Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cmetu04g1845 ATGAGCGTGATCGACCTTTTGACCAGAGTAGATGCGATCTGCCAGAAGTACGACAAATATGACATAGAAAAGCAGAGAGATCTCAATGTCTCCGGTGACGATGCCTTCGCTCGACTATACGCCACTGTTGAAGCTGACATTGAAGCCGCTCTACAGAAAGCGGAGGATGCTTCTAAAGAGAAGAATAGGGCATCCGTGGTGGCGTTGAATGCGGAGATTCGTCGTACGAAGGCTCGATTACTGGAGGAGGTCCCCAAGTTGCAGAGGTTGGCTGTAAAGAGGGTTAAAGGGCTATCAACTGAAGATCTTACCACTCGAAATGATTTGGTGCTTGCATTGCCGGATAGGATTCAAGCTATACCAGACGGAACTGTGACTACCACGAAGAATAACGGGGGCTGGACATCCTCAGCTTCACGGACTGAAATCAAATTTGACTCAGATGGGCGATTTGATGATGAGTACTTCCAACACACTGAGGAGTCCAGTCAGTTCAGGCAGGAGTATGAAATGAGGAAAATGAAGCAGGATCAAGGATTGGACATGATATCAGAAGGGTTGGATACTCTGAAGAATATGGCACATGATATGAATGAGGAAATAGACAGACAAGTTCCTTTGATGGACGAGATTGACACTAAGGTGGACAAGGCTGCATCTGACCTTAAGAACACCAACGTTAGATTAAAGGACACAGTTAACCAGCTAAGGTCCAGCAGAAATTTCTGTATTGATATCATTTTGTTGTGTATAATCTTGGGGATTGCTGCCTATCTATACAATGTGTTGAAGAAGTGA 798 44.99 MSVIDLLTRVDAICQKYDKYDIEKQRDLNVSGDDAFARLYATVEADIEAALQKAEDASKEKNRASVVALNAEIRRTKARLLEEVPKLQRLAVKRVKGLSTEDLTTRNDLVLALPDRIQAIPDGTVTTTKNNGGWTSSASRTEIKFDSDGRFDDEYFQHTEESSQFRQEYEMRKMKQDQGLDMISEGLDTLKNMAHDMNEEIDRQVPLMDEIDTKVDKAASDLKNTNVRLKDTVNQLRSSRNFCIDIILLCIILGIAAYLYNVLKK 265
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
4 4140249 4144058 + PI0026207.1 Cmetu04g1845 354289

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cmetu04g1845 265 ProSitePatterns Syntaxin / epimorphin family signature. 176 215 IPR006012 GO:0005484|GO:0006886|GO:0016020
Cmetu04g1845 265 Gene3D - 170 231 - -
Cmetu04g1845 265 PANTHER SYNTAXIN 44 252 IPR045242 -
Cmetu04g1845 265 SUPERFAMILY SNARE fusion complex 163 230 - -
Cmetu04g1845 265 SMART tSNARE_6 165 232 IPR000727 -
Cmetu04g1845 265 CDD SNARE_Qc 175 230 - -
Cmetu04g1845 265 Coils Coil 219 239 - -
Cmetu04g1845 265 Coils Coil 40 60 - -
Cmetu04g1845 265 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 170 232 IPR000727 -
Cmetu04g1845 265 FunFam Putative syntaxin-71-like 170 231 - -
Cmetu04g1845 265 Pfam SNARE domain 207 256 IPR000727 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cmetu04g1845 K08506 - - csv:101215905 503.442
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cmetu11g0284 Cmetu-Chr11:5864568 Cmetu04g1845 Cmetu-Chr4:4140249 2.20E-95 wgd
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi8g590 . . . . Bpe04g01584 . . . . Cmo14g00195 . . . . . . . . . . . . . . . . . . . . . . . Cone13ag1275 Cone19ag1262 . . . Cme04g02538 . . . . . . . . Sed04g1347 . . . Cma14g00203 . Car14g00181 Cpe03g00174 . Bhi11g02112 Tan08g1893 Cmetu04g1845 Lac10g3026 Hepe05g0250 . . Cla10g01938 Cam10g2004 Cec10g2046 Cco10g2031 Clacu10g2011 Cmu10g2760 Cre10g2153 Lsi03g02035 Csa03g03265 Chy04g02075 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cmetu03g1681 . 8 336 SNARE and Associated Proteins AT3G24350 62.8 3.0e-102 369.0
Cmetu08g0109 . 1 309 SNARE and Associated Proteins AT1G08560 69.4 6.4e-101 364.4
Cmetu08g1065 . 1 303 SNARE and Associated Proteins AT2G18260 54.7 1.9e-84 309.7
Cmetu04g2079 . 22 280 SNARE and Associated Proteins AT3G11820 80.7 1.8e-114 409.5
Cmetu08g1428 . 24 283 SNARE and Associated Proteins AT3G11820 71.2 5.0e-101 364.8
Cmetu12g0532 . 1 202 SNARE and Associated Proteins AT3G11820 69.8 3.0e-77 285.8
Cmetu04g2542 . 36 291 SNARE and Associated Proteins AT3G11820 52.1 7.6e-65 244.6
Cmetu04g2079 . 31 280 SNARE and Associated Proteins AT3G52400 68.8 3.3e-90 328.9
Cmetu08g1428 . 1 283 SNARE and Associated Proteins AT3G52400 59.5 1.9e-85 313.2
Cmetu12g0532 . 1 202 SNARE and Associated Proteins AT3G52400 65.3 1.8e-67 253.4
Cmetu04g2079 . 1 280 SNARE and Associated Proteins AT4G03330 57.9 1.0e-82 303.9
Cmetu12g0532 . 1 220 SNARE and Associated Proteins AT4G03330 72.3 1.7e-82 303.1
Cmetu08g1428 . 1 299 SNARE and Associated Proteins AT4G03330 52.2 8.3e-77 284.3
Cmetu04g2542 . 48 291 SNARE and Associated Proteins AT4G03330 54.3 1.1e-63 240.7
Cmetu12g0532 . 1 224 SNARE and Associated Proteins AT1G61290 80.4 9.7e-94 340.5
Cmetu04g2079 . 1 280 SNARE and Associated Proteins AT1G61290 62.8 1.0e-90 330.5
Cmetu08g1428 . 1 299 SNARE and Associated Proteins AT1G61290 56.2 3.5e-83 305.4
Cmetu04g2542 . 49 291 SNARE and Associated Proteins AT1G61290 50.4 6.0e-59 224.9
Cmetu12g0532 . 1 224 SNARE and Associated Proteins AT1G11250 79.9 3.9e-95 345.1
Cmetu04g2079 . 1 280 SNARE and Associated Proteins AT1G11250 62.5 9.0e-92 334.0
Cmetu08g1428 . 1 294 SNARE and Associated Proteins AT1G11250 56.8 2.8e-85 312.4
Cmetu04g2542 . 17 314 SNARE and Associated Proteins AT3G03800 71.1 1.0e-106 383.6
Cmetu11g1082 . 1 270 SNARE and Associated Proteins AT3G03800 57.4 1.2e-80 297.0
Cmetu12g0532 . 1 203 SNARE and Associated Proteins AT3G03800 55.7 1.6e-56 216.9
Cmetu04g2542 . 17 209 SNARE and Associated Proteins AT5G08080 75.5 7.0e-73 270.8
Cmetu11g1082 . 2 169 SNARE and Associated Proteins AT5G08080 63.1 2.9e-50 195.7
Cmetu06g0720 . 1 249 SNARE and Associated Proteins AT5G16830 54.7 1.3e-65 246.9
Cmetu06g0720 . 1 249 SNARE and Associated Proteins AT5G46860 59.5 3.6e-68 255.4
Cmetu06g0720 . 1 249 SNARE and Associated Proteins AT4G17730 54.8 2.0e-63 239.6
Cmetu06g0720 . 61 249 SNARE and Associated Proteins AT1G32270 58.9 9.7e-50 194.5
Cmetu10g1254 . 1 336 SNARE and Associated Proteins AT5G05760 65.6 1.7e-110 396.4
Cmetu03g1681 . 8 336 SNARE and Associated Proteins AT3G24350 62.8 3.0e-102 369.0
Cmetu05g1168 . 1 327 SNARE and Associated Proteins AT5G26980 75.5 7.9e-126 447.2
Cmetu01g0565 . 1 318 SNARE and Associated Proteins AT5G26980 66.8 5.5e-103 371.3
Cmetu05g1168 . 1 329 SNARE and Associated Proteins AT4G02195 64.0 5.9e-105 377.9
Cmetu01g0565 . 1 318 SNARE and Associated Proteins AT4G02195 67.1 7.7e-105 377.5
Cmetu05g1168 . 1 328 SNARE and Associated Proteins AT3G05710 75.4 4.6e-129 458.0
Cmetu01g0565 . 1 318 SNARE and Associated Proteins AT3G05710 64.3 4.9e-99 358.2
Cmetu01g0482 . 1 233 SNARE and Associated Proteins AT1G16240 73.0 1.7e-90 329.3
Cmetu06g0075 . 58 286 SNARE and Associated Proteins AT1G16240 68.6 2.5e-81 298.9
Cmetu01g0482 . 1 233 SNARE and Associated Proteins AT1G79590 73.0 9.7e-90 327.0
Cmetu06g0075 . 58 286 SNARE and Associated Proteins AT1G79590 67.7 8.2e-81 297.4
Cmetu11g2412 . 56 246 SNARE and Associated Proteins AT1G28490 71.7 1.1e-66 250.0
Cmetu04g1845 . 1 264 SNARE and Associated Proteins AT3G09740 78.9 2.4e-112 402.1
Cmetu11g0284 . 1 263 SNARE and Associated Proteins AT3G09740 67.2 2.5e-93 339.0
Cmetu11g0284 . 1 263 SNARE and Associated Proteins AT3G45280 64.9 3.2e-88 322.0
Cmetu04g1845 . 1 264 SNARE and Associated Proteins AT3G45280 65.2 5.4e-88 321.2
Cmetu04g1845 . 1 261 SNARE and Associated Proteins AT3G61450 68.6 3.4e-95 345.1
Cmetu11g0284 . 1 263 SNARE and Associated Proteins AT3G61450 61.4 3.8e-86 315.1
Cmetu03g1342 . 65 308 SNARE and Associated Proteins AT1G51740 73.2 5.7e-92 334.3
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002038 1 2 1 1 1 2 3 2 2 2 2 2 3 3 2 3 2 2 3 2 3 2 2 2 2 2 3 2 2 2 63