Cma09g01122 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G22780 96.1 4.6e-81 297.7
Cma01g00968 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G34030 96.7 2.1e-81 298.9
Cma15g00578 . 36 187 Cytoplasmic Ribosomal Protein Gene Family AT1G34030 96.1 4.6e-81 297.7
Cma04g02461 . 29 180 Cytoplasmic Ribosomal Protein Gene Family AT1G34030 96.1 4.6e-81 297.7
Cma09g01122 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G34030 96.1 4.6e-81 297.7
Cma01g00968 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT4G09800 96.7 2.1e-81 298.9
Cma15g00578 . 36 187 Cytoplasmic Ribosomal Protein Gene Family AT4G09800 96.1 4.6e-81 297.7
Cma04g02461 . 29 180 Cytoplasmic Ribosomal Protein Gene Family AT4G09800 96.1 4.6e-81 297.7
Cma09g01122 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT4G09800 96.1 4.6e-81 297.7
Cma04g02798 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT3G02080 85.3 2.7e-70 261.9
Cma15g00243 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT3G02080 84.6 5.9e-70 260.8
Cma08g00355 . 568 710 Cytoplasmic Ribosomal Protein Gene Family AT3G02080 84.6 5.9e-70 260.8
Cma17g01169 . 1 130 Cytoplasmic Ribosomal Protein Gene Family AT3G02080 78.3 1.3e-61 233.0
Cma04g02798 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT5G15520 87.1 8.6e-69 256.9
Cma15g00243 . 1 139 Cytoplasmic Ribosomal Protein Gene Family AT5G15520 86.3 1.9e-68 255.8
Cma08g00355 . 568 706 Cytoplasmic Ribosomal Protein Gene Family AT5G15520 86.3 1.9e-68 255.8
Cma17g01169 . 1 126 Cytoplasmic Ribosomal Protein Gene Family AT5G15520 80.6 1.1e-60 229.9
Cma15g00243 . 1 142 Cytoplasmic Ribosomal Protein Gene Family AT5G61170 87.3 2.7e-70 261.9
Cma04g02798 . 1 142 Cytoplasmic Ribosomal Protein Gene Family AT5G61170 86.6 5.9e-70 260.8
Cma08g00355 . 568 709 Cytoplasmic Ribosomal Protein Gene Family AT5G61170 85.9 1.3e-69 259.6
Cma17g01169 . 1 129 Cytoplasmic Ribosomal Protein Gene Family AT5G61170 78.2 1.9e-60 229.2
Cma15g01385 CCT,CST 2 121 Cytoplasmic Ribosomal Protein Gene Family AT3G45030 91.7 1.6e-55 212.6
Cma02g01014 CCT,CST 46 165 Cytoplasmic Ribosomal Protein Gene Family AT3G45030 91.7 1.6e-55 212.6
Cma04g00323 CCT 150 269 Cytoplasmic Ribosomal Protein Gene Family AT3G45030 90.8 6.1e-55 210.7
Cma16g00181 CST 234 345 Cytoplasmic Ribosomal Protein Gene Family AT3G45030 89.3 1.6e-50 196.1
Cma15g01385 CCT,CST 1 121 Cytoplasmic Ribosomal Protein Gene Family AT3G47370 92.6 1.4e-56 216.1
Cma02g01014 CCT,CST 45 165 Cytoplasmic Ribosomal Protein Gene Family AT3G47370 92.6 1.4e-56 216.1
Cma04g00323 CCT 149 269 Cytoplasmic Ribosomal Protein Gene Family AT3G47370 91.7 5.4e-56 214.2
Cma16g00181 CST 235 345 Cytoplasmic Ribosomal Protein Gene Family AT3G47370 91.9 1.8e-51 199.1
Cma15g01385 CCT,CST 2 121 Cytoplasmic Ribosomal Protein Gene Family AT5G62300 91.7 1.6e-55 212.6
Cma02g01014 CCT,CST 46 165 Cytoplasmic Ribosomal Protein Gene Family AT5G62300 91.7 1.6e-55 212.6
Cma04g00323 CCT 150 269 Cytoplasmic Ribosomal Protein Gene Family AT5G62300 90.8 6.1e-55 210.7
Cma16g00181 CST 234 345 Cytoplasmic Ribosomal Protein Gene Family AT5G62300 89.3 1.6e-50 196.1
Cma17g00323 . 1 82 Cytoplasmic Ribosomal Protein Gene Family AT5G27700 84.1 1.5e-38 155.6
Cma08g01225 . 1 81 Cytoplasmic Ribosomal Protein Gene Family AT5G27700 84.0 1.0e-37 152.9
Cma06g01498 . 1 81 Cytoplasmic Ribosomal Protein Gene Family AT5G27700 85.2 3.8e-37 151.0
Cma15g00432 CST 1 142 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 94.4 1.2e-70 263.1
Cma06g00356 CCT,CST,ECH 606 747 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 94.4 1.5e-70 262.7
Cma04g02602 CST 1 142 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 94.4 1.5e-70 262.7
Cma20g00464 . 50 191 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 94.4 1.5e-70 262.7
Cma14g00194 . 290 429 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 94.3 2.2e-69 258.8
Cma08g00776 . 16 155 Cytoplasmic Ribosomal Protein Gene Family AT3G09680 94.3 2.2e-69 258.8
Cma15g00432 CST 1 142 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 96.5 3.3e-73 271.6
Cma06g00356 CCT,CST,ECH 606 747 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 96.5 4.4e-73 271.2
Cma04g02602 CST 1 142 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 96.5 4.4e-73 271.2
Cma20g00464 . 50 191 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 96.5 4.4e-73 271.2
Cma14g00194 . 290 429 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 96.4 6.3e-72 267.3
Cma08g00776 . 16 155 Cytoplasmic Ribosomal Protein Gene Family AT5G02960 96.4 6.3e-72 267.3
Cma12g01106 CCT,CST 1 103 Cytoplasmic Ribosomal Protein Gene Family AT3G04920 85.6 1.4e-45 179.5
Cma11g00998 CCT 1 103 Cytoplasmic Ribosomal Protein Gene Family AT3G04920 85.6 4.0e-45 177.9
Cma05g01184 CCT,CST 1 148 Cytoplasmic Ribosomal Protein Gene Family AT3G04920 59.1 9.5e-39 156.8
Cma05g01184 CCT,CST 1 173 Cytoplasmic Ribosomal Protein Gene Family AT5G28060 63.6 8.8e-52 200.3
Cma12g01106 CCT,CST 1 108 Cytoplasmic Ribosomal Protein Gene Family AT5G28060 88.0 7.5e-51 197.2
Cma11g00998 CCT 1 108 Cytoplasmic Ribosomal Protein Gene Family AT5G28060 88.0 2.2e-50 195.7
Cma04g02518 . 379 485 Cytoplasmic Ribosomal Protein Gene Family AT4G34555 86.9 1.0e-37 153.3
Cma10g01095 . 1 107 Cytoplasmic Ribosomal Protein Gene Family AT4G34555 86.9 6.5e-37 150.6
Cma03g00092 . 1 107 Cytoplasmic Ribosomal Protein Gene Family AT4G34555 86.9 8.5e-37 150.2
Cma15g00162 CCT,CST,ECH 1 126 Cytoplasmic Ribosomal Protein Gene Family AT2G40510 85.7 7.7e-56 213.8
Cma04g01068 CCT,CST,ECH 222 344 Cytoplasmic Ribosomal Protein Gene Family AT2G40510 85.4 1.0e-55 213.4
Cma04g02867 CCT,CST,ECH 1 119 Cytoplasmic Ribosomal Protein Gene Family AT2G40510 85.7 1.1e-54 209.9
Cma04g00108 CCT,CST,ECH 1 127 Cytoplasmic Ribosomal Protein Gene Family AT2G40510 80.3 5.2e-52 201.1
Cma15g00162 CCT,CST,ECH 1 126 Cytoplasmic Ribosomal Protein Gene Family AT2G40590 85.7 3.4e-56 214.9
Cma04g01068 CCT,CST,ECH 222 347 Cytoplasmic Ribosomal Protein Gene Family AT2G40590 84.1 4.5e-56 214.5
Cma04g02867 CCT,CST,ECH 1 128 Cytoplasmic Ribosomal Protein Gene Family AT2G40590 82.9 2.2e-55 212.2
Cma04g00108 CCT,CST,ECH 1 127 Cytoplasmic Ribosomal Protein Gene Family AT2G40590 80.3 3.0e-52 201.8
Cma15g00162 CCT,CST,ECH 1 130 Cytoplasmic Ribosomal Protein Gene Family AT3G56340 83.1 7.6e-56 213.8
Cma04g01068 CCT,CST,ECH 222 342 Cytoplasmic Ribosomal Protein Gene Family AT3G56340 86.0 2.9e-55 211.8
Cma04g02867 CCT,CST,ECH 1 128 Cytoplasmic Ribosomal Protein Gene Family AT3G56340 82.8 4.9e-55 211.1
Cma04g00108 CCT,CST,ECH 1 125 Cytoplasmic Ribosomal Protein Gene Family AT3G56340 80.8 1.5e-51 199.5
Cma17g01393 . 55 138 Cytoplasmic Ribosomal Protein Gene Family AT2G45710 92.9 3.6e-43 171.0
Cma15g00803 . 337 420 Cytoplasmic Ribosomal Protein Gene Family AT2G45710 91.7 8.1e-43 169.9
Cma04g02227 . 21 103 Cytoplasmic Ribosomal Protein Gene Family AT2G45710 92.8 1.4e-42 169.1
Cma08g00026 . 318 400 Cytoplasmic Ribosomal Protein Gene Family AT2G45710 91.6 4.0e-42 167.5
Cma17g01393 . 55 140 Cytoplasmic Ribosomal Protein Gene Family AT3G61110 96.5 4.7e-46 180.6
Cma04g02227 . 21 105 Cytoplasmic Ribosomal Protein Gene Family AT3G61110 96.5 1.8e-45 178.7
Cma15g00803 . 337 420 Cytoplasmic Ribosomal Protein Gene Family AT3G61110 95.2 2.6e-44 174.9
Cma08g00026 . 318 401 Cytoplasmic Ribosomal Protein Gene Family AT3G61110 95.2 2.6e-44 174.9
Cma17g01393 . 55 138 Cytoplasmic Ribosomal Protein Gene Family AT5G47930 94.0 1.1e-42 169.5
Cma15g00803 . 337 420 Cytoplasmic Ribosomal Protein Gene Family AT5G47930 92.9 2.4e-42 168.3
Cma04g02227 . 21 103 Cytoplasmic Ribosomal Protein Gene Family AT5G47930 94.0 4.0e-42 167.5
Cma08g00026 . 318 400 Cytoplasmic Ribosomal Protein Gene Family AT5G47930 92.8 1.2e-41 166.0
Cma04g01742 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT1G23410 83.0 1.3e-65 246.5
Cma18g00790 . 79 231 Cytoplasmic Ribosomal Protein Gene Family AT1G23410 83.0 1.3e-65 246.5
Cma05g00023 . 1 152 Cytoplasmic Ribosomal Protein Gene Family AT1G23410 82.2 1.8e-64 242.7
Cma04g01742 . 1 154 Cytoplasmic Ribosomal Protein Gene Family AT3G62250 96.1 5.9e-71 264.2
Cma18g00790 . 79 232 Cytoplasmic Ribosomal Protein Gene Family AT3G62250 96.1 5.9e-71 264.2
Cma05g00023 . 1 154 Cytoplasmic Ribosomal Protein Gene Family AT3G62250 94.8 5.0e-70 261.2
Cma04g01125 CST,ECH 1 291 Cytoplasmic Ribosomal Protein Gene Family AT2G40010 86.3 1.7e-138 489.6
Cma04g00162 CST,ECH 2 289 Cytoplasmic Ribosomal Protein Gene Family AT2G40010 84.4 2.3e-135 479.2
Cma13g00073 . 1 279 Cytoplasmic Ribosomal Protein Gene Family AT2G40010 81.0 7.3e-129 457.6
Cma04g01125 CST,ECH 3 290 Cytoplasmic Ribosomal Protein Gene Family AT3G09200 77.5 2.0e-117 419.5
Cma04g00162 CST,ECH 1 289 Cytoplasmic Ribosomal Protein Gene Family AT3G09200 75.1 1.2e-114 410.2
Cma13g00073 . 2 279 Cytoplasmic Ribosomal Protein Gene Family AT3G09200 71.6 6.4e-108 387.9
Cma04g01125 CST,ECH 3 281 Cytoplasmic Ribosomal Protein Gene Family AT3G11250 89.2 1.8e-138 489.6
Cma04g00162 CST,ECH 1 280 Cytoplasmic Ribosomal Protein Gene Family AT3G11250 87.9 1.3e-136 483.4
Cma13g00073 . 2 278 Cytoplasmic Ribosomal Protein Gene Family AT3G11250 81.2 4.4e-129 458.4
Cma01g00901 . 1 387 Cytoplasmic Ribosomal Protein Gene Family AT1G43170 86.3 2.2e-199 692.2
Cma09g01182 . 1 387 Cytoplasmic Ribosomal Protein Gene Family AT1G43170 86.6 2.8e-199 691.8
Cma04g01864 . 11 377 Cytoplasmic Ribosomal Protein Gene Family AT1G43170 80.1 2.8e-183 638.6
Cma01g00901 . 1 389 Cytoplasmic Ribosomal Protein Gene Family AT1G61580 86.4 9.1e-198 686.8
Cma09g01182 . 1 389 Cytoplasmic Ribosomal Protein Gene Family AT1G61580 85.9 1.0e-196 683.3
Cma04g01864 . 11 376 Cytoplasmic Ribosomal Protein Gene Family AT1G61580 85.0 2.0e-189 659.1
Cma07g00940 . 1 406 Cytoplasmic Ribosomal Protein Gene Family AT3G09630 83.3 1.2e-192 669.8
Cma06g00345 . 1 406 Cytoplasmic Ribosomal Protein Gene Family AT3G09630 82.5 2.7e-192 668.7
Cma03g01256 . 2 405 Cytoplasmic Ribosomal Protein Gene Family AT3G09630 82.7 2.3e-191 665.6
Cma14g00185 . 383 816 Cytoplasmic Ribosomal Protein Gene Family AT3G09630 76.0 1.8e-185 646.0
Cma06g00345 . 1 406 Cytoplasmic Ribosomal Protein Gene Family AT5G02870 82.3 5.4e-193 671.0
Cma07g00940 . 1 406 Cytoplasmic Ribosomal Protein Gene Family AT5G02870 83.3 5.4e-193 671.0
Cma03g01256 . 2 405 Cytoplasmic Ribosomal Protein Gene Family AT5G02870 82.2 5.0e-191 664.5
Cma14g00185 . 383 816 Cytoplasmic Ribosomal Protein Gene Family AT5G02870 75.8 3.2e-185 645.2
Cma18g00678 . 1 290 Cytoplasmic Ribosomal Protein Gene Family AT3G25520 81.7 3.4e-136 481.9
Cma04g01850 . 1 288 Cytoplasmic Ribosomal Protein Gene Family AT3G25520 80.9 1.4e-134 476.5
Cma12g00086 . 1 311 Cytoplasmic Ribosomal Protein Gene Family AT3G25520 75.2 9.7e-131 463.8
Cma05g00430 . 1 292 Cytoplasmic Ribosomal Protein Gene Family AT3G25520 77.1 3.1e-129 458.8
Cma18g00678 . 1 290 Cytoplasmic Ribosomal Protein Gene Family AT5G39740 80.7 4.2e-134 474.9
Cma04g01850 . 1 288 Cytoplasmic Ribosomal Protein Gene Family AT5G39740 79.9 1.8e-132 469.5
Cma12g00086 . 1 311 Cytoplasmic Ribosomal Protein Gene Family AT5G39740 75.6 7.4e-131 464.2
Cma05g00430 . 1 292 Cytoplasmic Ribosomal Protein Gene Family AT5G39740 77.1 4.5e-128 454.9
Cma14g01022 CCT,CST 2 231 Cytoplasmic Ribosomal Protein Gene Family AT1G18540 81.7 2.3e-103 372.5
Cma08g00548 CCT 2 231 Cytoplasmic Ribosomal Protein Gene Family AT1G18540 82.6 2.3e-103 372.5
Cma01g00211 CCT,CST 2 231 Cytoplasmic Ribosomal Protein Gene Family AT1G18540 80.4 1.2e-101 366.7
Cma17g00938 CST 2 223 Cytoplasmic Ribosomal Protein Gene Family AT1G18540 80.6 1.1e-94 343.6
Cma14g01022 CCT,CST 4 231 Cytoplasmic Ribosomal Protein Gene Family AT1G74060 82.5 1.0e-103 373.6
Cma01g00211 CCT,CST 4 231 Cytoplasmic Ribosomal Protein Gene Family AT1G74060 82.0 6.6e-103 370.9
Cma08g00548 CCT 4 231 Cytoplasmic Ribosomal Protein Gene Family AT1G74060 81.6 8.1e-101 364.0
Cma17g00938 CST 4 223 Cytoplasmic Ribosomal Protein Gene Family AT1G74060 80.5 2.1e-93 339.3
Cma14g01022 CCT,CST 4 231 Cytoplasmic Ribosomal Protein Gene Family AT1G74050 82.5 2.3e-103 372.5
Cma01g00211 CCT,CST 7 231 Cytoplasmic Ribosomal Protein Gene Family AT1G74050 83.1 1.5e-102 369.8
Cma08g00548 CCT 4 231 Cytoplasmic Ribosomal Protein Gene Family AT1G74050 82.5 5.6e-102 367.9
Cma17g00938 CST 4 223 Cytoplasmic Ribosomal Protein Gene Family AT1G74050 81.4 1.5e-94 343.2
Cma06g00066 . 1 246 Cytoplasmic Ribosomal Protein Gene Family AT1G80750 57.5 2.0e-73 273.1
Cma10g00369 CST 306 481 Cytoplasmic Ribosomal Protein Gene Family AT2G01250 81.3 4.3e-73 271.6
Cma14g01194 . 4 178 Cytoplasmic Ribosomal Protein Gene Family AT2G01250 82.3 5.6e-73 271.2
Cma11g00355 CST 416 586 Cytoplasmic Ribosomal Protein Gene Family AT2G01250 82.5 2.1e-72 269.2
Cma01g00008 . 4 174 Cytoplasmic Ribosomal Protein Gene Family AT2G01250 66.9 1.9e-52 203.0
Cma14g01194 . 4 243 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 84.2 6.7e-114 407.5
Cma11g00355 CST 416 651 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 85.6 1.7e-112 402.9
Cma10g00369 CST 303 528 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 83.6 8.3e-104 374.0
Cma01g00008 . 4 214 Cytoplasmic Ribosomal Protein Gene Family AT2G44120 68.4 1.8e-74 276.6
Cma11g00355 CST 416 651 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 87.3 5.5e-116 414.5
Cma14g01194 . 4 243 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 85.0 1.0e-114 410.2
Cma10g00369 CST 311 528 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 87.2 2.5e-105 379.0
Cma01g00008 . 4 214 Cytoplasmic Ribosomal Protein Gene Family AT3G13580 69.8 7.2e-76 281.2
Cma14g00733 CST 1 257 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 85.6 4.1e-122 434.9
Cma15g01391 . 1 257 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 85.2 9.1e-122 433.7
Cma15g01390 . 3 258 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 84.0 2.3e-120 429.1
Cma02g01019 . 23 278 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 85.6 2.3e-120 429.1
Cma11g01523 CST 1 214 Cytoplasmic Ribosomal Protein Gene Family AT2G47610 85.0 4.4e-100 361.7
Cma15g01391 . 1 257 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 85.6 1.8e-122 436.0
Cma14g00733 CST 1 257 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 85.2 4.1e-122 434.9
Cma02g01019 . 23 278 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 85.5 9.1e-122 433.7
Cma15g01390 . 3 258 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 84.4 4.5e-121 431.4
Cma11g01523 CST 1 214 Cytoplasmic Ribosomal Protein Gene Family AT3G62870 84.1 8.3e-99 357.5
Cma07g00436 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT2G18020 92.6 4.0e-141 498.0
Cma09g00914 CST 1 258 Cytoplasmic Ribosomal Protein Gene Family AT2G18020 91.9 1.2e-140 496.5
Cma01g01163 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT2G18020 92.2 2.6e-140 495.4
Cma03g00695 . 1 246 Cytoplasmic Ribosomal Protein Gene Family AT2G18020 82.6 3.9e-120 428.3
Cma07g00436 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT3G51190 84.6 2.5e-127 452.2
Cma01g01163 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT3G51190 83.4 1.1e-125 446.8
Cma09g00914 CST 1 258 Cytoplasmic Ribosomal Protein Gene Family AT3G51190 82.2 2.6e-124 442.2
Cma03g00695 . 1 246 Cytoplasmic Ribosomal Protein Gene Family AT3G51190 73.7 3.9e-104 375.2
Cma07g00436 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT4G36130 93.4 1.1e-143 506.5
Cma01g01163 . 1 258 Cytoplasmic Ribosomal Protein Gene Family AT4G36130 93.0 7.2e-143 503.8
Cma09g00914 CST 1 258 Cytoplasmic Ribosomal Protein Gene Family AT4G36130 91.1 8.8e-141 496.9
Cma03g00695 . 1 246 Cytoplasmic Ribosomal Protein Gene Family AT4G36130 82.2 7.8e-121 430.6
Cma18g01348 CST 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33120 85.1 4.8e-91 331.3
Cma02g01085 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33120 84.5 8.2e-91 330.5
Cma15g01065 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33120 84.0 3.1e-90 328.6
Cma16g00008 CST 1 191 Cytoplasmic Ribosomal Protein Gene Family AT1G33120 84.8 1.6e-89 326.2
Cma18g01348 CST 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33140 85.1 4.8e-91 331.3
Cma02g01085 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33140 84.5 8.2e-91 330.5
Cma15g01065 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G33140 84.0 3.1e-90 328.6
Cma16g00008 CST 1 191 Cytoplasmic Ribosomal Protein Gene Family AT1G33140 84.8 1.6e-89 326.2
Cma16g00008 CST 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G10450 82.5 1.5e-75 279.6
Cma02g01085 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G10450 83.1 5.7e-75 277.7
Cma18g01348 CST 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G10450 81.3 1.7e-74 276.2
Cma15g01065 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G10450 81.9 4.8e-74 274.6
Cma04g00651 . 68 246 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 59.2 6.4e-52 200.7
Cma20g01052 . 38 216 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 58.1 2.4e-51 198.7
Cma02g00642 . 38 216 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 58.1 2.4e-51 198.7
Cma04g02854 . 38 217 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 57.8 4.2e-51 198.0
Cma16g00451 . 38 216 Cytoplasmic Ribosomal Protein Gene Family AT1G14320 58.1 7.1e-51 197.2
Cma04g00651 . 68 250 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 88.0 1.4e-92 336.3
Cma20g01052 . 38 220 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 86.9 9.2e-92 333.6
Cma16g00451 . 38 220 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 86.9 2.7e-91 332.0
Cma02g00642 . 38 220 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 86.3 4.6e-91 331.3
Cma04g02854 . 38 216 Cytoplasmic Ribosomal Protein Gene Family AT1G26910 87.7 1.3e-90 329.7
Cma16g00451 . 1 220 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 88.6 2.3e-113 405.6
Cma04g00651 . 31 247 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 89.4 5.1e-113 404.4
Cma04g02854 . 1 216 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 89.4 3.3e-112 401.7
Cma20g01052 . 1 217 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 88.0 9.6e-112 400.2
Cma02g00642 . 1 217 Cytoplasmic Ribosomal Protein Gene Family AT1G66580 87.6 4.8e-111 397.9
Cma13g00306 . 1 216 Cytoplasmic Ribosomal Protein Gene Family AT1G08360 88.4 5.5e-104 374.4
Cma02g01330 . 1 200 Cytoplasmic Ribosomal Protein Gene Family AT1G08360 89.5 5.0e-97 351.3
Cma20g00171 CST 117 350 Cytoplasmic Ribosomal Protein Gene Family AT1G08360 76.9 1.1e-91 333.6
Cma18g00657 . 27 221 Cytoplasmic Ribosomal Protein Gene Family AT1G08360 87.0 1.4e-91 333.2
Cma13g00306 . 1 216 Cytoplasmic Ribosomal Protein Gene Family AT2G27530 87.5 4.0e-102 368.2
Cma02g01330 . 1 200 Cytoplasmic Ribosomal Protein Gene Family AT2G27530 88.5 3.6e-95 345.1
Cma20g00171 CST 117 350 Cytoplasmic Ribosomal Protein Gene Family AT2G27530 76.1 7.8e-90 327.4
Cma18g00657 . 27 221 Cytoplasmic Ribosomal Protein Gene Family AT2G27530 85.5 1.7e-89 326.2
Cma13g00306 . 1 216 Cytoplasmic Ribosomal Protein Gene Family AT5G22440 89.4 1.9e-104 375.9
Cma02g01330 . 1 200 Cytoplasmic Ribosomal Protein Gene Family AT5G22440 89.1 7.3e-96 347.4
Cma18g00657 . 27 221 Cytoplasmic Ribosomal Protein Gene Family AT5G22440 87.1 6.4e-92 334.3
Cma20g00171 CST 117 350 Cytoplasmic Ribosomal Protein Gene Family AT5G22440 76.6 1.6e-90 329.7
Cma07g00177 CST 273 453 Cytoplasmic Ribosomal Protein Gene Family AT2G42740 96.1 7.2e-97 350.5
Cma03g01329 CST 233 413 Cytoplasmic Ribosomal Protein Gene Family AT2G42740 95.6 1.6e-96 349.4
Cma19g01011 CST 36 202 Cytoplasmic Ribosomal Protein Gene Family AT2G42740 95.2 1.2e-88 323.2
Cma11g01901 CST 1 167 Cytoplasmic Ribosomal Protein Gene Family AT2G42740 94.6 1.0e-87 320.1
Cma07g00177 CST 273 453 Cytoplasmic Ribosomal Protein Gene Family AT3G58700 96.1 7.2e-97 350.5
Cma03g01329 CST 233 413 Cytoplasmic Ribosomal Protein Gene Family AT3G58700 95.6 1.6e-96 349.4
Cma19g01011 CST 36 202 Cytoplasmic Ribosomal Protein Gene Family AT3G58700 95.2 1.2e-88 323.2
Cma11g01901 CST 1 167 Cytoplasmic Ribosomal Protein Gene Family AT3G58700 94.6 1.0e-87 320.1
Cma07g00177 CST 273 453 Cytoplasmic Ribosomal Protein Gene Family AT4G18730 96.1 7.2e-97 350.5
Cma03g01329 CST 233 413 Cytoplasmic Ribosomal Protein Gene Family AT4G18730 95.6 1.6e-96 349.4
Cma19g01011 CST 36 202 Cytoplasmic Ribosomal Protein Gene Family AT4G18730 95.2 1.2e-88 323.2
Cma11g01901 CST 1 167 Cytoplasmic Ribosomal Protein Gene Family AT4G18730 94.6 1.0e-87 320.1
Cma07g00177 CST 273 453 Cytoplasmic Ribosomal Protein Gene Family AT5G45775 96.1 7.2e-97 350.5
Cma03g01329 CST 233 413 Cytoplasmic Ribosomal Protein Gene Family AT5G45775 95.6 1.6e-96 349.4
Cma19g01011 CST 36 202 Cytoplasmic Ribosomal Protein Gene Family AT5G45775 95.2 1.2e-88 323.2
Cma11g01901 CST 1 167 Cytoplasmic Ribosomal Protein Gene Family AT5G45775 94.6 1.0e-87 320.1
Cma07g00925 CCT,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT2G37190 89.8 1.3e-81 299.7
Cma14g00209 CCT,CST,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT2G37190 89.2 2.3e-81 298.9
Cma06g00376 CCT,CST,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT2G37190 88.6 3.0e-81 298.5
Cma07g00925 CCT,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G53430 89.2 1.3e-81 299.7
Cma14g00209 CCT,CST,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G53430 88.6 2.3e-81 298.9
Cma06g00376 CCT,CST,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G53430 88.0 3.0e-81 298.5
Cma06g00376 CCT,CST,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT5G60670 88.6 1.3e-81 299.7
Cma14g00209 CCT,CST,ECH 1 166 Cytoplasmic Ribosomal Protein Gene Family AT5G60670 88.6 3.9e-81 298.1
Cma07g00925 CCT,ECH 1 164 Cytoplasmic Ribosomal Protein Gene Family AT5G60670 89.6 1.1e-80 296.6
Cma16g00233 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G49010 85.0 4.1e-96 348.2
Cma04g00376 . 24 229 Cytoplasmic Ribosomal Protein Gene Family AT3G49010 84.5 6.9e-96 347.4
Cma02g00991 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G49010 83.0 8.5e-94 340.5
Cma15g01370 . 1039 1208 Cytoplasmic Ribosomal Protein Gene Family AT3G49010 80.6 4.1e-72 268.5
Cma16g00233 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G48960 74.3 6.7e-83 304.3
Cma04g00376 . 24 229 Cytoplasmic Ribosomal Protein Gene Family AT3G48960 73.8 1.1e-82 303.5
Cma02g00991 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G48960 73.3 3.7e-81 298.5
Cma15g01370 . 1039 1208 Cytoplasmic Ribosomal Protein Gene Family AT3G48960 72.4 3.1e-64 242.3
Cma16g00233 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT5G23900 83.0 7.6e-95 344.0
Cma04g00376 . 24 229 Cytoplasmic Ribosomal Protein Gene Family AT5G23900 82.5 1.3e-94 343.2
Cma02g00991 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT5G23900 83.0 1.3e-94 343.2
Cma15g01370 . 1039 1208 Cytoplasmic Ribosomal Protein Gene Family AT5G23900 81.2 1.1e-72 270.4
Cma08g01027 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G07110 87.4 4.5e-103 371.3
Cma06g01227 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G07110 87.4 1.0e-102 370.2
Cma14g01892 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G07110 87.0 1.7e-102 369.4
Cma17g00105 . 1 219 Cytoplasmic Ribosomal Protein Gene Family AT3G07110 81.4 1.5e-98 356.3
Cma06g01243 . 34 231 Cytoplasmic Ribosomal Protein Gene Family AT3G07110 86.4 1.7e-97 352.8
Cma08g01027 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G24830 89.3 2.4e-104 375.6
Cma14g01892 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G24830 88.8 3.1e-104 375.2
Cma06g01227 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT3G24830 88.8 1.2e-103 373.2
Cma17g00105 . 1 219 Cytoplasmic Ribosomal Protein Gene Family AT3G24830 82.6 7.9e-100 360.5
Cma06g01243 . 34 231 Cytoplasmic Ribosomal Protein Gene Family AT3G24830 88.9 3.0e-99 358.6
Cma08g01027 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT4G13170 87.9 2.4e-104 375.6
Cma06g01227 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT4G13170 87.4 9.0e-104 373.6
Cma14g01892 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT4G13170 86.4 4.5e-103 371.3
Cma17g00105 . 1 219 Cytoplasmic Ribosomal Protein Gene Family AT4G13170 81.7 4.6e-100 361.3
Cma06g01243 . 34 231 Cytoplasmic Ribosomal Protein Gene Family AT4G13170 86.4 1.5e-98 356.3
Cma08g01027 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT5G48760 89.3 2.5e-106 382.1
Cma06g01227 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT5G48760 89.8 5.6e-106 380.9
Cma14g01892 . 1 206 Cytoplasmic Ribosomal Protein Gene Family AT5G48760 88.8 2.1e-105 379.0
Cma17g00105 . 1 219 Cytoplasmic Ribosomal Protein Gene Family AT5G48760 83.1 4.9e-102 367.9
Cma06g01243 . 34 231 Cytoplasmic Ribosomal Protein Gene Family AT5G48760 89.9 1.9e-101 365.9
Cma08g01075 CST 842 971 Cytoplasmic Ribosomal Protein Gene Family AT2G20450 84.6 3.9e-55 211.5
Cma17g00153 CST 827 954 Cytoplasmic Ribosomal Protein Gene Family AT2G20450 85.2 6.6e-55 210.7
Cma14g01818 . 118 245 Cytoplasmic Ribosomal Protein Gene Family AT2G20450 83.6 7.3e-54 207.2
Cma06g01315 . 139 266 Cytoplasmic Ribosomal Protein Gene Family AT2G20450 83.6 1.6e-53 206.1
Cma08g01075 CST 842 971 Cytoplasmic Ribosomal Protein Gene Family AT4G27090 85.4 1.0e-55 213.4
Cma17g00153 CST 827 954 Cytoplasmic Ribosomal Protein Gene Family AT4G27090 85.9 1.7e-55 212.6
Cma14g01818 . 118 245 Cytoplasmic Ribosomal Protein Gene Family AT4G27090 84.4 1.9e-54 209.1
Cma06g01315 . 139 266 Cytoplasmic Ribosomal Protein Gene Family AT4G27090 84.4 4.3e-54 208.0
Cma15g01112 . 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G16720 91.2 7.3e-106 380.6
Cma04g00350 CCT 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G16720 90.7 9.5e-106 380.2
Cma02g01529 . 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G16720 91.2 9.5e-106 380.2
Cma16g00203 . 1 170 Cytoplasmic Ribosomal Protein Gene Family AT4G16720 92.4 6.6e-91 330.9
Cma15g01112 . 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G17390 91.7 8.6e-107 383.6
Cma04g00350 CCT 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G17390 91.2 1.1e-106 383.3
Cma02g01529 . 1 204 Cytoplasmic Ribosomal Protein Gene Family AT4G17390 91.7 1.1e-106 383.3
Cma16g00203 . 1 170 Cytoplasmic Ribosomal Protein Gene Family AT4G17390 92.4 6.6e-91 330.9
Cma18g00704 . 1 174 Cytoplasmic Ribosomal Protein Gene Family AT1G27400 90.2 3.8e-87 318.2
Cma05g00428 . 885 1058 Cytoplasmic Ribosomal Protein Gene Family AT1G27400 87.9 6.8e-84 307.4
Cma12g00073 . 933 1096 Cytoplasmic Ribosomal Protein Gene Family AT1G27400 88.4 3.3e-78 288.5
Cma04g01830 . 1 162 Cytoplasmic Ribosomal Protein Gene Family AT1G27400 77.8 6.8e-68 254.2
Cma18g00704 . 1 176 Cytoplasmic Ribosomal Protein Gene Family AT1G67430 67.0 1.4e-54 209.5
Cma05g00428 . 885 1060 Cytoplasmic Ribosomal Protein Gene Family AT1G67430 65.9 7.9e-53 203.8
Cma04g01830 . 1 105 Cytoplasmic Ribosomal Protein Gene Family AT1G67430 87.6 2.1e-50 195.7
Cma12g00073 . 936 1098 Cytoplasmic Ribosomal Protein Gene Family AT1G67430 65.0 2.9e-47 185.3
Cma12g01052 . 3 187 Cytoplasmic Ribosomal Protein Gene Family AT2G47570 79.0 7.7e-78 287.3
Cma05g01097 . 3 187 Cytoplasmic Ribosomal Protein Gene Family AT2G47570 78.5 1.7e-77 286.2
Cma11g01196 CST 30 214 Cytoplasmic Ribosomal Protein Gene Family AT2G47570 76.9 4.2e-76 281.6
Cma10g01132 CST 40 224 Cytoplasmic Ribosomal Protein Gene Family AT2G47570 75.8 2.7e-75 278.9
Cma12g01052 . 54 187 Cytoplasmic Ribosomal Protein Gene Family AT3G05590 86.6 5.9e-64 240.7
Cma05g01097 . 54 187 Cytoplasmic Ribosomal Protein Gene Family AT3G05590 86.6 5.9e-64 240.7
Cma11g01196 CST 81 214 Cytoplasmic Ribosomal Protein Gene Family AT3G05590 85.8 4.3e-62 234.6
Cma10g01132 CST 91 224 Cytoplasmic Ribosomal Protein Gene Family AT3G05590 84.3 2.8e-61 231.9
Cma12g01052 . 54 187 Cytoplasmic Ribosomal Protein Gene Family AT5G27850 85.8 5.0e-63 237.7
Cma05g01097 . 54 187 Cytoplasmic Ribosomal Protein Gene Family AT5G27850 85.8 5.0e-63 237.7
Cma11g01196 CST 81 214 Cytoplasmic Ribosomal Protein Gene Family AT5G27850 83.6 2.3e-60 228.8
Cma10g01132 CST 91 224 Cytoplasmic Ribosomal Protein Gene Family AT5G27850 82.1 1.5e-59 226.1
Cma13g00555 CST 674 852 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 90.5 8.3e-92 334.0
Cma09g00729 . 524 702 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 90.5 1.4e-91 333.2
Cma07g00115 . 1 178 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 90.4 9.2e-91 330.5
Cma03g01391 . 1 178 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 90.4 1.6e-90 329.7
Cma01g01314 . 1 177 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 90.4 6.0e-90 327.8
Cma18g00464 . 1 178 Cytoplasmic Ribosomal Protein Gene Family AT2G34480 89.3 7.8e-90 327.4
Cma13g00555 CST 678 852 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 90.9 5.8e-91 330.9
Cma07g00115 . 4 178 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 90.9 1.7e-90 329.3
Cma09g00729 . 528 702 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 90.9 1.7e-90 329.3
Cma03g01391 . 4 178 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 90.9 4.9e-90 327.8
Cma18g00464 . 1 178 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 88.8 1.1e-89 326.6
Cma01g01314 . 1 177 Cytoplasmic Ribosomal Protein Gene Family AT3G14600 89.3 2.4e-89 325.5
Cma01g00301 CST 1 193 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 90.7 4.8e-92 334.7
Cma08g00432 . 1 194 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 89.2 3.5e-90 328.6
Cma17g01077 CCT,ECH 1 186 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 91.9 1.7e-89 326.2
Cma14g00917 CST 1 197 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 88.8 2.2e-89 325.9
Cma10g00333 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT1G02780 72.3 4.0e-62 235.3
Cma08g00432 . 1 211 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 85.0 4.0e-91 331.6
Cma17g01077 CCT,ECH 1 186 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 91.4 9.8e-90 327.0
Cma01g00301 CST 1 209 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 84.4 1.3e-89 326.6
Cma14g00917 CST 1 186 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 90.9 6.4e-89 324.3
Cma10g00333 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT3G16780 69.3 5.6e-61 231.5
Cma01g00301 CST 1 209 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 85.6 5.2e-91 331.3
Cma08g00432 . 1 208 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 85.6 1.2e-90 330.1
Cma14g00917 CST 1 196 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 88.8 3.7e-89 325.1
Cma17g01077 CCT,ECH 1 191 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 90.6 8.3e-89 323.9
Cma10g00333 . 1 166 Cytoplasmic Ribosomal Protein Gene Family AT4G02230 72.3 6.6e-62 234.6
Cma06g00572 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G09590 85.4 2.2e-81 298.9
Cma14g00398 . 184 345 Cytoplasmic Ribosomal Protein Gene Family AT1G09590 86.4 3.8e-81 298.1
Cma06g00572 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G09690 85.4 2.2e-81 298.9
Cma14g00398 . 184 345 Cytoplasmic Ribosomal Protein Gene Family AT1G09690 86.4 3.8e-81 298.1
Cma06g00572 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G57660 85.4 7.7e-82 300.4
Cma14g00398 . 184 345 Cytoplasmic Ribosomal Protein Gene Family AT1G57660 85.8 5.0e-81 297.7
Cma06g00572 . 1 164 Cytoplasmic Ribosomal Protein Gene Family AT1G57860 85.4 7.7e-82 300.4
Cma14g00398 . 184 345 Cytoplasmic Ribosomal Protein Gene Family AT1G57860 85.8 5.0e-81 297.7
Cma17g01085 CST 1 117 Cytoplasmic Ribosomal Protein Gene Family AT1G02830 71.8 1.0e-41 166.8
Cma08g00425 CST 1 117 Cytoplasmic Ribosomal Protein Gene Family AT1G02830 72.6 1.0e-41 166.8
Cma11g01141 . 1 115 Cytoplasmic Ribosomal Protein Gene Family AT1G02830 71.8 2.5e-40 162.2
Cma10g01122 . 37 151 Cytoplasmic Ribosomal Protein Gene Family AT1G02830 70.9 5.7e-40 161.0
Cma11g01141 . 1 124 Cytoplasmic Ribosomal Protein Gene Family AT3G05560 89.5 4.5e-58 221.1
Cma10g01122 . 37 160 Cytoplasmic Ribosomal Protein Gene Family AT3G05560 88.7 1.0e-57 219.9
Cma17g01085 CST 1 126 Cytoplasmic Ribosomal Protein Gene Family AT3G05560 82.5 1.2e-53 206.5
Cma08g00425 CST 1 126 Cytoplasmic Ribosomal Protein Gene Family AT3G05560 83.3 1.2e-53 206.5
Cma11g01141 . 1 124 Cytoplasmic Ribosomal Protein Gene Family AT5G27770 88.7 6.5e-57 217.2
Cma10g01122 . 37 160 Cytoplasmic Ribosomal Protein Gene Family AT5G27770 87.9 1.5e-56 216.1
Cma17g01085 CST 1 126 Cytoplasmic Ribosomal Protein Gene Family AT5G27770 81.0 3.7e-52 201.4
Cma08g00425 CST 1 126 Cytoplasmic Ribosomal Protein Gene Family AT5G27770 81.7 3.7e-52 201.4
Cma19g00113 CCT,CST,ECH 1 140 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 98.6 2.4e-76 282.0
Cma08g01062 . 1 140 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 98.6 2.4e-76 282.0
Cma02g01722 CCT,CST,ECH 404 543 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 98.6 2.4e-76 282.0
Cma08g00039 CCT,CST,ECH 1 140 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 98.6 2.4e-76 282.0
Cma17g01378 CCT,CST,ECH 925 1060 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 98.5 3.9e-74 274.6
Cma17g00142 CST 455 590 Cytoplasmic Ribosomal Protein Gene Family AT1G04480 98.5 3.9e-74 274.6
Cma17g01378 CCT,CST,ECH 936 1060 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 100.0 1.3e-68 256.1
Cma19g00113 CCT,CST,ECH 16 140 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 100.0 1.3e-68 256.1
Cma17g00142 CST 466 590 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 100.0 1.3e-68 256.1
Cma08g01062 . 16 140 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 100.0 1.3e-68 256.1
Cma02g01722 CCT,CST,ECH 419 543 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 100.0 1.3e-68 256.1
Cma08g00039 CCT,CST,ECH 16 140 Cytoplasmic Ribosomal Protein Gene Family AT2G33370 100.0 1.3e-68 256.1
Cma17g01378 CCT,CST,ECH 936 1060 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 100.0 1.3e-68 256.1
Cma19g00113 CCT,CST,ECH 16 140 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 100.0 1.3e-68 256.1
Cma17g00142 CST 466 590 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 100.0 1.3e-68 256.1
Cma08g01062 . 16 140 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 100.0 1.3e-68 256.1
Cma02g01722 CCT,CST,ECH 419 543 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 100.0 1.3e-68 256.1
Cma08g00039 CCT,CST,ECH 16 140 Cytoplasmic Ribosomal Protein Gene Family AT3G04400 100.0 1.3e-68 256.1
Cma04g00232 CST 871 1023 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 79.2 3.0e-59 225.3
Cma04g01206 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 78.6 1.9e-58 222.6
Cma04g02609 . 44 152 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 94.5 1.0e-51 200.3
Cma04g00002 . 1086 1192 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 92.5 4.3e-50 194.9
Cma15g00414 . 1 153 Cytoplasmic Ribosomal Protein Gene Family AT2G39460 61.0 2.6e-39 159.1
Cma04g00232 CST 874 1023 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 86.7 6.6e-64 240.7
Cma04g01206 . 4 153 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 85.3 3.6e-62 235.0
Cma04g02609 . 4 152 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 82.6 2.4e-58 222.2
Cma04g00002 . 1044 1192 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 76.5 6.8e-53 204.1
Cma15g00414 . 4 153 Cytoplasmic Ribosomal Protein Gene Family AT3G55280 67.3 7.5e-44 174.1
Cma06g00430 CCT,CST,ECH 1 164 Cytoplasmic Ribosomal Protein Gene Family AT2G36620 87.2 1.9e-72 269.2
Cma14g00256 CCT,CST,ECH 5 167 Cytoplasmic Ribosomal Protein Gene Family AT2G36620 82.2 1.4e-67 253.1
Cma07g00875 CCT,ECH 1 165 Cytoplasmic Ribosomal Protein Gene Family AT2G36620 81.8 5.0e-65 244.6
Cma03g01183 . 512 671 Cytoplasmic Ribosomal Protein Gene Family AT2G36620 76.3 6.0e-58 221.1
Cma06g00430 CCT,CST,ECH 1 164 Cytoplasmic Ribosomal Protein Gene Family AT3G53020 87.3 5.2e-70 261.2
Cma14g00256 CCT,CST,ECH 5 167 Cytoplasmic Ribosomal Protein Gene Family AT3G53020 83.5 1.2e-66 250.0
Cma07g00875 CCT,ECH 1 165 Cytoplasmic Ribosomal Protein Gene Family AT3G53020 83.0 1.7e-65 246.1
Cma03g01183 . 512 671 Cytoplasmic Ribosomal Protein Gene Family AT3G53020 77.6 1.5e-56 216.5
Cma09g00159 . 1 168 Cytoplasmic Ribosomal Protein Gene Family AT2G44860 69.6 1.6e-60 229.6
Cma06g00450 . 1 168 Cytoplasmic Ribosomal Protein Gene Family AT2G44860 60.7 3.8e-49 191.8
Cma03g00915 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT3G49910 87.7 2.8e-67 251.9
Cma20g01015 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT3G49910 85.6 3.1e-66 248.4
Cma02g00538 . 257 402 Cytoplasmic Ribosomal Protein Gene Family AT3G49910 84.2 9.0e-66 246.9
Cma02g00538 . 257 402 Cytoplasmic Ribosomal Protein Gene Family AT5G67510 84.2 4.5e-65 244.6
Cma20g01015 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT5G67510 83.6 1.3e-64 243.0
Cma03g00915 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT5G67510 83.6 1.7e-64 242.7
Cma04g00617 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT2G32220 76.3 1.3e-55 213.0
Cma16g00485 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT2G32220 74.8 1.7e-55 212.6
Cma04g00616 CCT,CST 1 135 Cytoplasmic Ribosomal Protein Gene Family AT2G32220 74.8 3.9e-55 211.5
Cma16g00486 CCT,CST 1 135 Cytoplasmic Ribosomal Protein Gene Family AT2G32220 74.1 8.7e-55 210.3
Cma01g01332 CCT 1 135 Cytoplasmic Ribosomal Protein Gene Family AT2G32220 73.3 1.6e-53 206.1
Cma04g00617 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT3G22230 85.9 4.7e-61 231.1
Cma04g00616 CCT,CST 1 135 Cytoplasmic Ribosomal Protein Gene Family AT3G22230 84.4 6.2e-61 230.7
Cma16g00485 . 1 135 Cytoplasmic Ribosomal Protein Gene Family AT3G22230 83.7 8.1e-61 230.3
Cma16g00486 CCT,CST 1 135 Cytoplasmic Ribosomal Protein Gene Family AT3G22230 83.7 1.4e-60 229.6
Cma01g01332 CCT 1 135 Cytoplasmic Ribosomal Protein Gene Family AT3G22230 78.5 2.1e-56 215.7
Cma04g00616 CCT,CST 1 123 Cytoplasmic Ribosomal Protein Gene Family AT4G15000 82.9 3.5e-53 204.9
Cma16g00486 CCT,CST 1 123 Cytoplasmic Ribosomal Protein Gene Family AT4G15000 82.9 3.5e-53 204.9
Cma16g00485 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT4G15000 82.1 4.6e-53 204.5
Cma04g00617 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT4G15000 83.7 7.9e-53 203.8
Cma01g01332 CCT 1 123 Cytoplasmic Ribosomal Protein Gene Family AT4G15000 79.7 4.3e-51 198.0
Cma18g00773 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT1G23290 80.8 3.3e-60 228.4
Cma13g00863 CST 1 146 Cytoplasmic Ribosomal Protein Gene Family AT1G23290 81.5 1.7e-59 226.1
Cma18g00188 CST 1 143 Cytoplasmic Ribosomal Protein Gene Family AT1G23290 81.8 1.8e-58 222.6
Cma18g00773 . 1 146 Cytoplasmic Ribosomal Protein Gene Family AT1G70600 82.2 7.9e-62 233.8
Cma13g00863 CST 1 146 Cytoplasmic Ribosomal Protein Gene Family AT1G70600 82.9 3.9e-61 231.5
Cma18g00188 CST 1 143 Cytoplasmic Ribosomal Protein Gene Family AT1G70600 83.2 4.3e-60 228.0
Cma05g01390 . 269 411 Cytoplasmic Ribosomal Protein Gene Family AT2G19730 72.7 4.6e-54 208.0
Cma14g01276 . 40 182 Cytoplasmic Ribosomal Protein Gene Family AT2G19730 74.1 7.8e-54 207.2
Cma01g00076 CCT,CST 840 982 Cytoplasmic Ribosomal Protein Gene Family AT2G19730 72.7 6.6e-53 204.1
Cma12g01289 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT2G19730 71.3 1.2e-51 199.9
Cma14g01276 . 40 182 Cytoplasmic Ribosomal Protein Gene Family AT4G29410 76.2 2.9e-56 215.3
Cma01g00076 CCT,CST 840 982 Cytoplasmic Ribosomal Protein Gene Family AT4G29410 74.1 7.0e-55 210.7
Cma05g01390 . 269 411 Cytoplasmic Ribosomal Protein Gene Family AT4G29410 72.0 2.7e-54 208.8
Cma12g01289 . 1 143 Cytoplasmic Ribosomal Protein Gene Family AT4G29410 71.3 3.3e-52 201.8
Cma11g00811 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G36240 85.7 8.8e-53 203.4
Cma15g00728 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G36240 83.9 1.5e-52 202.6
Cma10g00978 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G36240 84.8 2.6e-52 201.8
Cma04g02312 . 1 109 Cytoplasmic Ribosomal Protein Gene Family AT1G36240 84.4 1.1e-50 196.4
Cma11g00811 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G77940 84.8 3.3e-52 201.4
Cma15g00728 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G77940 82.1 5.7e-52 200.7
Cma10g00978 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G77940 83.0 1.3e-51 199.5
Cma04g02312 . 1 109 Cytoplasmic Ribosomal Protein Gene Family AT1G77940 82.6 4.1e-50 194.5
Cma11g00811 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT3G18740 83.0 2.8e-51 198.4
Cma15g00728 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT3G18740 81.3 4.8e-51 197.6
Cma10g00978 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT3G18740 82.1 8.2e-51 196.8
Cma04g02312 . 1 109 Cytoplasmic Ribosomal Protein Gene Family AT3G18740 81.7 3.5e-49 191.4
Cma10g00697 . 50 168 Cytoplasmic Ribosomal Protein Gene Family AT2G19740 84.9 5.1e-51 197.6
Cma12g01288 . 2 120 Cytoplasmic Ribosomal Protein Gene Family AT2G19740 84.0 6.7e-51 197.2
Cma05g01388 . 1008 1102 Cytoplasmic Ribosomal Protein Gene Family AT2G19740 84.2 3.8e-38 154.8
Cma11g00674 . 1173 1269 Cytoplasmic Ribosomal Protein Gene Family AT2G19740 83.5 8.5e-38 153.7
Cma10g00697 . 54 168 Cytoplasmic Ribosomal Protein Gene Family AT4G26230 87.0 3.9e-51 198.0
Cma12g01288 . 6 120 Cytoplasmic Ribosomal Protein Gene Family AT4G26230 86.1 5.1e-51 197.6
Cma05g01388 . 1008 1102 Cytoplasmic Ribosomal Protein Gene Family AT4G26230 85.3 3.5e-39 158.3
Cma11g00674 . 1173 1269 Cytoplasmic Ribosomal Protein Gene Family AT4G26230 84.5 7.7e-39 157.1
Cma13g00568 CCT,CST 669 801 Cytoplasmic Ribosomal Protein Gene Family AT4G18100 87.2 2.5e-62 235.3
Cma18g00451 CCT,CST 1 119 Cytoplasmic Ribosomal Protein Gene Family AT4G18100 84.9 1.5e-54 209.5
Cma03g01366 CCT,CST 1 120 Cytoplasmic Ribosomal Protein Gene Family AT4G18100 80.2 4.4e-51 198.0
Cma07g00143 CCT,CST 1 116 Cytoplasmic Ribosomal Protein Gene Family AT4G18100 75.2 7.0e-49 190.7
Cma13g00568 CCT,CST 669 801 Cytoplasmic Ribosomal Protein Gene Family AT5G46430 85.0 1.2e-61 233.0
Cma18g00451 CCT,CST 1 119 Cytoplasmic Ribosomal Protein Gene Family AT5G46430 83.2 2.5e-54 208.8
Cma03g01366 CCT,CST 1 120 Cytoplasmic Ribosomal Protein Gene Family AT5G46430 77.8 1.7e-50 196.1
Cma07g00143 CCT,CST 1 116 Cytoplasmic Ribosomal Protein Gene Family AT5G46430 73.7 2.7e-48 188.7
Cma15g00274 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 92.4 6.4e-44 173.7
Cma12g00800 . 30 121 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 91.3 1.1e-43 172.9
Cma11g00148 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 91.3 1.1e-43 172.9
Cma10g00187 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 90.2 2.4e-43 171.8
Cma13g00270 . 1 95 Cytoplasmic Ribosomal Protein Gene Family AT1G26880 88.4 4.6e-42 167.5
Cma15g00274 . 1 119 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 92.4 1.2e-55 213.0
Cma12g00800 . 30 148 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 91.6 1.5e-55 212.6
Cma11g00148 . 1 119 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 91.6 1.5e-55 212.6
Cma10g00187 . 1 119 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 90.8 3.4e-55 211.5
Cma13g00270 . 1 122 Cytoplasmic Ribosomal Protein Gene Family AT1G69620 89.3 6.5e-54 207.2
Cma12g00800 . 30 149 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 90.8 3.5e-55 211.5
Cma11g00148 . 1 120 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 90.8 3.5e-55 211.5
Cma15g00274 . 1 120 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 91.7 4.5e-55 211.1
Cma10g00187 . 1 120 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 90.0 7.7e-55 210.3
Cma13g00270 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT3G28900 88.6 1.5e-53 206.1
Cma04g01214 . 1232 1354 Cytoplasmic Ribosomal Protein Gene Family AT3G09500 90.2 6.3e-52 200.7
Cma15g00416 . 618 739 Cytoplasmic Ribosomal Protein Gene Family AT3G09500 90.2 2.4e-51 198.7
Cma04g02614 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT3G09500 88.6 1.5e-50 196.1
Cma04g00242 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT3G09500 88.6 2.0e-50 195.7
Cma04g01214 . 1232 1354 Cytoplasmic Ribosomal Protein Gene Family AT2G39390 91.1 1.6e-52 202.6
Cma15g00416 . 618 739 Cytoplasmic Ribosomal Protein Gene Family AT2G39390 91.0 6.3e-52 200.7
Cma04g02614 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT2G39390 89.4 4.1e-51 198.0
Cma04g00242 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT2G39390 89.4 4.1e-51 198.0
Cma04g01214 . 1232 1354 Cytoplasmic Ribosomal Protein Gene Family AT3G55170 89.4 2.4e-51 198.7
Cma15g00416 . 618 739 Cytoplasmic Ribosomal Protein Gene Family AT3G55170 89.3 9.0e-51 196.8
Cma04g02614 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT3G55170 87.8 4.5e-50 194.5
Cma04g00242 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT3G55170 87.0 1.7e-49 192.6
Cma04g01214 . 1232 1354 Cytoplasmic Ribosomal Protein Gene Family AT5G02610 76.0 2.2e-48 189.1
Cma15g00416 . 618 739 Cytoplasmic Ribosomal Protein Gene Family AT5G02610 75.9 8.5e-48 187.2
Cma04g02614 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT5G02610 74.7 4.2e-47 184.9
Cma04g00242 . 1 123 Cytoplasmic Ribosomal Protein Gene Family AT5G02610 74.7 7.2e-47 184.1
Cma04g00174 CST,ECH 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G07070 88.4 5.5e-55 210.7
Cma03g00122 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G07070 83.9 2.7e-54 208.4
Cma07g01277 . 591 725 Cytoplasmic Ribosomal Protein Gene Family AT1G07070 68.9 1.7e-48 189.1
Cma04g01143 CST,ECH 6 116 Cytoplasmic Ribosomal Protein Gene Family AT1G07070 73.0 2.4e-42 168.7
Cma04g00174 CST,ECH 2 112 Cytoplasmic Ribosomal Protein Gene Family AT1G41880 86.5 7.9e-54 206.8
Cma03g00122 . 2 112 Cytoplasmic Ribosomal Protein Gene Family AT1G41880 85.6 2.3e-53 205.3
Cma07g01277 . 592 725 Cytoplasmic Ribosomal Protein Gene Family AT1G41880 70.1 1.4e-47 186.0
Cma04g01143 CST,ECH 6 116 Cytoplasmic Ribosomal Protein Gene Family AT1G41880 72.1 4.1e-42 167.9
Cma04g00174 CST,ECH 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G74270 88.4 1.2e-54 209.5
Cma03g00122 . 1 112 Cytoplasmic Ribosomal Protein Gene Family AT1G74270 84.8 6.1e-54 207.2
Cma07g01277 . 591 725 Cytoplasmic Ribosomal Protein Gene Family AT1G74270 69.6 3.8e-48 188.0
Cma04g01143 CST,ECH 6 116 Cytoplasmic Ribosomal Protein Gene Family AT1G74270 73.0 5.4e-42 167.5
Cma04g00174 CST,ECH 2 112 Cytoplasmic Ribosomal Protein Gene Family AT3G55750 86.5 1.3e-53 206.1
Cma03g00122 . 2 112 Cytoplasmic Ribosomal Protein Gene Family AT3G55750 84.7 3.9e-53 204.5
Cma07g01277 . 592 725 Cytoplasmic Ribosomal Protein Gene Family AT3G55750 69.4 2.5e-47 185.3
Cma04g01143 CST,ECH 6 116 Cytoplasmic Ribosomal Protein Gene Family AT3G55750 72.1 6.9e-42 167.2
Cma02g01070 CST 8 101 Cytoplasmic Ribosomal Protein Gene Family AT2G37600 87.2 2.5e-39 158.7
Cma16g00117 CST 721 823 Cytoplasmic Ribosomal Protein Gene Family AT2G37600 81.6 3.3e-39 158.3
Cma15g01095 CST 19 112 Cytoplasmic Ribosomal Protein Gene Family AT2G37600 86.2 7.3e-39 157.1
Cma16g00117 CST 714 813 Cytoplasmic Ribosomal Protein Gene Family AT3G53740 83.0 3.2e-39 158.3
Cma02g01070 CST 1 101 Cytoplasmic Ribosomal Protein Gene Family AT3G53740 82.2 4.2e-39 157.9
Cma15g01095 CST 12 112 Cytoplasmic Ribosomal Protein Gene Family AT3G53740 81.2 1.2e-38 156.4
Cma16g00117 CST 721 822 Cytoplasmic Ribosomal Protein Gene Family AT5G02450 80.4 9.1e-39 156.8
Cma02g01070 CST 8 101 Cytoplasmic Ribosomal Protein Gene Family AT5G02450 85.1 1.6e-38 156.0
Cma15g01095 CST 19 112 Cytoplasmic Ribosomal Protein Gene Family AT5G02450 84.0 4.5e-38 154.5
Cma08g00502 . 1 105 Cytoplasmic Ribosomal Protein Gene Family AT3G23390 93.3 4.8e-53 204.1
Cma17g00988 . 10 113 Cytoplasmic Ribosomal Protein Gene Family AT3G23390 93.3 1.8e-52 202.2
Cma14g00973 CCT 486 571 Cytoplasmic Ribosomal Protein Gene Family AT3G23390 91.9 2.1e-40 162.2
Cma01g00250 . 20 104 Cytoplasmic Ribosomal Protein Gene Family AT3G23390 91.8 8.0e-40 160.2
Cma08g00502 . 1 93 Cytoplasmic Ribosomal Protein Gene Family AT4G14320 92.5 4.2e-45 178.3
Cma17g00988 . 10 101 Cytoplasmic Ribosomal Protein Gene Family AT4G14320 92.4 1.6e-44 176.4
Cma14g00973 CCT 486 571 Cytoplasmic Ribosomal Protein Gene Family AT4G14320 91.9 2.4e-40 162.5
Cma01g00250 . 20 104 Cytoplasmic Ribosomal Protein Gene Family AT4G14320 91.8 9.0e-40 160.6
Cma14g01308 CCT,CST,ECH 1 94 Cytoplasmic Ribosomal Protein Gene Family AT1G15250 88.3 8.3e-44 173.3
Cma01g00110 CCT,CST,ECH 1 94 Cytoplasmic Ribosomal Protein Gene Family AT1G15250 86.2 9.2e-43 169.9
Cma17g00800 CCT,CST,ECH 1 81 Cytoplasmic Ribosomal Protein Gene Family AT1G15250 90.1 5.2e-38 154.1
Cma08g00696 CCT,CST,ECH 1 81 Cytoplasmic Ribosomal Protein Gene Family AT1G15250 88.9 1.5e-37 152.5
Cma14g01308 CCT,CST,ECH 1 95 Cytoplasmic Ribosomal Protein Gene Family AT1G52300 87.4 7.5e-45 176.8
Cma01g00110 CCT,CST,ECH 1 95 Cytoplasmic Ribosomal Protein Gene Family AT1G52300 87.4 1.7e-44 175.6
Cma17g00800 CCT,CST,ECH 1 81 Cytoplasmic Ribosomal Protein Gene Family AT1G52300 90.1 1.0e-38 156.4
Cma08g00696 CCT,CST,ECH 1 81 Cytoplasmic Ribosomal Protein Gene Family AT1G52300 88.9 3.1e-38 154.8
Cma06g01191 CCT,CST,ECH 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G10950 94.6 3.3e-45 177.9
Cma17g00074 CCT,ECH 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G10950 94.6 3.3e-45 177.9
Cma08g01008 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G10950 94.6 3.3e-45 177.9
Cma14g01921 CCT,CST,ECH 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G10950 94.6 3.3e-45 177.9
Cma06g01191 CCT,CST,ECH 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G60245 92.4 9.5e-45 176.4
Cma17g00074 CCT,ECH 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G60245 92.4 9.5e-45 176.4
Cma08g01008 . 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G60245 92.4 9.5e-45 176.4
Cma14g01921 CCT,CST,ECH 1 92 Cytoplasmic Ribosomal Protein Gene Family AT3G60245 92.4 9.5e-45 176.4
Cma02g01143 CCT 1 122 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.4 3.3e-64 241.5
Cma16g00025 CCT,CST 1 121 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.3 9.7e-64 240.0
Cma18g01337 CCT,CST 1 120 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 99.2 1.7e-63 239.2
Cma07g00298 CCT 317 393 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 7.7e-37 150.6
Cma18g00240 . 1 77 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 7.7e-37 150.6
Cma13g00720 . 1 77 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 7.7e-37 150.6
Cma01g01148 CST 1 77 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 7.7e-37 150.6
Cma09g00931 CST 1 77 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 98.7 7.7e-37 150.6
Cma04g01742 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 100.0 1.0e-36 150.2
Cma02g00011 . 37 112 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 100.0 1.0e-36 150.2
Cma18g00790 . 79 154 Cytoplasmic Ribosomal Protein Gene Family AT2G36170 100.0 1.0e-36 150.2
Cma02g01143 CCT 1 122 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.4 3.3e-64 241.5
Cma16g00025 CCT,CST 1 121 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.3 9.7e-64 240.0
Cma18g01337 CCT,CST 1 120 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 99.2 1.7e-63 239.2
Cma07g00298 CCT 317 393 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 7.7e-37 150.6
Cma18g00240 . 1 77 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 7.7e-37 150.6
Cma13g00720 . 1 77 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 7.7e-37 150.6
Cma01g01148 CST 1 77 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 7.7e-37 150.6
Cma09g00931 CST 1 77 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 98.7 7.7e-37 150.6
Cma04g01742 . 1 76 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 100.0 1.0e-36 150.2
Cma02g00011 . 37 112 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 100.0 1.0e-36 150.2
Cma18g00790 . 79 154 Cytoplasmic Ribosomal Protein Gene Family AT3G52590 100.0 1.0e-36 150.2
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0006540 1 3 1 1 1 1 2 1 1 1 1 1 2 1 1 2 1 2 2 1 1 1 1 1 1 1 1 2 1 1 38
       

Transcriptome


Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Cma20g00171 Cma_Chr20 FPKM 30.671225 33.661167 27.868526 30.45335 37.972084 34.995289 36.964073 39.283863 36.654514 37.714088