Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cme06g02818 ATGGCACCTTCTGATTTATGGATAAAGGAATATAATGAAGCTTCTAAGCTTGGTGATGATATCAATGGCATGATTTCTGAAAGAAGTTCCTTTCCTGCAACTGGACCAGAATCCCAACGTCACGCTTCGGCCATTCGGAGGAAGATCACAATTTTGGGGACTAAAGTTGATGGCTTACAGTCCCTTTTGTCGAAACTTCCTGTAAAGCAGCCCCTGTCCGAAAAGGAGATAAATCGACGTAAAGACATGCTCATTCAGATGAGATCAGAAGTAAAGCAGATGGCCTCAACGTTGAACATGTCAAACTTTGCTAACCGAGACAGTTTGCTAGGCCCAGAGATGAAATCGGTGGATGTAATGAGCAAGACAGCTGAACTAGACAATCAAGGACTTGTTGAGCAAGATGAAGGTCTTGAAAAGCTGGAGGAGACTATTATAAGTACAAAACATATTGCATTAGCGGTCAATGAAGAACTCGATCTTCACACTCGCCTAATTGATGACTTGGATCAACATGTTGATGTTATAGACTCTCGATTAGCGAGGGTGCAGAAGAGATTGGGAATAATGAACAAGCGAGCAAAGGGGAGCTGCTCTTGCTTTGGAATGCTTCTGTCTGTGGTTGGTATTGTGGTTCTCATCACTGTCATATGGCTGCTCCAATACTTGTAA 672 42.86 MAPSDLWIKEYNEASKLGDDINGMISERSSFPATGPESQRHASAIRRKITILGTKVDGLQSLLSKLPVKQPLSEKEINRRKDMLIQMRSEVKQMASTLNMSNFANRDSLLGPEMKSVDVMSKTAELDNQGLVEQDEGLEKLEETIISTKHIALAVNEELDLHTRLIDDLDQHVDVIDSRLARVQKRLGIMNKRAKGSCSCFGMLLSVVGIVVLITVIWLLQYL 223
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
6 35482051 35484501 + MELO3C014154.2.1 Cme06g02818 331967

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cme06g02818 223 Gene3D - 130 192 - -
Cme06g02818 223 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 128 190 IPR000727 -
Cme06g02818 223 PANTHER SYNTAXIN 1 219 IPR045242 -
Cme06g02818 223 Pfam SNARE domain 165 216 IPR000727 -
Cme06g02818 223 CDD SNARE_SYN8 131 195 - -
Cme06g02818 223 SUPERFAMILY SNARE fusion complex 127 190 - -
Cme06g02818 223 PANTHER TARGET SNARE COILED-COIL DOMAIN-CONTAINING PROTEIN-RELATED 1 219 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cme06g02818 K08503 SYP5; syntaxin of plants SYP5 - csv:101223140 405.986
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cme01g00994 Cme-Chr1:11894476 Cme06g02818 Cme-Chr6:35482051 7.43E-118 dispersed
Cme06g02818 Cme-Chr6:35482051 Cme11g02501 Cme-Chr11:31571696 1.07E-07 dispersed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cme03g01671 . 8 338 SNARE and Associated Proteins AT3G24350 64.5 2.8e-102 369.0
Cme08g02007 CCT 1 309 SNARE and Associated Proteins AT1G08560 68.8 6.5e-100 360.9
Cme04g02317 . 22 280 SNARE and Associated Proteins AT3G11820 80.3 6.1e-114 407.5
Cme08g01151 . 90 349 SNARE and Associated Proteins AT3G11820 70.0 6.6e-100 360.9
Cme12g01397 . 31 281 SNARE and Associated Proteins AT3G11820 65.3 1.1e-91 333.6
Cme04g01796 CCT 30 282 SNARE and Associated Proteins AT3G11820 52.2 9.6e-67 250.8
Cme04g02317 . 31 280 SNARE and Associated Proteins AT3G52400 68.8 2.3e-90 329.3
Cme08g01151 . 67 349 SNARE and Associated Proteins AT3G52400 59.8 1.9e-84 309.7
Cme12g01397 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 5.7e-81 298.1
Cme12g01397 . 1 299 SNARE and Associated Proteins AT4G03330 67.5 5.4e-107 384.4
Cme04g02317 . 1 285 SNARE and Associated Proteins AT4G03330 56.6 5.4e-83 304.7
Cme08g01151 . 67 347 SNARE and Associated Proteins AT4G03330 54.8 1.1e-78 290.4
Cme04g01796 CCT 1 282 SNARE and Associated Proteins AT4G03330 51.4 1.7e-68 256.5
Cme12g01397 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 1.6e-127 452.6
Cme04g02317 . 1 285 SNARE and Associated Proteins AT1G61290 61.3 9.2e-91 330.5
Cme08g01151 . 67 365 SNARE and Associated Proteins AT1G61290 54.5 1.5e-80 296.6
Cme12g01397 . 1 299 SNARE and Associated Proteins AT1G11250 77.9 2.8e-124 441.8
Cme04g02317 . 1 285 SNARE and Associated Proteins AT1G11250 61.8 2.8e-92 335.5
Cme08g01151 . 67 361 SNARE and Associated Proteins AT1G11250 54.6 3.1e-83 305.4
Cme04g01796 CCT 1 305 SNARE and Associated Proteins AT3G03800 73.3 4.6e-114 407.9
Cme11g00777 . 48 325 SNARE and Associated Proteins AT3G03800 52.9 1.3e-73 273.5
Cme04g01796 CCT 1 200 SNARE and Associated Proteins AT5G08080 79.0 5.7e-82 300.8
Cme11g00777 . 30 224 SNARE and Associated Proteins AT5G08080 53.3 1.4e-43 173.3
Cme06g02454 . 1 256 SNARE and Associated Proteins AT5G16830 58.8 8.5e-75 277.3
Cme06g02454 . 1 256 SNARE and Associated Proteins AT5G46860 65.6 1.4e-79 293.1
Cme06g02454 . 1 256 SNARE and Associated Proteins AT4G17730 60.9 6.8e-74 274.2
Cme06g02454 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 4.3e-52 202.2
Cme10g01057 . 1 336 SNARE and Associated Proteins AT5G05760 64.7 3.4e-110 395.2
Cme03g01671 . 8 338 SNARE and Associated Proteins AT3G24350 64.5 2.8e-102 369.0
Cme05g01576 . 1 327 SNARE and Associated Proteins AT5G26980 75.8 5.5e-126 447.6
Cme01g02227 . 1 302 SNARE and Associated Proteins AT5G26980 66.0 3.1e-97 352.1
Cme05g01576 . 1 329 SNARE and Associated Proteins AT4G02195 63.7 3.5e-104 375.2
Cme01g02227 . 1 302 SNARE and Associated Proteins AT4G02195 67.3 1.8e-100 362.8
Cme05g01576 . 1 328 SNARE and Associated Proteins AT3G05710 74.8 7.9e-128 453.8
Cme01g02227 . 1 302 SNARE and Associated Proteins AT3G05710 63.1 6.3e-93 337.8
Cme01g00994 . 1 233 SNARE and Associated Proteins AT1G16240 73.8 2.4e-91 332.0
Cme06g02818 . 4 220 SNARE and Associated Proteins AT1G16240 65.3 1.9e-72 269.2
Cme01g00994 . 1 233 SNARE and Associated Proteins AT1G79590 73.0 1.2e-89 326.6
Cme06g02818 . 4 220 SNARE and Associated Proteins AT1G79590 65.3 4.4e-73 271.6
Cme11g02501 . 56 246 SNARE and Associated Proteins AT1G28490 71.7 1.4e-66 249.6
Cme04g02538 . 1 264 SNARE and Associated Proteins AT3G09740 78.6 4.9e-112 401.0
Cme04g02539 . 1 264 SNARE and Associated Proteins AT3G09740 78.6 4.9e-112 401.0
Cme11g01790 . 1 235 SNARE and Associated Proteins AT3G09740 66.2 5.4e-79 291.2
Cme04g02538 . 1 264 SNARE and Associated Proteins AT3G45280 64.8 1.1e-87 320.1
Cme04g02539 . 1 264 SNARE and Associated Proteins AT3G45280 64.8 1.1e-87 320.1
Cme11g01790 . 1 237 SNARE and Associated Proteins AT3G45280 64.0 2.8e-75 278.9
Cme04g02538 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.9e-95 344.0
Cme04g02539 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.9e-95 344.0
Cme11g01790 . 1 235 SNARE and Associated Proteins AT3G61450 60.6 1.4e-74 276.6
Cme03g00216 . 65 308 SNARE and Associated Proteins AT1G51740 74.0 1.2e-93 339.7
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002063 3 5 2 3 2 1 3 1 2 1 1 1 3 2 2 3 1 4 3 1 2 2 1 2 2 2 1 5 3 1 65