Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cme06g02454 ATGAGCTTTCAAGATATCGAGGCTGGTCGCCCCTTTGCTTCTTCGAGGAGAGACCTCATCAATGGCAAACAAGATCCTACGCAAGCTGTTGCTTCCGGTATATTTCAGATTAATACTGCCGTTGCTACGTTTCAAAGGCTTGTTAATACCTTAGGTACACCAAAGGATACGCCTGAGCTACGCGAGAAGCTGCACAAGACAAGGTTACATATTGGACAGTTGGTTAAAGACACTTCTGCTAAACTTAAACAAGCCAGCGATATAGATCATCATGCTGAAGTGAATGCCAGCAAGAAAATTGCAGATGCTAAACTTGCGAAAGATTTTCAAGCAGTGTTGAAAGAGTTTCAGAAGGCTCAACGACTTGCAGCCGAGAGGGAAACAGCATATTCACCTTTTGTTCCCCAAACTAATCTACCTTCTAGCTACACAGCTGGGGAGGCAGATGCAAGCTCAGAAAAGAATCTTGAACAGCGTGCCCTTCTTGTGGAATCCAGGAGGCAAGAGGTCTTGCTGTTGGACAATGAAATAGCCTTCAATGAGGCAATAATTGAGGAAAGAGAGCAAGGCATTCATGAAATCCAGCAGCAAATTGGAGAAGTGAATGAAATTTTTAAAGATCTTGCAGTTCTAGTTCATGAACAGGGAGCAATGATTGATGATATTGGATCCAACATAGAGGGGGCACATGCTGCAACGTCACAGGGAACAACTCAACTTGTAAAAGCTTCAAAGACACAAAGATCGAATTCATCTCTGGCTTGCTTACTTTTGGTGATATTTGGTATTATCCTCCTCATTGTGATCATAATAGTCGTTGCTTAA 825 42.67 MSFQDIEAGRPFASSRRDLINGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSAKLKQASDIDHHAEVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYSPFVPQTNLPSSYTAGEADASSEKNLEQRALLVESRRQEVLLLDNEIAFNEAIIEEREQGIHEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIEGAHAATSQGTTQLVKASKTQRSNSSLACLLLVIFGIILLIVIIIVVA 274
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
6 31570340 31575247 + MELO3C013834.2.1 Cme06g02454 331603

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cme06g02454 274 Pfam Syntaxin-like protein 31 130 IPR006011 GO:0016020
Cme06g02454 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020|GO:0016192
Cme06g02454 274 PANTHER SYNTAXIN 5 272 IPR045242 -
Cme06g02454 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
Cme06g02454 274 CDD SNARE_Qa 184 242 - -
Cme06g02454 274 SMART tSNARE_6 176 243 IPR000727 -
Cme06g02454 274 PANTHER SYNTAXIN OF PLANTS PROTEIN 5 272 - -
Cme06g02454 274 Pfam SNARE domain 218 269 IPR000727 -
Cme06g02454 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484|GO:0006886|GO:0016020
Cme06g02454 274 CDD SynN 24 147 IPR006011 GO:0016020
Cme06g02454 274 Gene3D - 21 134 - -
Cme06g02454 274 Gene3D - 174 274 - -
Cme06g02454 274 SMART SynN_4 16 128 IPR006011 GO:0016020
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cme06g02454 - - K08488 bhj:120089793 458.373
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cme05g01576 Cme-Chr5:24990079 Cme06g02454 Cme-Chr6:31570340 1.41E-10 dispersed
Cme06g02454 Cme-Chr6:31570340 Cme12g01397 Cme-Chr12:21851130 4.21E-11 dispersed
Cme06g02454 Cme-Chr6:31570340 Cme08g01151 Cme-Chr8:8134579 7.73E-14 transposed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
Vvi16g114 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cme06g02454 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cme03g01671 . 8 338 SNARE and Associated Proteins AT3G24350 64.5 2.8e-102 369.0
Cme08g02007 CCT 1 309 SNARE and Associated Proteins AT1G08560 68.8 6.5e-100 360.9
Cme04g02317 . 22 280 SNARE and Associated Proteins AT3G11820 80.3 6.1e-114 407.5
Cme08g01151 . 90 349 SNARE and Associated Proteins AT3G11820 70.0 6.6e-100 360.9
Cme12g01397 . 31 281 SNARE and Associated Proteins AT3G11820 65.3 1.1e-91 333.6
Cme04g01796 CCT 30 282 SNARE and Associated Proteins AT3G11820 52.2 9.6e-67 250.8
Cme04g02317 . 31 280 SNARE and Associated Proteins AT3G52400 68.8 2.3e-90 329.3
Cme08g01151 . 67 349 SNARE and Associated Proteins AT3G52400 59.8 1.9e-84 309.7
Cme12g01397 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 5.7e-81 298.1
Cme12g01397 . 1 299 SNARE and Associated Proteins AT4G03330 67.5 5.4e-107 384.4
Cme04g02317 . 1 285 SNARE and Associated Proteins AT4G03330 56.6 5.4e-83 304.7
Cme08g01151 . 67 347 SNARE and Associated Proteins AT4G03330 54.8 1.1e-78 290.4
Cme04g01796 CCT 1 282 SNARE and Associated Proteins AT4G03330 51.4 1.7e-68 256.5
Cme12g01397 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 1.6e-127 452.6
Cme04g02317 . 1 285 SNARE and Associated Proteins AT1G61290 61.3 9.2e-91 330.5
Cme08g01151 . 67 365 SNARE and Associated Proteins AT1G61290 54.5 1.5e-80 296.6
Cme12g01397 . 1 299 SNARE and Associated Proteins AT1G11250 77.9 2.8e-124 441.8
Cme04g02317 . 1 285 SNARE and Associated Proteins AT1G11250 61.8 2.8e-92 335.5
Cme08g01151 . 67 361 SNARE and Associated Proteins AT1G11250 54.6 3.1e-83 305.4
Cme04g01796 CCT 1 305 SNARE and Associated Proteins AT3G03800 73.3 4.6e-114 407.9
Cme11g00777 . 48 325 SNARE and Associated Proteins AT3G03800 52.9 1.3e-73 273.5
Cme04g01796 CCT 1 200 SNARE and Associated Proteins AT5G08080 79.0 5.7e-82 300.8
Cme11g00777 . 30 224 SNARE and Associated Proteins AT5G08080 53.3 1.4e-43 173.3
Cme06g02454 . 1 256 SNARE and Associated Proteins AT5G16830 58.8 8.5e-75 277.3
Cme06g02454 . 1 256 SNARE and Associated Proteins AT5G46860 65.6 1.4e-79 293.1
Cme06g02454 . 1 256 SNARE and Associated Proteins AT4G17730 60.9 6.8e-74 274.2
Cme06g02454 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 4.3e-52 202.2
Cme10g01057 . 1 336 SNARE and Associated Proteins AT5G05760 64.7 3.4e-110 395.2
Cme03g01671 . 8 338 SNARE and Associated Proteins AT3G24350 64.5 2.8e-102 369.0
Cme05g01576 . 1 327 SNARE and Associated Proteins AT5G26980 75.8 5.5e-126 447.6
Cme01g02227 . 1 302 SNARE and Associated Proteins AT5G26980 66.0 3.1e-97 352.1
Cme05g01576 . 1 329 SNARE and Associated Proteins AT4G02195 63.7 3.5e-104 375.2
Cme01g02227 . 1 302 SNARE and Associated Proteins AT4G02195 67.3 1.8e-100 362.8
Cme05g01576 . 1 328 SNARE and Associated Proteins AT3G05710 74.8 7.9e-128 453.8
Cme01g02227 . 1 302 SNARE and Associated Proteins AT3G05710 63.1 6.3e-93 337.8
Cme01g00994 . 1 233 SNARE and Associated Proteins AT1G16240 73.8 2.4e-91 332.0
Cme06g02818 . 4 220 SNARE and Associated Proteins AT1G16240 65.3 1.9e-72 269.2
Cme01g00994 . 1 233 SNARE and Associated Proteins AT1G79590 73.0 1.2e-89 326.6
Cme06g02818 . 4 220 SNARE and Associated Proteins AT1G79590 65.3 4.4e-73 271.6
Cme11g02501 . 56 246 SNARE and Associated Proteins AT1G28490 71.7 1.4e-66 249.6
Cme04g02538 . 1 264 SNARE and Associated Proteins AT3G09740 78.6 4.9e-112 401.0
Cme04g02539 . 1 264 SNARE and Associated Proteins AT3G09740 78.6 4.9e-112 401.0
Cme11g01790 . 1 235 SNARE and Associated Proteins AT3G09740 66.2 5.4e-79 291.2
Cme04g02538 . 1 264 SNARE and Associated Proteins AT3G45280 64.8 1.1e-87 320.1
Cme04g02539 . 1 264 SNARE and Associated Proteins AT3G45280 64.8 1.1e-87 320.1
Cme11g01790 . 1 237 SNARE and Associated Proteins AT3G45280 64.0 2.8e-75 278.9
Cme04g02538 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.9e-95 344.0
Cme04g02539 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.9e-95 344.0
Cme11g01790 . 1 235 SNARE and Associated Proteins AT3G61450 60.6 1.4e-74 276.6
Cme03g00216 . 65 308 SNARE and Associated Proteins AT1G51740 74.0 1.2e-93 339.7
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45