Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cme03g00216 ATGGCAAAGTTCAGGGATAGAACTGAAGATTTCAAAGATGTTGTGCGGCACTGTGCTATTTCGTTAGGGTATAATGAGTCCAAGTTGGCAGCTATTATGGCATCTTTCATCATTCAGAAACCTCGGCAAAGGTCACCTTTCATCAAAGCTGCCCTGAAAACGCTTGAAAGCATTGGTGCTCTTGAAGAGTTCATGTTGAAACATCAGAAGGATTATGTAGACATGTATCGGACGACAGATCAAGAGAGAGACAATATTGAACATGAGGTAGCTGCCTTCATCAAAGCATGCCAAGAACAACTTGATATCCTAAAAAACAGCATTAACGAGGATGATGCACATTCCAAGGGATGGCTTGGTCCTAGGACTGATGATTCTAATGCTGATACCATTGCACACAAACATGGGGTGGTTCTAATTTTGAGTGAGAAACTCCATTCAGTAACATCACAGTTTGATAAGCTAAGAGCCATTCGGTTTCAAGATATCATAAGCAAAGCAGTACCAAGAAGAAAACTGAACCAAGTAAATAAACCACGTTCTGCCAATACCACTGAGTATAGTAACACAGAGCTGAGAGAACCTGATAATTTTGAGCATCAACCTGTCCGAGCCCAACAACTGTTAGATGATGAAACTCGTGCACTTCAGGTTGAGTTGACTAGTCTTCTTGACGCAGTCCAAGAAACAGAAACTAAGATGGTAGAGATGTCTGCTCTAAATCACCTTATGTCTACACACGTTTTGCAGCAAGCACAACAAATTGAATATCTTTATGAACAGGCTGTTGAAGCTACGAAGAATGTCGAGCTTGGTAATAAAGAACTTACCCAAGCAATTCAGCGGAATAGCAGCAGCAGAACCTTCCTTCTGCTTTTTCTATTTGTGCTCACTTTTTCAATTCTCTTTCTTGATTGGTACAGTTGA 927 40.78 MAKFRDRTEDFKDVVRHCAISLGYNESKLAAIMASFIIQKPRQRSPFIKAALKTLESIGALEEFMLKHQKDYVDMYRTTDQERDNIEHEVAAFIKACQEQLDILKNSINEDDAHSKGWLGPRTDDSNADTIAHKHGVVLILSEKLHSVTSQFDKLRAIRFQDIISKAVPRRKLNQVNKPRSANTTEYSNTELREPDNFEHQPVRAQQLLDDETRALQVELTSLLDAVQETETKMVEMSALNHLMSTHVLQQAQQIEYLYEQAVEATKNVELGNKELTQAIQRNSSSRTFLLLFLFVLTFSILFLDWYS 308
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
3 2777972 2782396 + MELO3C008270.2.1 Cme03g00216 322227

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cme03g00216 308 PANTHER SYNTAXIN-18 5 308 - -
Cme03g00216 308 PANTHER SYNTAXIN-18 5 308 - -
Cme03g00216 308 Pfam SNARE-complex protein Syntaxin-18 N-terminus 6 86 IPR019529 -
Cme03g00216 308 SUPERFAMILY t-snare proteins 61 272 IPR010989 GO:0016020|GO:0016192
Cme03g00216 308 Gene3D - 211 305 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cme03g00216 K08492 STX18; syntaxin 18 - csv:101207161 587.415
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi13g422 . . . . . . . . . . . . . . Sed03g0404 Cpe13g01079 . Bhi04g02346 Tan11g0243 Cmetu03g1342 . Hepe02g3337 . Lcy10g2218 . . . . . . . . . . Cone18ag0421 Lsi03g00333 Csa06g00159 . . . . . . . . . . . Cmo04g03046 Cmo15g00129 Cma04g02924 Cma15g00119 Car04g02811 Car15g00129 . Cpe01g02531 . . . . . . . Cla11g00615 Cam11g0668 Cec11g0667 Cco11g0653 Clacu11g0790 Cmu11g0646 Cre11g1122 . . Chy03g00164 Cme03g00216
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cme03g01671 . 8 338 SNARE and Associated Proteins AT3G24350 64.5 2.8e-102 369.0
Cme08g02007 CCT 1 309 SNARE and Associated Proteins AT1G08560 68.8 6.5e-100 360.9
Cme04g02317 . 22 280 SNARE and Associated Proteins AT3G11820 80.3 6.1e-114 407.5
Cme08g01151 . 90 349 SNARE and Associated Proteins AT3G11820 70.0 6.6e-100 360.9
Cme12g01397 . 31 281 SNARE and Associated Proteins AT3G11820 65.3 1.1e-91 333.6
Cme04g01796 CCT 30 282 SNARE and Associated Proteins AT3G11820 52.2 9.6e-67 250.8
Cme04g02317 . 31 280 SNARE and Associated Proteins AT3G52400 68.8 2.3e-90 329.3
Cme08g01151 . 67 349 SNARE and Associated Proteins AT3G52400 59.8 1.9e-84 309.7
Cme12g01397 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 5.7e-81 298.1
Cme12g01397 . 1 299 SNARE and Associated Proteins AT4G03330 67.5 5.4e-107 384.4
Cme04g02317 . 1 285 SNARE and Associated Proteins AT4G03330 56.6 5.4e-83 304.7
Cme08g01151 . 67 347 SNARE and Associated Proteins AT4G03330 54.8 1.1e-78 290.4
Cme04g01796 CCT 1 282 SNARE and Associated Proteins AT4G03330 51.4 1.7e-68 256.5
Cme12g01397 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 1.6e-127 452.6
Cme04g02317 . 1 285 SNARE and Associated Proteins AT1G61290 61.3 9.2e-91 330.5
Cme08g01151 . 67 365 SNARE and Associated Proteins AT1G61290 54.5 1.5e-80 296.6
Cme12g01397 . 1 299 SNARE and Associated Proteins AT1G11250 77.9 2.8e-124 441.8
Cme04g02317 . 1 285 SNARE and Associated Proteins AT1G11250 61.8 2.8e-92 335.5
Cme08g01151 . 67 361 SNARE and Associated Proteins AT1G11250 54.6 3.1e-83 305.4
Cme04g01796 CCT 1 305 SNARE and Associated Proteins AT3G03800 73.3 4.6e-114 407.9
Cme11g00777 . 48 325 SNARE and Associated Proteins AT3G03800 52.9 1.3e-73 273.5
Cme04g01796 CCT 1 200 SNARE and Associated Proteins AT5G08080 79.0 5.7e-82 300.8
Cme11g00777 . 30 224 SNARE and Associated Proteins AT5G08080 53.3 1.4e-43 173.3
Cme06g02454 . 1 256 SNARE and Associated Proteins AT5G16830 58.8 8.5e-75 277.3
Cme06g02454 . 1 256 SNARE and Associated Proteins AT5G46860 65.6 1.4e-79 293.1
Cme06g02454 . 1 256 SNARE and Associated Proteins AT4G17730 60.9 6.8e-74 274.2
Cme06g02454 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 4.3e-52 202.2
Cme10g01057 . 1 336 SNARE and Associated Proteins AT5G05760 64.7 3.4e-110 395.2
Cme03g01671 . 8 338 SNARE and Associated Proteins AT3G24350 64.5 2.8e-102 369.0
Cme05g01576 . 1 327 SNARE and Associated Proteins AT5G26980 75.8 5.5e-126 447.6
Cme01g02227 . 1 302 SNARE and Associated Proteins AT5G26980 66.0 3.1e-97 352.1
Cme05g01576 . 1 329 SNARE and Associated Proteins AT4G02195 63.7 3.5e-104 375.2
Cme01g02227 . 1 302 SNARE and Associated Proteins AT4G02195 67.3 1.8e-100 362.8
Cme05g01576 . 1 328 SNARE and Associated Proteins AT3G05710 74.8 7.9e-128 453.8
Cme01g02227 . 1 302 SNARE and Associated Proteins AT3G05710 63.1 6.3e-93 337.8
Cme01g00994 . 1 233 SNARE and Associated Proteins AT1G16240 73.8 2.4e-91 332.0
Cme06g02818 . 4 220 SNARE and Associated Proteins AT1G16240 65.3 1.9e-72 269.2
Cme01g00994 . 1 233 SNARE and Associated Proteins AT1G79590 73.0 1.2e-89 326.6
Cme06g02818 . 4 220 SNARE and Associated Proteins AT1G79590 65.3 4.4e-73 271.6
Cme11g02501 . 56 246 SNARE and Associated Proteins AT1G28490 71.7 1.4e-66 249.6
Cme04g02538 . 1 264 SNARE and Associated Proteins AT3G09740 78.6 4.9e-112 401.0
Cme04g02539 . 1 264 SNARE and Associated Proteins AT3G09740 78.6 4.9e-112 401.0
Cme11g01790 . 1 235 SNARE and Associated Proteins AT3G09740 66.2 5.4e-79 291.2
Cme04g02538 . 1 264 SNARE and Associated Proteins AT3G45280 64.8 1.1e-87 320.1
Cme04g02539 . 1 264 SNARE and Associated Proteins AT3G45280 64.8 1.1e-87 320.1
Cme11g01790 . 1 237 SNARE and Associated Proteins AT3G45280 64.0 2.8e-75 278.9
Cme04g02538 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.9e-95 344.0
Cme04g02539 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.9e-95 344.0
Cme11g01790 . 1 235 SNARE and Associated Proteins AT3G61450 60.6 1.4e-74 276.6
Cme03g00216 . 65 308 SNARE and Associated Proteins AT1G51740 74.0 1.2e-93 339.7
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0011407 0 1 0 1 0 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 1 2 1 1 1 30
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Cme03g00216 Cme_Chr03 FPKM 29.898678 33.749462 36.747608 33.465691 33.347103 34.426311 34.254631 40.096645 44.667068 38.389561