Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Cme11g01725	ATGACCCCAATCCCAACTCATTGTTGTTATTTGTTTTGGTTGACTTCCAGGTTGTTTTCTGATTTTTCTGCGAATTTTGAACTCGGTTTTCGTTTTGCAATGGCTACCGAGGCGACTGAAGCCACGACTAAGTTCCAAAGTCCGGATTTCCGTCCGGTACCGTCGCCTCCAGATTTCCATCCCGAGATTGTGGTGTCAGCTCATGATGGTCTTCGGTTCTGGCAGTTCATGATTGCCGGTTCAATCGCTGGTTCTGCTGAACATATGGCTATGTTCCCGATCGATACCGTCAAGACCCATATGCAAGCACTTGGTTCTTGTCCAATTAAATCTGTTGGAGTTCGACAAGCCCTTCGGTCAATTTTGAAATCAGAGGGACCTGCTGGGTTTTATCGTGGTATTGGTGCTATGGGTCTTGGAGCTGGACCAGCACATGCTGTGTATTTTACAGTTTACGAGAATTGTAAGAAGTTTTTCTCTGGTGGGGATCCTAATAATTCTCTTGCTCATGCTGCTTCTGGGGTCTGTGCAACGGTGGCGAGTGATGCTGTGTTCACACCGATGGATATGGTTAAACAGAGGCTGCAGTTGAGTAATAATCCCTACAAGGGAGTTTTGGATTGTATCAAAAAGGTTCTTAGAGATGAGGGGTTTAAAGCATTTTATGCATCATATAGAACTACGGTGTTGATGAATGCACCATTTACTGCTGTGCATTTTGCTACTTATGAAGCTGCAAAGAGAGGTTTGATGGAGGTTTCCCCAGAAAGTGTGAATGATGAACAGTGGATTGTTCATGCGACGGCTGGAGCTGTTGCTGGAGCTTCAGCTGCGTTTGTTACAACGCCGCTCGATGTGGTTAAGACTCAATTACAATGCCAGAAGTCAGTCCAAATTGCATTGAAGAGGGAAGAGTTTGTTTCCTGTCCATTTGTATCCAAATCCGTTGCCAATGATTTGGATGAAAAGTTCCCATTTTTGTCGAGGTTCCAAGTCCATTTGTCTCTAGAAGTAGTAGGAGTGACGGGTGTTTGTGGATGCGACAGATTCAAAAGTGGGTCAATCAGGGACGTAATTCGAACAATACTCAAGAAGGATGGATACAGAGGGCTAATGAGGGGATGGGTTCCAAGGATGCTCTTTCATGCCCCGGCTGCAGCTATTTGCTGGTCGACATATGAAGCATTAAAATCCTTCTTCCACGATCTCAATGGCGGCAGCAGCGACAACGGAACCTGA	1239	45.52	MTPIPTHCCYLFWLTSRLFSDFSANFELGFRFAMATEATEATTKFQSPDFRPVPSPPDFHPEIVVSAHDGLRFWQFMIAGSIAGSAEHMAMFPIDTVKTHMQALGSCPIKSVGVRQALRSILKSEGPAGFYRGIGAMGLGAGPAHAVYFTVYENCKKFFSGGDPNNSLAHAASGVCATVASDAVFTPMDMVKQRLQLSNNPYKGVLDCIKKVLRDEGFKAFYASYRTTVLMNAPFTAVHFATYEAAKRGLMEVSPESVNDEQWIVHATAGAVAGASAAFVTTPLDVVKTQLQCQKSVQIALKREEFVSCPFVSKSVANDLDEKFPFLSRFQVHLSLEVVGVTGVCGCDRFKSGSIRDVIRTILKKDGYRGLMRGWVPRMLFHAPAAAICWSTYEALKSFFHDLNGGSSDNGT	412

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
11	25323026	25327991	-	MELO3C025699.2.1	Cme11g01725	342388

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Cme11g01725	412	ProSiteProfiles	Solute carrier (Solcar) repeat profile.	165	249	IPR018108	-
Cme11g01725	412	PANTHER	MITOFERRIN-1-RELATED	342	406	-	-
Cme11g01725	412	PANTHER	MITOFERRIN-1-RELATED	38	295	-	-
Cme11g01725	412	Gene3D	Mitochondrial carrier domain	200	412	IPR023395	-
Cme11g01725	412	ProSiteProfiles	Solute carrier (Solcar) repeat profile.	71	158	IPR018108	-
Cme11g01725	412	Pfam	Mitochondrial carrier protein	262	401	IPR018108	-
Cme11g01725	412	Pfam	Mitochondrial carrier protein	166	252	IPR018108	-
Cme11g01725	412	Pfam	Mitochondrial carrier protein	71	160	IPR018108	-
Cme11g01725	412	PRINTS	Mitochondrial carrier protein signature	222	240	IPR002067	GO:0055085
Cme11g01725	412	PRINTS	Mitochondrial carrier protein signature	270	292	IPR002067	GO:0055085
Cme11g01725	412	PRINTS	Mitochondrial carrier protein signature	180	198	IPR002067	GO:0055085
Cme11g01725	412	PRINTS	Mitochondrial carrier protein signature	89	103	IPR002067	GO:0055085
Cme11g01725	412	SUPERFAMILY	Mitochondrial carrier	69	395	IPR023395	-
Cme11g01725	412	Gene3D	Mitochondrial carrier domain	44	199	IPR023395	-
Cme11g01725	412	ProSiteProfiles	Solute carrier (Solcar) repeat profile.	261	399	IPR018108	-
Cme11g01725	412	PANTHER	MITOCHONDRIAL CARRIER PROTEIN, EXPRESSED	342	406	-	-
Cme11g01725	412	PANTHER	MITOCHONDRIAL CARRIER PROTEIN, EXPRESSED	38	295	-	-

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Cme11g01725	K15113	SLC25A28_37, MFRN; solute carrier family 25 (mitochondrial iron transporter), member 28/37	-	csv:101215924	639.032

Dupl-types

Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
Cme08g02177	Cme-Chr8:27804945	Cme11g01725	Cme-Chr11:25323026	4.43E-146	dispersed
Cme09g00204	Cme-Chr9:1610689	Cme11g01725	Cme-Chr11:25323026	6.10E-10	dispersed
Cme10g00125	Cme-Chr10:889453	Cme11g01725	Cme-Chr11:25323026	1.67E-07	dispersed
Cme11g00204	Cme-Chr11:2447836	Cme11g01725	Cme-Chr11:25323026	7.62E-19	dispersed
Cme11g01725	Cme-Chr11:25323026	Cme06g00138	Cme-Chr6:842810	7.80E-28	dispersed
Cme11g01725	Cme-Chr11:25323026	Cme08g02449	Cme-Chr8:31357978	4.87E-06	transposed

Deco-Alignment

Select	Vvi1	Blo1	Blo2	Bda1	Bda2	Bpe1	Bpe2	Bma1	Bma2	Cmo1	Cmo2	Cma1	Cma2	Car1	Car2	Sed1	Cpe1	Cpe2	Bhi1	Tan1	Cmetu1	Lac1	Hepe1	Mch1	Lcy1	Cla1	Cam1	Cec1	Cco1	Clacu1	Cmu1	Cre1	Cone1	Cone2	Cone3	Cone4	Lsi1	Csa1	Chy1	Cme1	Blo3	Blo4	Bda3	Bda4	Bpe3	Bpe4	Bma3	Bma4	Sed2	Cmo3	Cmo4	Cma3	Cma4	Car3	Car4	Cpe3	Cpe4	Bhi2	Tan2	Cmetu2	Lac2	Hepe2	Mch2	Lcy2	Cla2	Cam2	Cec2	Cco2	Clacu2	Cmu2	Cre2	Lsi2	Csa2	Chy2	Cme2
	Vvi6g700	.	Blo03g01202	Bda02g00881	.	Bpe01g00070	Bpe08g01410	.	Bma07g01583	.	.	.	.	.	.	.	Cpe05g00987	.	.	.	.	.	.	.	.	Cla02g01883	Cam02g1998	Cec02g2028	Cco02g2063	Clacu02g1978	Cmu02g1923	Cre02g2238	Cone1ag0764	Cone5ag1055	.	.	.	Csa06g01392	Chy11g01383	Cme11g01725	Blo13g01027	Blo14g00065	.	.	.	.	.	.	Sed05g3793	Cmo02g00725	Cmo20g00352	Cma02g00724	Cma20g00327	Car02g00514	Car20g00286	Cpe16g00674	.	Bhi10g00847	Tan05g0522	Cmetu11g0163	.	Hepe08g0701	.	.	.	.	.	.	.	.	.	.	.	.	.

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Cme12g00204	.	54	432	Chloroplast and Mitochondria Gene Families	AT2G28800	62.0	1.3e-122	436.8
Cme03g02205	.	71	425	Chloroplast and Mitochondria Gene Families	AT2G28800	55.2	1.3e-98	357.1
Cme03g00333	.	3	255	Chloroplast and Mitochondria Gene Families	AT1G15820	80.8	2.6e-118	421.8
Cme01g00539	.	1	272	Chloroplast and Mitochondria Gene Families	AT3G27690	87.2	6.6e-142	500.4
Cme11g01575	.	2	267	Chloroplast and Mitochondria Gene Families	AT3G27690	78.4	6.4e-121	430.6
Cme08g00161	.	75	338	Chloroplast and Mitochondria Gene Families	AT3G27690	77.4	1.1e-120	429.9
Cme08g00160	.	2	265	Chloroplast and Mitochondria Gene Families	AT3G27690	77.0	3.2e-120	428.3
Cme12g01212	.	2	265	Chloroplast and Mitochondria Gene Families	AT3G27690	77.0	1.0e-118	423.3
Cme04g01040	.	1	265	Chloroplast and Mitochondria Gene Families	AT3G27690	76.9	1.5e-117	419.5
Cme06g02076	.	5	264	Chloroplast and Mitochondria Gene Families	AT3G27690	66.3	4.9e-97	351.3
Cme09g00132	.	71	274	Chloroplast and Mitochondria Gene Families	AT3G27690	52.6	1.1e-51	200.7
Cme10g00664	.	1	156	Chloroplast and Mitochondria Gene Families	AT3G61470	92.9	4.7e-88	321.2
Cme02g00318	.	56	261	Chloroplast and Mitochondria Gene Families	AT3G61470	66.0	3.1e-87	318.5
Cme05g01586	.	1	197	Chloroplast and Mitochondria Gene Families	AT3G54890	82.0	9.3e-90	326.6
Cme08g02519	.	3	284	Chloroplast and Mitochondria Gene Families	AT3G08940	83.4	1.2e-135	479.6
Cme07g00015	.	55	253	Chloroplast and Mitochondria Gene Families	AT1G76570	75.4	3.8e-90	328.6
Cme02g00798	.	1	273	Chloroplast and Mitochondria Gene Families	AT1G61520	85.3	8.4e-136	479.9
Cme01g00539	.	1	272	Chloroplast and Mitochondria Gene Families	AT2G05070	87.1	1.0e-141	499.6
Cme08g00161	.	78	338	Chloroplast and Mitochondria Gene Families	AT2G05070	78.6	2.8e-120	428.3
Cme11g01575	.	7	267	Chloroplast and Mitochondria Gene Families	AT2G05070	78.9	6.3e-120	427.2
Cme08g00160	.	5	265	Chloroplast and Mitochondria Gene Families	AT2G05070	78.2	8.2e-120	426.8
Cme12g01212	.	5	265	Chloroplast and Mitochondria Gene Families	AT2G05070	78.2	1.2e-118	422.9
Cme04g01040	.	27	265	Chloroplast and Mitochondria Gene Families	AT2G05070	82.8	8.5e-117	416.8
Cme06g02076	.	5	264	Chloroplast and Mitochondria Gene Families	AT2G05070	68.4	2.0e-97	352.4
Cme09g00132	.	71	274	Chloroplast and Mitochondria Gene Families	AT2G05070	53.1	7.3e-52	201.1
Cme01g00539	.	1	244	Chloroplast and Mitochondria Gene Families	AT2G05100	86.9	5.6e-123	437.6
Cme08g00161	.	78	310	Chloroplast and Mitochondria Gene Families	AT2G05100	75.9	2.1e-101	365.9
Cme08g00160	.	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	75.9	2.7e-101	365.5
Cme11g01575	.	7	239	Chloroplast and Mitochondria Gene Families	AT2G05100	77.4	4.6e-101	364.8
Cme12g01212	.	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	76.5	3.0e-100	362.1
Cme04g01040	.	8	237	Chloroplast and Mitochondria Gene Families	AT2G05100	76.7	7.3e-99	357.5
Cme06g02076	.	5	236	Chloroplast and Mitochondria Gene Families	AT2G05100	67.6	2.8e-82	302.4
Cme09g00132	.	71	258	Chloroplast and Mitochondria Gene Families	AT2G05100	51.8	2.6e-43	172.9
Cme08g02519	.	3	167	Chloroplast and Mitochondria Gene Families	AT2G40100	72.8	7.4e-67	250.4
Cme11g01575	.	1	267	Chloroplast and Mitochondria Gene Families	AT1G29930	88.8	5.7e-137	483.8
Cme08g00160	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29930	88.8	2.2e-136	481.9
Cme08g00161	.	74	338	Chloroplast and Mitochondria Gene Families	AT1G29930	88.8	8.3e-136	479.9
Cme12g01212	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29930	87.3	2.0e-134	475.3
Cme04g01040	.	4	265	Chloroplast and Mitochondria Gene Families	AT1G29930	83.8	2.3e-125	445.3
Cme01g00539	.	3	272	Chloroplast and Mitochondria Gene Families	AT1G29930	76.3	8.9e-114	406.8
Cme06g02076	.	1	264	Chloroplast and Mitochondria Gene Families	AT1G29930	65.3	7.8e-94	340.5
Cme09g00132	.	54	274	Chloroplast and Mitochondria Gene Families	AT1G29930	50.7	5.1e-53	204.9
Cme11g01575	.	1	267	Chloroplast and Mitochondria Gene Families	AT1G29920	88.4	2.2e-136	481.9
Cme08g00160	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29920	88.4	8.3e-136	479.9
Cme08g00161	.	74	338	Chloroplast and Mitochondria Gene Families	AT1G29920	88.4	3.1e-135	478.0
Cme12g01212	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29920	86.9	7.7e-134	473.4
Cme04g01040	.	4	265	Chloroplast and Mitochondria Gene Families	AT1G29920	83.8	2.9e-125	444.9
Cme01g00539	.	3	272	Chloroplast and Mitochondria Gene Families	AT1G29920	75.9	5.2e-114	407.5
Cme06g02076	.	34	264	Chloroplast and Mitochondria Gene Families	AT1G29920	69.4	7.8e-94	340.5
Cme09g00132	.	54	274	Chloroplast and Mitochondria Gene Families	AT1G29920	50.7	5.1e-53	204.9
Cme11g01575	.	1	267	Chloroplast and Mitochondria Gene Families	AT1G29910	88.4	2.2e-136	481.9
Cme08g00160	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29910	88.4	8.3e-136	479.9
Cme08g00161	.	74	338	Chloroplast and Mitochondria Gene Families	AT1G29910	88.4	3.1e-135	478.0
Cme12g01212	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29910	86.9	7.7e-134	473.4
Cme04g01040	.	4	265	Chloroplast and Mitochondria Gene Families	AT1G29910	83.8	2.9e-125	444.9
Cme01g00539	.	3	272	Chloroplast and Mitochondria Gene Families	AT1G29910	75.9	5.2e-114	407.5
Cme06g02076	.	34	264	Chloroplast and Mitochondria Gene Families	AT1G29910	69.4	7.8e-94	340.5
Cme09g00132	.	54	274	Chloroplast and Mitochondria Gene Families	AT1G29910	50.7	5.1e-53	204.9
Cme09g00132	.	11	289	Chloroplast and Mitochondria Gene Families	AT4G10340	84.3	2.1e-137	485.3
Cme04g01040	.	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	54.5	1.6e-57	219.9
Cme08g00160	.	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	54.5	6.1e-57	218.0
Cme12g01212	.	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	51.6	8.0e-57	217.6
Cme11g01575	.	51	255	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	1.0e-56	217.2
Cme08g00161	.	122	326	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	1.4e-56	216.9
Cme01g00539	.	55	260	Chloroplast and Mitochondria Gene Families	AT4G10340	52.4	3.2e-53	205.7
Cme06g02076	.	46	252	Chloroplast and Mitochondria Gene Families	AT4G10340	54.0	3.5e-52	202.2
Cme11g01575	.	1	267	Chloroplast and Mitochondria Gene Families	AT2G34420	88.8	3.7e-136	481.1
Cme08g00160	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34420	88.0	9.1e-135	476.5
Cme08g00161	.	74	338	Chloroplast and Mitochondria Gene Families	AT2G34420	88.0	3.4e-134	474.6
Cme12g01212	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34420	86.9	3.8e-133	471.1
Cme04g01040	.	4	265	Chloroplast and Mitochondria Gene Families	AT2G34420	84.2	4.5e-126	447.6
Cme01g00539	.	3	272	Chloroplast and Mitochondria Gene Families	AT2G34420	75.2	1.8e-114	409.1
Cme06g02076	.	34	264	Chloroplast and Mitochondria Gene Families	AT2G34420	69.8	7.8e-94	340.5
Cme08g00161	.	74	338	Chloroplast and Mitochondria Gene Families	AT2G34430	89.8	6.7e-138	486.9
Cme08g00160	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34430	89.5	2.6e-137	485.0
Cme12g01212	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34430	87.6	1.3e-136	482.6
Cme11g01575	.	1	267	Chloroplast and Mitochondria Gene Families	AT2G34430	88.4	6.3e-136	480.3
Cme04g01040	.	4	265	Chloroplast and Mitochondria Gene Families	AT2G34430	85.2	3.7e-128	454.5
Cme01g00539	.	31	272	Chloroplast and Mitochondria Gene Families	AT2G34430	81.5	3.7e-112	401.4
Cme06g02076	.	34	264	Chloroplast and Mitochondria Gene Families	AT2G34430	70.5	7.8e-94	340.5
Cme08g02519	.	2	284	Chloroplast and Mitochondria Gene Families	AT5G01530	84.5	3.9e-139	491.1
Cme06g01704	.	48	307	Chloroplast and Mitochondria Gene Families	AT5G40810	93.5	3.6e-144	507.7
Cme06g01704	.	1	307	Chloroplast and Mitochondria Gene Families	AT3G27240	86.7	3.0e-150	528.1
Cme11g01725	.	38	405	Chloroplast and Mitochondria Gene Families	AT2G30160	65.7	7.8e-136	480.3
Cme08g02177	.	63	365	Chloroplast and Mitochondria Gene Families	AT2G30160	65.5	8.4e-114	407.1
Cme11g01725	.	38	408	Chloroplast and Mitochondria Gene Families	AT1G07030	65.2	8.5e-135	476.9
Cme08g02177	.	59	365	Chloroplast and Mitochondria Gene Families	AT1G07030	68.2	1.3e-119	426.4
Cme01g02233	.	1	341	Chloroplast and Mitochondria Gene Families	AT2G47490	68.4	4.6e-130	461.1
Cme09g01426	.	11	320	Chloroplast and Mitochondria Gene Families	AT2G47490	58.8	4.1e-102	368.2
Cme09g01426	.	10	315	Chloroplast and Mitochondria Gene Families	AT1G25380	64.8	7.8e-113	404.1
Cme01g02233	.	11	333	Chloroplast and Mitochondria Gene Families	AT1G25380	57.4	4.0e-101	365.2
Cme11g01086	CCT	1	585	Chloroplast and Mitochondria Gene Families	AT4G21490	69.1	1.3e-239	825.9
Cme01g00362	CCT	1	575	Chloroplast and Mitochondria Gene Families	AT4G21490	64.4	3.0e-223	771.5
Cme12g01401	.	6	521	Chloroplast and Mitochondria Gene Families	AT4G21490	72.3	1.2e-216	749.6
Cme01g02831	.	5	182	Chloroplast and Mitochondria Gene Families	AT1G17530	64.6	2.3e-60	228.8
Cme02g01431	.	36	214	Chloroplast and Mitochondria Gene Families	AT1G17530	57.5	2.5e-51	198.7
Cme02g01431	.	35	218	Chloroplast and Mitochondria Gene Families	AT3G04800	56.2	5.2e-52	201.1
Cme01g02831	.	22	180	Chloroplast and Mitochondria Gene Families	AT3G04800	55.9	6.0e-40	161.0
Cme01g02831	.	15	182	Chloroplast and Mitochondria Gene Families	AT1G72750	67.6	9.8e-59	223.4
Cme02g01431	.	38	218	Chloroplast and Mitochondria Gene Families	AT1G72750	58.7	4.7e-53	204.5
Cme09g00161	.	86	240	Chloroplast and Mitochondria Gene Families	AT1G26100	50.6	3.7e-39	158.7
Cme10g00300	.	15	121	Chloroplast and Mitochondria Gene Families	AT1G26100	65.4	4.1e-38	155.2
Cme09g00161	.	1	247	Chloroplast and Mitochondria Gene Families	AT5G38630	60.4	8.8e-78	287.0
Cme04g00023	.	23	218	Chloroplast and Mitochondria Gene Families	AT4G25570	71.9	1.2e-81	300.1
Cme09g01298	.	5	222	Chloroplast and Mitochondria Gene Families	AT1G14730	51.4	1.0e-62	236.9
Cme09g01145	.	9	375	Chloroplast and Mitochondria Gene Families	AT5G14040	78.6	2.2e-166	582.0
Cme06g01908	.	10	355	Chloroplast and Mitochondria Gene Families	AT5G14040	75.8	1.0e-155	546.6
Cme02g02103	.	28	336	Chloroplast and Mitochondria Gene Families	AT5G14040	84.6	7.2e-154	540.4
Cme01g01928	.	11	298	Chloroplast and Mitochondria Gene Families	AT5G14040	52.7	1.1e-85	313.9
Cme06g01908	.	8	361	Chloroplast and Mitochondria Gene Families	AT3G48850	70.5	3.3e-143	505.0
Cme09g01145	.	8	375	Chloroplast and Mitochondria Gene Families	AT3G48850	67.8	5.7e-140	494.2
Cme02g02103	.	29	336	Chloroplast and Mitochondria Gene Families	AT3G48850	75.3	4.9e-139	491.1
Cme01g01928	.	11	297	Chloroplast and Mitochondria Gene Families	AT3G48850	51.5	2.4e-85	312.8
Cme01g01928	.	14	309	Chloroplast and Mitochondria Gene Families	AT2G17270	75.7	7.1e-131	463.8
Cme06g01908	.	62	360	Chloroplast and Mitochondria Gene Families	AT2G17270	52.2	5.7e-88	321.2
Cme09g00204	.	16	313	Chloroplast and Mitochondria Gene Families	AT5G15640	77.7	6.1e-130	460.7
Cme07g00195	.	12	345	Chloroplast and Mitochondria Gene Families	AT5G26200	68.0	3.2e-124	441.8
Cme01g02825	.	1	259	Chloroplast and Mitochondria Gene Families	AT5G26200	57.7	9.7e-73	270.8
Cme07g00195	.	1	346	Chloroplast and Mitochondria Gene Families	AT1G72820	68.2	3.0e-130	461.8
Cme01g02825	.	1	263	Chloroplast and Mitochondria Gene Families	AT1G72820	72.6	1.9e-103	372.9
Cme09g01790	.	78	280	Chloroplast and Mitochondria Gene Families	AT5G52570	52.2	2.8e-47	185.7
Cme06g01033	.	67	285	Chloroplast and Mitochondria Gene Families	AT4G25700	61.4	3.1e-67	251.9
Cme09g01790	.	65	201	Chloroplast and Mitochondria Gene Families	AT4G25700	72.3	5.6e-53	204.5
Cme01g00379	.	101	287	Chloroplast and Mitochondria Gene Families	AT4G03320	51.1	6.9e-56	214.5
Cme06g02078	.	72	359	Chloroplast and Mitochondria Gene Families	AT5G54290	79.7	2.2e-120	429.1
Cme02g01000	.	54	547	Chloroplast and Mitochondria Gene Families	AT2G18710	85.9	1.4e-241	832.4

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0001660	3	2	4	3	4	2	3	2	2	2	2	2	4	2	2	4	2	1	4	2	2	2	2	2	2	2	1	2	2	1	70

Transcriptome

Select	Gene	Chr	Type	da1	da2	da3	da4	da5	da6	da7	da8	da9	da10
	Cme11g01725	Cme_Chr11	FPKM	0.427848	0.0	31.695007	32.352337	96.842834	98.160942	85.837326	19.584183	23.84584	22.410419