Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cmetu11g2412 ATGCCATCGGCTCAAGATCCGTTCTATGTTGTAAAAGACGAGATTCAAGAATCTATCGATAAACTGCAATCAAGCTTTCATCAATGGGAAAGGATATCTTCTGATTCCGGAGAGAGAGTACAACAAACAAAAGAGTTGCTCACTTCCTGTGAAAGCATCGAGTGGCAGGTGGACGAATTGGACAAAGCTATTGCTGTGGCAGCTAGAGATCCATCTTGGTATGGCATTGATGATGCAGAACTTGAAAAACGAAGGAGATGGACGAGTACAGCTAGGACACAGGTTGGAAATGTTAAGAAAGTAGTAGGAGCCGGCAAGGAGCAAACAGGAACTGCTAGTGCAAGTGGGATGCGTCGAGAATTGATGAGACTACCTAATGCACATGAAACAGATAGATCAAACTTATATACAGCCCACCAAGCAAATGATGACTTCATCACATCCGAATCAGACAGACAGCTACTTCTAATAAAGCAGCAGGACGAGGAGTTGGATGAGTTGAGTGCAAGCGTGGAGAGAATTGGAGGTGTTGGGCTTACAATTCACGAAGAGCTCCTTGCACAGGATAAAATTATCGACGACCTAGGAATGGAAATGGACAGTACATCAAATCGTCTTGATTTTGTACAGAAAAAAGTAGCTGTGGTCATGAAGAAGGCCAGCGCCAAGGGGCAGATAATGATGATATTGTTTTTGGTGGCTTTGTTCATCATCCTTTTTGTGTTGGTCTTCCTCACCTAG 741 43.59 MPSAQDPFYVVKDEIQESIDKLQSSFHQWERISSDSGERVQQTKELLTSCESIEWQVDELDKAIAVAARDPSWYGIDDAELEKRRRWTSTARTQVGNVKKVVGAGKEQTGTASASGMRRELMRLPNAHETDRSNLYTAHQANDDFITSESDRQLLLIKQQDEELDELSASVERIGGVGLTIHEELLAQDKIIDDLGMEMDSTSNRLDFVQKKVAVVMKKASAKGQIMMILFLVALFIILFVLVFLT 246
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
11 388039 392125 - PI0026259.1 Cmetu11g2412 371144

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cmetu11g2412 246 CDD SNARE_Qc 157 214 - -
Cmetu11g2412 246 CDD SNARE_NTD_AtSYP61-like 5 102 - -
Cmetu11g2412 246 Gene3D - 161 225 - -
Cmetu11g2412 246 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 154 216 IPR000727 -
Cmetu11g2412 246 Gene3D - 2 104 - -
Cmetu11g2412 246 Pfam SNARE domain 191 242 IPR000727 -
Cmetu11g2412 246 SUPERFAMILY t-snare proteins 5 100 IPR010989 GO:0016020|GO:0016192
Cmetu11g2412 246 PANTHER GOLGI SNARE BET1-RELATED 136 242 - -
Cmetu11g2412 246 Pfam Syntaxin 6, N-terminal 6 99 IPR015260 GO:0016020|GO:0048193
Cmetu11g2412 246 FunFam Syntaxin 10 3 105 - -
Cmetu11g2412 246 FunFam syntaxin-61 isoform X1 157 218 - -
Cmetu11g2412 246 SMART tSNARE_6 149 216 IPR000727 -
Cmetu11g2412 246 ProSitePatterns Syntaxin / epimorphin family signature. 160 199 IPR006012 GO:0005484|GO:0006886|GO:0016020
Cmetu11g2412 246 SUPERFAMILY SNARE fusion complex 153 216 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cmetu11g2412 K08500 - - csv:101212527 422.165
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cmetu03g1681 . 8 336 SNARE and Associated Proteins AT3G24350 62.8 3.0e-102 369.0
Cmetu08g0109 . 1 309 SNARE and Associated Proteins AT1G08560 69.4 6.4e-101 364.4
Cmetu08g1065 . 1 303 SNARE and Associated Proteins AT2G18260 54.7 1.9e-84 309.7
Cmetu04g2079 . 22 280 SNARE and Associated Proteins AT3G11820 80.7 1.8e-114 409.5
Cmetu08g1428 . 24 283 SNARE and Associated Proteins AT3G11820 71.2 5.0e-101 364.8
Cmetu12g0532 . 1 202 SNARE and Associated Proteins AT3G11820 69.8 3.0e-77 285.8
Cmetu04g2542 . 36 291 SNARE and Associated Proteins AT3G11820 52.1 7.6e-65 244.6
Cmetu04g2079 . 31 280 SNARE and Associated Proteins AT3G52400 68.8 3.3e-90 328.9
Cmetu08g1428 . 1 283 SNARE and Associated Proteins AT3G52400 59.5 1.9e-85 313.2
Cmetu12g0532 . 1 202 SNARE and Associated Proteins AT3G52400 65.3 1.8e-67 253.4
Cmetu04g2079 . 1 280 SNARE and Associated Proteins AT4G03330 57.9 1.0e-82 303.9
Cmetu12g0532 . 1 220 SNARE and Associated Proteins AT4G03330 72.3 1.7e-82 303.1
Cmetu08g1428 . 1 299 SNARE and Associated Proteins AT4G03330 52.2 8.3e-77 284.3
Cmetu04g2542 . 48 291 SNARE and Associated Proteins AT4G03330 54.3 1.1e-63 240.7
Cmetu12g0532 . 1 224 SNARE and Associated Proteins AT1G61290 80.4 9.7e-94 340.5
Cmetu04g2079 . 1 280 SNARE and Associated Proteins AT1G61290 62.8 1.0e-90 330.5
Cmetu08g1428 . 1 299 SNARE and Associated Proteins AT1G61290 56.2 3.5e-83 305.4
Cmetu04g2542 . 49 291 SNARE and Associated Proteins AT1G61290 50.4 6.0e-59 224.9
Cmetu12g0532 . 1 224 SNARE and Associated Proteins AT1G11250 79.9 3.9e-95 345.1
Cmetu04g2079 . 1 280 SNARE and Associated Proteins AT1G11250 62.5 9.0e-92 334.0
Cmetu08g1428 . 1 294 SNARE and Associated Proteins AT1G11250 56.8 2.8e-85 312.4
Cmetu04g2542 . 17 314 SNARE and Associated Proteins AT3G03800 71.1 1.0e-106 383.6
Cmetu11g1082 . 1 270 SNARE and Associated Proteins AT3G03800 57.4 1.2e-80 297.0
Cmetu12g0532 . 1 203 SNARE and Associated Proteins AT3G03800 55.7 1.6e-56 216.9
Cmetu04g2542 . 17 209 SNARE and Associated Proteins AT5G08080 75.5 7.0e-73 270.8
Cmetu11g1082 . 2 169 SNARE and Associated Proteins AT5G08080 63.1 2.9e-50 195.7
Cmetu06g0720 . 1 249 SNARE and Associated Proteins AT5G16830 54.7 1.3e-65 246.9
Cmetu06g0720 . 1 249 SNARE and Associated Proteins AT5G46860 59.5 3.6e-68 255.4
Cmetu06g0720 . 1 249 SNARE and Associated Proteins AT4G17730 54.8 2.0e-63 239.6
Cmetu06g0720 . 61 249 SNARE and Associated Proteins AT1G32270 58.9 9.7e-50 194.5
Cmetu10g1254 . 1 336 SNARE and Associated Proteins AT5G05760 65.6 1.7e-110 396.4
Cmetu03g1681 . 8 336 SNARE and Associated Proteins AT3G24350 62.8 3.0e-102 369.0
Cmetu05g1168 . 1 327 SNARE and Associated Proteins AT5G26980 75.5 7.9e-126 447.2
Cmetu01g0565 . 1 318 SNARE and Associated Proteins AT5G26980 66.8 5.5e-103 371.3
Cmetu05g1168 . 1 329 SNARE and Associated Proteins AT4G02195 64.0 5.9e-105 377.9
Cmetu01g0565 . 1 318 SNARE and Associated Proteins AT4G02195 67.1 7.7e-105 377.5
Cmetu05g1168 . 1 328 SNARE and Associated Proteins AT3G05710 75.4 4.6e-129 458.0
Cmetu01g0565 . 1 318 SNARE and Associated Proteins AT3G05710 64.3 4.9e-99 358.2
Cmetu01g0482 . 1 233 SNARE and Associated Proteins AT1G16240 73.0 1.7e-90 329.3
Cmetu06g0075 . 58 286 SNARE and Associated Proteins AT1G16240 68.6 2.5e-81 298.9
Cmetu01g0482 . 1 233 SNARE and Associated Proteins AT1G79590 73.0 9.7e-90 327.0
Cmetu06g0075 . 58 286 SNARE and Associated Proteins AT1G79590 67.7 8.2e-81 297.4
Cmetu11g2412 . 56 246 SNARE and Associated Proteins AT1G28490 71.7 1.1e-66 250.0
Cmetu04g1845 . 1 264 SNARE and Associated Proteins AT3G09740 78.9 2.4e-112 402.1
Cmetu11g0284 . 1 263 SNARE and Associated Proteins AT3G09740 67.2 2.5e-93 339.0
Cmetu11g0284 . 1 263 SNARE and Associated Proteins AT3G45280 64.9 3.2e-88 322.0
Cmetu04g1845 . 1 264 SNARE and Associated Proteins AT3G45280 65.2 5.4e-88 321.2
Cmetu04g1845 . 1 261 SNARE and Associated Proteins AT3G61450 68.6 3.4e-95 345.1
Cmetu11g0284 . 1 263 SNARE and Associated Proteins AT3G61450 61.4 3.8e-86 315.1
Cmetu03g1342 . 65 308 SNARE and Associated Proteins AT1G51740 73.2 5.7e-92 334.3
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003549 2 1 2 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 5 4 0 44