Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cme12g01397 ATGAACGATTTATTCTCGAACTCGTTCAAGAAGTACACGGATCTGAAGCAACAAGCATATCTGGACAGCATGGAGGCTGGAAATGAGAGTGTAAATTTGGACAGGTTCTTTGAGGATGTTGAAAATGTTAAAGATGACATGAAACAAGTGGAGAATTTGTACAAGAAATTGCAGCAGGCTAATGAGGAGTGTAAGGTTGTGCATAATGCCAAGACAATGAAGGAGCTGAGGGGCCGAATGGAGGCTGATGTTGCTCAAGTTCTCAAGCGAGTCAAATTGATCAAAGGAAAGCTCGAAGCTCTTGAGCGTTCTAATGCCGCTCACCGTGGCCTCCCCGGTTGTGGCCCTGGCTCTTCTGCTGACCGAACTCGAACCTCTGTTGTCAGCGGCTTGGGAAAGAAGCTCAAAGATGTTATGGATGATTTTCAAGGCCTTAGAGCTCGAATGAATGCCGAGTATAAAGAAACCGTCGAGCGAAGGTACTTCACAGTGACAGGGCAGAAAGCAAATGAAGAAACAATAGAGAATTTGATATCAAGTGGGGAAAGTGAGAGCTTCCTACAGAAGGCAATTCAAGAACAGGGTAGAGGTCAAATAATGGACACAATTTCGGAGATTCAAGAACGACATGACGCTGTGAAGGAAATAGAGAAGAATTTGATAGAGCTGCATCAGATTTTCTTGGACATGGCAGCTTTAGTTGAAGCTCAAGGCCACCAACTGAACGACATCGAAAGCCATGTCGCGCACGCTAACTCGTTCGTTAGAAGAGGAACAGAACAACTCCAAGAAGCCAGAGAGTATCAAAAGAGCTCAAGGAAATGGACTTGCTATGCCATACTTTTGGGAGCTATTCTTATTATCGTTCTTCTCTTCCCACTATTAACTTCAATTTTACCTCATTTGTTGTAG 912 43.97 MNDLFSNSFKKYTDLKQQAYLDSMEAGNESVNLDRFFEDVENVKDDMKQVENLYKKLQQANEECKVVHNAKTMKELRGRMEADVAQVLKRVKLIKGKLEALERSNAAHRGLPGCGPGSSADRTRTSVVSGLGKKLKDVMDDFQGLRARMNAEYKETVERRYFTVTGQKANEETIENLISSGESESFLQKAIQEQGRGQIMDTISEIQERHDAVKEIEKNLIELHQIFLDMAALVEAQGHQLNDIESHVAHANSFVRRGTEQLQEAREYQKSSRKWTCYAILLGAILIIVLLFPLLTSILPHLL 303
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
12 21851130 21852388 - MELO3C002559.2.1 Cme12g01397 344614

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cme12g01397 303 Gene3D - 33 160 - -
Cme12g01397 303 PANTHER SYNTAXIN 6 295 IPR045242 -
Cme12g01397 303 CDD SNARE_syntaxin1-like 202 264 - -
Cme12g01397 303 Pfam Syntaxin 35 238 IPR006011 GO:0016020
Cme12g01397 303 PANTHER SYNTAXIN-124-RELATED 6 295 - -
Cme12g01397 303 CDD SynN 33 190 IPR006011 GO:0016020
Cme12g01397 303 SUPERFAMILY t-snare proteins 32 258 IPR010989 GO:0016020|GO:0016192
Cme12g01397 303 Gene3D - 193 295 - -
Cme12g01397 303 ProSitePatterns Syntaxin / epimorphin family signature. 209 248 IPR006012 GO:0005484|GO:0006886|GO:0016020
Cme12g01397 303 SMART tSNARE_6 198 265 IPR000727 -
Cme12g01397 303 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 203 265 IPR000727 -
Cme12g01397 303 Pfam SNARE domain 240 291 IPR000727 -
Cme12g01397 303 Coils Coil 33 70 - -
Cme12g01397 303 SMART SynN_4 28 154 IPR006011 GO:0016020
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cme12g01397 K08486 STX1B_2_3; syntaxin 1B/2/3 - csv:101217140 576.244
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cme06g02454 Cme-Chr6:31570340 Cme12g01397 Cme-Chr12:21851130 4.21E-11 dispersed
Cme08g01151 Cme-Chr8:8134579 Cme12g01397 Cme-Chr12:21851130 2.12E-115 dispersed
Cme08g02007 Cme-Chr8:25241527 Cme12g01397 Cme-Chr12:21851130 2.24E-100 dispersed
Cme11g00777 Cme-Chr11:9709170 Cme12g01397 Cme-Chr12:21851130 1.47E-68 dispersed
Cme12g01397 Cme-Chr12:21851130 Cme04g02317 Cme-Chr4:30097548 7.04E-120 transposed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cme03g01671 . 8 338 SNARE and Associated Proteins AT3G24350 64.5 2.8e-102 369.0
Cme08g02007 CCT 1 309 SNARE and Associated Proteins AT1G08560 68.8 6.5e-100 360.9
Cme04g02317 . 22 280 SNARE and Associated Proteins AT3G11820 80.3 6.1e-114 407.5
Cme08g01151 . 90 349 SNARE and Associated Proteins AT3G11820 70.0 6.6e-100 360.9
Cme12g01397 . 31 281 SNARE and Associated Proteins AT3G11820 65.3 1.1e-91 333.6
Cme04g01796 CCT 30 282 SNARE and Associated Proteins AT3G11820 52.2 9.6e-67 250.8
Cme04g02317 . 31 280 SNARE and Associated Proteins AT3G52400 68.8 2.3e-90 329.3
Cme08g01151 . 67 349 SNARE and Associated Proteins AT3G52400 59.8 1.9e-84 309.7
Cme12g01397 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 5.7e-81 298.1
Cme12g01397 . 1 299 SNARE and Associated Proteins AT4G03330 67.5 5.4e-107 384.4
Cme04g02317 . 1 285 SNARE and Associated Proteins AT4G03330 56.6 5.4e-83 304.7
Cme08g01151 . 67 347 SNARE and Associated Proteins AT4G03330 54.8 1.1e-78 290.4
Cme04g01796 CCT 1 282 SNARE and Associated Proteins AT4G03330 51.4 1.7e-68 256.5
Cme12g01397 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 1.6e-127 452.6
Cme04g02317 . 1 285 SNARE and Associated Proteins AT1G61290 61.3 9.2e-91 330.5
Cme08g01151 . 67 365 SNARE and Associated Proteins AT1G61290 54.5 1.5e-80 296.6
Cme12g01397 . 1 299 SNARE and Associated Proteins AT1G11250 77.9 2.8e-124 441.8
Cme04g02317 . 1 285 SNARE and Associated Proteins AT1G11250 61.8 2.8e-92 335.5
Cme08g01151 . 67 361 SNARE and Associated Proteins AT1G11250 54.6 3.1e-83 305.4
Cme04g01796 CCT 1 305 SNARE and Associated Proteins AT3G03800 73.3 4.6e-114 407.9
Cme11g00777 . 48 325 SNARE and Associated Proteins AT3G03800 52.9 1.3e-73 273.5
Cme04g01796 CCT 1 200 SNARE and Associated Proteins AT5G08080 79.0 5.7e-82 300.8
Cme11g00777 . 30 224 SNARE and Associated Proteins AT5G08080 53.3 1.4e-43 173.3
Cme06g02454 . 1 256 SNARE and Associated Proteins AT5G16830 58.8 8.5e-75 277.3
Cme06g02454 . 1 256 SNARE and Associated Proteins AT5G46860 65.6 1.4e-79 293.1
Cme06g02454 . 1 256 SNARE and Associated Proteins AT4G17730 60.9 6.8e-74 274.2
Cme06g02454 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 4.3e-52 202.2
Cme10g01057 . 1 336 SNARE and Associated Proteins AT5G05760 64.7 3.4e-110 395.2
Cme03g01671 . 8 338 SNARE and Associated Proteins AT3G24350 64.5 2.8e-102 369.0
Cme05g01576 . 1 327 SNARE and Associated Proteins AT5G26980 75.8 5.5e-126 447.6
Cme01g02227 . 1 302 SNARE and Associated Proteins AT5G26980 66.0 3.1e-97 352.1
Cme05g01576 . 1 329 SNARE and Associated Proteins AT4G02195 63.7 3.5e-104 375.2
Cme01g02227 . 1 302 SNARE and Associated Proteins AT4G02195 67.3 1.8e-100 362.8
Cme05g01576 . 1 328 SNARE and Associated Proteins AT3G05710 74.8 7.9e-128 453.8
Cme01g02227 . 1 302 SNARE and Associated Proteins AT3G05710 63.1 6.3e-93 337.8
Cme01g00994 . 1 233 SNARE and Associated Proteins AT1G16240 73.8 2.4e-91 332.0
Cme06g02818 . 4 220 SNARE and Associated Proteins AT1G16240 65.3 1.9e-72 269.2
Cme01g00994 . 1 233 SNARE and Associated Proteins AT1G79590 73.0 1.2e-89 326.6
Cme06g02818 . 4 220 SNARE and Associated Proteins AT1G79590 65.3 4.4e-73 271.6
Cme11g02501 . 56 246 SNARE and Associated Proteins AT1G28490 71.7 1.4e-66 249.6
Cme04g02538 . 1 264 SNARE and Associated Proteins AT3G09740 78.6 4.9e-112 401.0
Cme04g02539 . 1 264 SNARE and Associated Proteins AT3G09740 78.6 4.9e-112 401.0
Cme11g01790 . 1 235 SNARE and Associated Proteins AT3G09740 66.2 5.4e-79 291.2
Cme04g02538 . 1 264 SNARE and Associated Proteins AT3G45280 64.8 1.1e-87 320.1
Cme04g02539 . 1 264 SNARE and Associated Proteins AT3G45280 64.8 1.1e-87 320.1
Cme11g01790 . 1 237 SNARE and Associated Proteins AT3G45280 64.0 2.8e-75 278.9
Cme04g02538 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.9e-95 344.0
Cme04g02539 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.9e-95 344.0
Cme11g01790 . 1 235 SNARE and Associated Proteins AT3G61450 60.6 1.4e-74 276.6
Cme03g00216 . 65 308 SNARE and Associated Proteins AT1G51740 74.0 1.2e-93 339.7
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0005716 1 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 2 1 1 37