Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cme01g02227 ATGGCGACGAGGAATCGAACTGCACAGTTTAGAAGGCACAGGGATGCCGTGAAGAGTGTCCGTGCGCCTCTATCCTCTTCGGCAGCTGGCTCCAGTGGACCGGTTATTGAGATGGTCAGTTCGTCTCTTCTTCGTTCGAAGCGCTCTTCTTCATATGCTCCCCTCAGCACTGAAGATCCAGGACCTTCGAGCAGCGATGCATTTATGGTTGGTCTACCTCCAGCTTGGGTGGATGATTCTGAAGAAATAACTGTTAATATACAGAAAATTCGTAGGAAGATGGCAGAGCTAGTCAAGGCTCATTCCAAAGCTTTAATGCCTTCTTTTGCTGATGGCAAAGAAGACGAGCATACGATTGAAGCACTTACGCTAGAGATTACCAATCTTTTGAAAACCTCCGAGAAGAGGTTAAAGAAAATTTCTAGTACTGGGTCTTCCGAGGATATTAACATCAGAAAAAACGTCCAGCGTTCTCTTGCTACAGAGCTTCAGAATCTTTCGATGGATCTTCGTAGAAGACAATCAATGTATTTGAAACATCTGCAACAGCAAAAGGAGGGACATGATGGAATTGATTTGGAGATAAATTTGAATGGAAACCGAACTTTCCAGGAGGATGACGGATATGATGAATTTGGAACAAATGAAAACCAAACGATGACATTAGATGGGCAGCACATTCAGGGAAGGGAGAAAGAGATTAAACAGGTTGTAAAATCCGTAAATGAGCTTGCCCAAATTATGAAGGATCTCTCAACTCTTGTCATAGACCAGGGTACCATTGTCGATAGAATTGACCACAATATTCAGAATGTTGCTGTTTCAGTTGAAGAGGGCTTGAAACAACTTCAAAAGGCAGAGAAGACACAGAAAAATGGAGGAATGGTGAAATGTGCAACAGTGCTTGCCCTTCGCAGCTCTGAAAATCAACAATGGGATATCATCAAAGCAAACCTCACGGCTCCAAACGCAAACAGAGATAAGGACTTTCCAAAATGGTGGGACGATGAGGATATTAAGGAGGTGTCCGTCCATCTAATGAAGATGTGA 1050 43.33 MATRNRTAQFRRHRDAVKSVRAPLSSSAAGSSGPVIEMVSSSLLRSKRSSSYAPLSTEDPGPSSSDAFMVGLPPAWVDDSEEITVNIQKIRRKMAELVKAHSKALMPSFADGKEDEHTIEALTLEITNLLKTSEKRLKKISSTGSSEDINIRKNVQRSLATELQNLSMDLRRRQSMYLKHLQQQKEGHDGIDLEINLNGNRTFQEDDGYDEFGTNENQTMTLDGQHIQGREKEIKQVVKSVNELAQIMKDLSTLVIDQGTIVDRIDHNIQNVAVSVEEGLKQLQKAEKTQKNGGMVKCATVLALRSSENQQWDIIKANLTAPNANRDKDFPKWWDDEDIKEVSVHLMKM 349
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
1 30993003 30999621 - MELO3C015953.2.1 Cme01g02227 319203

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cme01g02227 349 CDD SNARE_syntaxin16 227 285 - -
Cme01g02227 349 PANTHER SYNTAXIN OF PLANTS PROTEIN 1 303 - -
Cme01g02227 349 PANTHER SYNTAXIN 1 303 IPR045242 -
Cme01g02227 349 Gene3D - 73 278 - -
Cme01g02227 349 Pfam SNARE domain 260 304 IPR000727 -
Cme01g02227 349 SUPERFAMILY t-snare proteins 72 279 IPR010989 GO:0016020|GO:0016192
Cme01g02227 349 SMART SynN_4 67 182 IPR006011 GO:0016020
Cme01g02227 349 ProSitePatterns Syntaxin / epimorphin family signature. 230 269 IPR006012 GO:0005484|GO:0006886|GO:0016020
Cme01g02227 349 SMART tSNARE_6 218 286 IPR000727 -
Cme01g02227 349 MobiDBLite consensus disorder prediction 1 33 - -
Cme01g02227 349 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 224 286 IPR000727 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cme01g02227 K08489 STX16; syntaxin 16 - csv:101204192 559.296
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cme01g02227 Cme-Chr1:30993003 Cme05g01576 Cme-Chr5:24990079 2.26E-135 dispersed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi7g353 . . . . . . . . . Cmo17g01031 . . . . . . . Bhi09g00937 Tan06g0762 . . Hepe03g1868 . . Cla09g00505 Cam09g0545 Cec09g0536 Cco09g0532 Clacu09g0546 . Cre09g0524 Cone17ag0442 Cone20ag0971 . . Lsi02g02441 Csa07g01878 . Cme01g02227 . . . . . . . . . . . . Cma17g01060 . Car17g01008 . Cpe12g00911 . . . . . . . . . . . . . . . . Chy01g01727 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cme03g01671 . 8 338 SNARE and Associated Proteins AT3G24350 64.5 2.8e-102 369.0
Cme08g02007 CCT 1 309 SNARE and Associated Proteins AT1G08560 68.8 6.5e-100 360.9
Cme04g02317 . 22 280 SNARE and Associated Proteins AT3G11820 80.3 6.1e-114 407.5
Cme08g01151 . 90 349 SNARE and Associated Proteins AT3G11820 70.0 6.6e-100 360.9
Cme12g01397 . 31 281 SNARE and Associated Proteins AT3G11820 65.3 1.1e-91 333.6
Cme04g01796 CCT 30 282 SNARE and Associated Proteins AT3G11820 52.2 9.6e-67 250.8
Cme04g02317 . 31 280 SNARE and Associated Proteins AT3G52400 68.8 2.3e-90 329.3
Cme08g01151 . 67 349 SNARE and Associated Proteins AT3G52400 59.8 1.9e-84 309.7
Cme12g01397 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 5.7e-81 298.1
Cme12g01397 . 1 299 SNARE and Associated Proteins AT4G03330 67.5 5.4e-107 384.4
Cme04g02317 . 1 285 SNARE and Associated Proteins AT4G03330 56.6 5.4e-83 304.7
Cme08g01151 . 67 347 SNARE and Associated Proteins AT4G03330 54.8 1.1e-78 290.4
Cme04g01796 CCT 1 282 SNARE and Associated Proteins AT4G03330 51.4 1.7e-68 256.5
Cme12g01397 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 1.6e-127 452.6
Cme04g02317 . 1 285 SNARE and Associated Proteins AT1G61290 61.3 9.2e-91 330.5
Cme08g01151 . 67 365 SNARE and Associated Proteins AT1G61290 54.5 1.5e-80 296.6
Cme12g01397 . 1 299 SNARE and Associated Proteins AT1G11250 77.9 2.8e-124 441.8
Cme04g02317 . 1 285 SNARE and Associated Proteins AT1G11250 61.8 2.8e-92 335.5
Cme08g01151 . 67 361 SNARE and Associated Proteins AT1G11250 54.6 3.1e-83 305.4
Cme04g01796 CCT 1 305 SNARE and Associated Proteins AT3G03800 73.3 4.6e-114 407.9
Cme11g00777 . 48 325 SNARE and Associated Proteins AT3G03800 52.9 1.3e-73 273.5
Cme04g01796 CCT 1 200 SNARE and Associated Proteins AT5G08080 79.0 5.7e-82 300.8
Cme11g00777 . 30 224 SNARE and Associated Proteins AT5G08080 53.3 1.4e-43 173.3
Cme06g02454 . 1 256 SNARE and Associated Proteins AT5G16830 58.8 8.5e-75 277.3
Cme06g02454 . 1 256 SNARE and Associated Proteins AT5G46860 65.6 1.4e-79 293.1
Cme06g02454 . 1 256 SNARE and Associated Proteins AT4G17730 60.9 6.8e-74 274.2
Cme06g02454 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 4.3e-52 202.2
Cme10g01057 . 1 336 SNARE and Associated Proteins AT5G05760 64.7 3.4e-110 395.2
Cme03g01671 . 8 338 SNARE and Associated Proteins AT3G24350 64.5 2.8e-102 369.0
Cme05g01576 . 1 327 SNARE and Associated Proteins AT5G26980 75.8 5.5e-126 447.6
Cme01g02227 . 1 302 SNARE and Associated Proteins AT5G26980 66.0 3.1e-97 352.1
Cme05g01576 . 1 329 SNARE and Associated Proteins AT4G02195 63.7 3.5e-104 375.2
Cme01g02227 . 1 302 SNARE and Associated Proteins AT4G02195 67.3 1.8e-100 362.8
Cme05g01576 . 1 328 SNARE and Associated Proteins AT3G05710 74.8 7.9e-128 453.8
Cme01g02227 . 1 302 SNARE and Associated Proteins AT3G05710 63.1 6.3e-93 337.8
Cme01g00994 . 1 233 SNARE and Associated Proteins AT1G16240 73.8 2.4e-91 332.0
Cme06g02818 . 4 220 SNARE and Associated Proteins AT1G16240 65.3 1.9e-72 269.2
Cme01g00994 . 1 233 SNARE and Associated Proteins AT1G79590 73.0 1.2e-89 326.6
Cme06g02818 . 4 220 SNARE and Associated Proteins AT1G79590 65.3 4.4e-73 271.6
Cme11g02501 . 56 246 SNARE and Associated Proteins AT1G28490 71.7 1.4e-66 249.6
Cme04g02538 . 1 264 SNARE and Associated Proteins AT3G09740 78.6 4.9e-112 401.0
Cme04g02539 . 1 264 SNARE and Associated Proteins AT3G09740 78.6 4.9e-112 401.0
Cme11g01790 . 1 235 SNARE and Associated Proteins AT3G09740 66.2 5.4e-79 291.2
Cme04g02538 . 1 264 SNARE and Associated Proteins AT3G45280 64.8 1.1e-87 320.1
Cme04g02539 . 1 264 SNARE and Associated Proteins AT3G45280 64.8 1.1e-87 320.1
Cme11g01790 . 1 237 SNARE and Associated Proteins AT3G45280 64.0 2.8e-75 278.9
Cme04g02538 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.9e-95 344.0
Cme04g02539 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.9e-95 344.0
Cme11g01790 . 1 235 SNARE and Associated Proteins AT3G61450 60.6 1.4e-74 276.6
Cme03g00216 . 65 308 SNARE and Associated Proteins AT1G51740 74.0 1.2e-93 339.7
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0012598 0 2 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 2 2 0 29