Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cmetu01g0565 ATGGCGACGAGGAATCGAACTGCACAGTTTAGAAGGCACAGGGATGCCGTGAAGAGCGTCCGTGCGCCTCTATCCTCTTCGGCAGCTGGTTCCAGTGGACCGGTTATTGAGATGGTGAGTTCGTCTCTTCTTCGTTCGAAACGCTCTTCTTCATATGCTCCTCTCAGCACTGAAGATCCAGGACCTTCGAGCAGCGATGCATTTATGGTGGGTCTACCTCCAGCTTGGGTGGATGATTCTGAAGAAATAACTGTTAATATACAGAAAATTCGTAGGAAGATGGCAGAGTTAGTCAAGGCTCATTCCAAAGCTTTAATGCCTTCTTTTGCTGATGGCAAAGAAGACGAGCATACGATTGAGGCACTTACTCTAGAGATTACCAATCTTTTGAAAACCTCTGAGAAGAGGTTGAAGAAAATTCCTAGTACTGGGTCCTCAGAAGATATTAACATCAGAAAAAATGTCCAGCGTTCTCTTGCTACAGAGCTTCAGAATCTTTCGATGGATCTTCGTAGAAGACAATCAATGTATTTGAAACATCTGCAGCAGCAAAAGGAGGGACATGATGGAATTGATTTGGAGATAAATTTGAATGGAAACCGAACTCTCCAGGAGGATGACGGATATGATGAATTTGGAACAAATGAAAACCAAACGATGACATTAGATGGGCAGCACATTCAGGGAAGGGAGAAAGAGATTAAACAGGTTGTAAAATCCGTAAATGAGCTCGCCCAAATTATGAAGGATCTCTCAACCCTTGTCATAGACCAGGGTACCATTGTCGATAGAATTGACCACAATATTCAGAATGTTGCTGTTTCAGTTGAGGAGGGCTTGAAACAACTTCAAAAGGCAGAGAAGACACAGAAAAATGGAGGAATGGTGAAATGTGCAACAGTGCTTGTTATTATGTGTTTCATAATGCTGGTTCTTTTGATACTAAAGGAGATAATTATGTAA 963 42.26 MATRNRTAQFRRHRDAVKSVRAPLSSSAAGSSGPVIEMVSSSLLRSKRSSSYAPLSTEDPGPSSSDAFMVGLPPAWVDDSEEITVNIQKIRRKMAELVKAHSKALMPSFADGKEDEHTIEALTLEITNLLKTSEKRLKKIPSTGSSEDINIRKNVQRSLATELQNLSMDLRRRQSMYLKHLQQQKEGHDGIDLEINLNGNRTLQEDDGYDEFGTNENQTMTLDGQHIQGREKEIKQVVKSVNELAQIMKDLSTLVIDQGTIVDRIDHNIQNVAVSVEEGLKQLQKAEKTQKNGGMVKCATVLVIMCFIMLVLLILKEIIM 320
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
1 25123435 25127618 + PI0018867.1 Cmetu01g0565 345839

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cmetu01g0565 320 Gene3D - 73 278 - -
Cmetu01g0565 320 SUPERFAMILY t-snare proteins 72 279 IPR010989 GO:0016020|GO:0016192
Cmetu01g0565 320 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 224 286 IPR000727 -
Cmetu01g0565 320 SMART SynN_4 67 182 IPR006011 GO:0016020
Cmetu01g0565 320 MobiDBLite consensus disorder prediction 1 33 - -
Cmetu01g0565 320 Pfam SNARE domain 260 312 IPR000727 -
Cmetu01g0565 320 CDD SNARE_syntaxin16 227 285 - -
Cmetu01g0565 320 ProSitePatterns Syntaxin / epimorphin family signature. 230 269 IPR006012 GO:0005484|GO:0006886|GO:0016020
Cmetu01g0565 320 SMART tSNARE_6 218 286 IPR000727 -
Cmetu01g0565 320 FunFam Syntaxin-43 73 278 - -
Cmetu01g0565 320 PANTHER SYNTAXIN 79 306 IPR045242 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cmetu01g0565 K08489 - - csv:101204192 590.112
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cmetu01g0565 Cmetu-Chr1:25123435 Cmetu05g1168 Cmetu-Chr5:3849383 1.40E-106 dispersed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cmetu03g1681 . 8 336 SNARE and Associated Proteins AT3G24350 62.8 3.0e-102 369.0
Cmetu08g0109 . 1 309 SNARE and Associated Proteins AT1G08560 69.4 6.4e-101 364.4
Cmetu08g1065 . 1 303 SNARE and Associated Proteins AT2G18260 54.7 1.9e-84 309.7
Cmetu04g2079 . 22 280 SNARE and Associated Proteins AT3G11820 80.7 1.8e-114 409.5
Cmetu08g1428 . 24 283 SNARE and Associated Proteins AT3G11820 71.2 5.0e-101 364.8
Cmetu12g0532 . 1 202 SNARE and Associated Proteins AT3G11820 69.8 3.0e-77 285.8
Cmetu04g2542 . 36 291 SNARE and Associated Proteins AT3G11820 52.1 7.6e-65 244.6
Cmetu04g2079 . 31 280 SNARE and Associated Proteins AT3G52400 68.8 3.3e-90 328.9
Cmetu08g1428 . 1 283 SNARE and Associated Proteins AT3G52400 59.5 1.9e-85 313.2
Cmetu12g0532 . 1 202 SNARE and Associated Proteins AT3G52400 65.3 1.8e-67 253.4
Cmetu04g2079 . 1 280 SNARE and Associated Proteins AT4G03330 57.9 1.0e-82 303.9
Cmetu12g0532 . 1 220 SNARE and Associated Proteins AT4G03330 72.3 1.7e-82 303.1
Cmetu08g1428 . 1 299 SNARE and Associated Proteins AT4G03330 52.2 8.3e-77 284.3
Cmetu04g2542 . 48 291 SNARE and Associated Proteins AT4G03330 54.3 1.1e-63 240.7
Cmetu12g0532 . 1 224 SNARE and Associated Proteins AT1G61290 80.4 9.7e-94 340.5
Cmetu04g2079 . 1 280 SNARE and Associated Proteins AT1G61290 62.8 1.0e-90 330.5
Cmetu08g1428 . 1 299 SNARE and Associated Proteins AT1G61290 56.2 3.5e-83 305.4
Cmetu04g2542 . 49 291 SNARE and Associated Proteins AT1G61290 50.4 6.0e-59 224.9
Cmetu12g0532 . 1 224 SNARE and Associated Proteins AT1G11250 79.9 3.9e-95 345.1
Cmetu04g2079 . 1 280 SNARE and Associated Proteins AT1G11250 62.5 9.0e-92 334.0
Cmetu08g1428 . 1 294 SNARE and Associated Proteins AT1G11250 56.8 2.8e-85 312.4
Cmetu04g2542 . 17 314 SNARE and Associated Proteins AT3G03800 71.1 1.0e-106 383.6
Cmetu11g1082 . 1 270 SNARE and Associated Proteins AT3G03800 57.4 1.2e-80 297.0
Cmetu12g0532 . 1 203 SNARE and Associated Proteins AT3G03800 55.7 1.6e-56 216.9
Cmetu04g2542 . 17 209 SNARE and Associated Proteins AT5G08080 75.5 7.0e-73 270.8
Cmetu11g1082 . 2 169 SNARE and Associated Proteins AT5G08080 63.1 2.9e-50 195.7
Cmetu06g0720 . 1 249 SNARE and Associated Proteins AT5G16830 54.7 1.3e-65 246.9
Cmetu06g0720 . 1 249 SNARE and Associated Proteins AT5G46860 59.5 3.6e-68 255.4
Cmetu06g0720 . 1 249 SNARE and Associated Proteins AT4G17730 54.8 2.0e-63 239.6
Cmetu06g0720 . 61 249 SNARE and Associated Proteins AT1G32270 58.9 9.7e-50 194.5
Cmetu10g1254 . 1 336 SNARE and Associated Proteins AT5G05760 65.6 1.7e-110 396.4
Cmetu03g1681 . 8 336 SNARE and Associated Proteins AT3G24350 62.8 3.0e-102 369.0
Cmetu05g1168 . 1 327 SNARE and Associated Proteins AT5G26980 75.5 7.9e-126 447.2
Cmetu01g0565 . 1 318 SNARE and Associated Proteins AT5G26980 66.8 5.5e-103 371.3
Cmetu05g1168 . 1 329 SNARE and Associated Proteins AT4G02195 64.0 5.9e-105 377.9
Cmetu01g0565 . 1 318 SNARE and Associated Proteins AT4G02195 67.1 7.7e-105 377.5
Cmetu05g1168 . 1 328 SNARE and Associated Proteins AT3G05710 75.4 4.6e-129 458.0
Cmetu01g0565 . 1 318 SNARE and Associated Proteins AT3G05710 64.3 4.9e-99 358.2
Cmetu01g0482 . 1 233 SNARE and Associated Proteins AT1G16240 73.0 1.7e-90 329.3
Cmetu06g0075 . 58 286 SNARE and Associated Proteins AT1G16240 68.6 2.5e-81 298.9
Cmetu01g0482 . 1 233 SNARE and Associated Proteins AT1G79590 73.0 9.7e-90 327.0
Cmetu06g0075 . 58 286 SNARE and Associated Proteins AT1G79590 67.7 8.2e-81 297.4
Cmetu11g2412 . 56 246 SNARE and Associated Proteins AT1G28490 71.7 1.1e-66 250.0
Cmetu04g1845 . 1 264 SNARE and Associated Proteins AT3G09740 78.9 2.4e-112 402.1
Cmetu11g0284 . 1 263 SNARE and Associated Proteins AT3G09740 67.2 2.5e-93 339.0
Cmetu11g0284 . 1 263 SNARE and Associated Proteins AT3G45280 64.9 3.2e-88 322.0
Cmetu04g1845 . 1 264 SNARE and Associated Proteins AT3G45280 65.2 5.4e-88 321.2
Cmetu04g1845 . 1 261 SNARE and Associated Proteins AT3G61450 68.6 3.4e-95 345.1
Cmetu11g0284 . 1 263 SNARE and Associated Proteins AT3G61450 61.4 3.8e-86 315.1
Cmetu03g1342 . 65 308 SNARE and Associated Proteins AT1G51740 73.2 5.7e-92 334.3
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0012598 0 2 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 2 2 0 29