Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cmetu12g0532 ATGGAGGCCGATGTTGCTCTAGTTCTCAAGCGAGTCAAATTGATCAAAGGAAAGCTTGAAGCTCTTGAGCGTTCTAATGCCGCTCATCGTAGCCTCCCCGGTTGCGGCCCTGGTTCTTCTGCTGACCGAACTCGAACCTCTGTTGTCAGCGGCTTGGGAAAGAAGCTCAAAGATGTTATGGATGATTTTCAAGGCCTTAGAGCTCGAATGAATGCCGAGTATAAAGAAACCGTCGAGCGAAGGTACTTCACAGTGACAGGGCAGAAAGCAAATGAAGAAACAATAGAGAATTTGATATCAAGTGGGGAAAGTGAGAGCTTCCTACAGAAGGCAATTCAAGAACAGGGTAGAGGTCAAATAATGGACACAATTTCAGAGATTCAAGAACGACATGACGCTGTGAAGGAAATAGAGAAGAATTTGATAGAGCTGCATCAGATTTTCTTGGACATGGCAGCTTTAGTTGAAGCTCAAGGCCACCAACTGAACGACATCGAAAGCCATGTTGCGCATGCTAACTCATTCGTTAGAAGAGGAACAGAGCAACTCCAAGAAGCCAGAGAGTATCAAAAGAGCTCAAGGAAATGGACTTGTTATGCCATACTCTTGGGAGCTGTTCTTATTATCATTCTTCTCTTCCCATTATTAACTACAATTTTACCTCATTTGTTGTAG 675 43.85 MEADVALVLKRVKLIKGKLEALERSNAAHRSLPGCGPGSSADRTRTSVVSGLGKKLKDVMDDFQGLRARMNAEYKETVERRYFTVTGQKANEETIENLISSGESESFLQKAIQEQGRGQIMDTISEIQERHDAVKEIEKNLIELHQIFLDMAALVEAQGHQLNDIESHVAHANSFVRRGTEQLQEAREYQKSSRKWTCYAILLGAVLIIILLFPLLTTILPHLL 224
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
12 4675166 4677288 + PI0016098.1 Cmetu12g0532 371868

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cmetu12g0532 224 Gene3D - 112 217 - -
Cmetu12g0532 224 ProSitePatterns Syntaxin / epimorphin family signature. 130 169 IPR006012 GO:0005484|GO:0006886|GO:0016020
Cmetu12g0532 224 SMART tSNARE_6 119 186 IPR000727 -
Cmetu12g0532 224 Gene3D - 1 81 - -
Cmetu12g0532 224 Pfam Syntaxin 1 159 IPR006011 GO:0016020
Cmetu12g0532 224 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 124 186 IPR000727 -
Cmetu12g0532 224 CDD SynN 1 111 IPR006011 GO:0016020
Cmetu12g0532 224 FunFam Syntaxin 132 117 217 - -
Cmetu12g0532 224 CDD SNARE_syntaxin1-like 123 185 - -
Cmetu12g0532 224 Pfam SNARE domain 161 212 IPR000727 -
Cmetu12g0532 224 SUPERFAMILY t-snare proteins 3 179 IPR010989 GO:0016020|GO:0016192
Cmetu12g0532 224 PANTHER SYNTAXIN 2 210 IPR045242 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cmetu12g0532 K08486 - - csv:101217140 387.497
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cmetu08g1428 Cmetu-Chr8:17904672 Cmetu12g0532 Cmetu-Chr12:4675166 1.10E-68 dispersed
Cmetu11g1082 Cmetu-Chr11:23200301 Cmetu12g0532 Cmetu-Chr12:4675166 2.50E-48 dispersed
Cmetu12g0532 Cmetu-Chr12:4675166 Cmetu04g2079 Cmetu-Chr4:5745094 1.80E-73 transposed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cmetu03g1681 . 8 336 SNARE and Associated Proteins AT3G24350 62.8 3.0e-102 369.0
Cmetu08g0109 . 1 309 SNARE and Associated Proteins AT1G08560 69.4 6.4e-101 364.4
Cmetu08g1065 . 1 303 SNARE and Associated Proteins AT2G18260 54.7 1.9e-84 309.7
Cmetu04g2079 . 22 280 SNARE and Associated Proteins AT3G11820 80.7 1.8e-114 409.5
Cmetu08g1428 . 24 283 SNARE and Associated Proteins AT3G11820 71.2 5.0e-101 364.8
Cmetu12g0532 . 1 202 SNARE and Associated Proteins AT3G11820 69.8 3.0e-77 285.8
Cmetu04g2542 . 36 291 SNARE and Associated Proteins AT3G11820 52.1 7.6e-65 244.6
Cmetu04g2079 . 31 280 SNARE and Associated Proteins AT3G52400 68.8 3.3e-90 328.9
Cmetu08g1428 . 1 283 SNARE and Associated Proteins AT3G52400 59.5 1.9e-85 313.2
Cmetu12g0532 . 1 202 SNARE and Associated Proteins AT3G52400 65.3 1.8e-67 253.4
Cmetu04g2079 . 1 280 SNARE and Associated Proteins AT4G03330 57.9 1.0e-82 303.9
Cmetu12g0532 . 1 220 SNARE and Associated Proteins AT4G03330 72.3 1.7e-82 303.1
Cmetu08g1428 . 1 299 SNARE and Associated Proteins AT4G03330 52.2 8.3e-77 284.3
Cmetu04g2542 . 48 291 SNARE and Associated Proteins AT4G03330 54.3 1.1e-63 240.7
Cmetu12g0532 . 1 224 SNARE and Associated Proteins AT1G61290 80.4 9.7e-94 340.5
Cmetu04g2079 . 1 280 SNARE and Associated Proteins AT1G61290 62.8 1.0e-90 330.5
Cmetu08g1428 . 1 299 SNARE and Associated Proteins AT1G61290 56.2 3.5e-83 305.4
Cmetu04g2542 . 49 291 SNARE and Associated Proteins AT1G61290 50.4 6.0e-59 224.9
Cmetu12g0532 . 1 224 SNARE and Associated Proteins AT1G11250 79.9 3.9e-95 345.1
Cmetu04g2079 . 1 280 SNARE and Associated Proteins AT1G11250 62.5 9.0e-92 334.0
Cmetu08g1428 . 1 294 SNARE and Associated Proteins AT1G11250 56.8 2.8e-85 312.4
Cmetu04g2542 . 17 314 SNARE and Associated Proteins AT3G03800 71.1 1.0e-106 383.6
Cmetu11g1082 . 1 270 SNARE and Associated Proteins AT3G03800 57.4 1.2e-80 297.0
Cmetu12g0532 . 1 203 SNARE and Associated Proteins AT3G03800 55.7 1.6e-56 216.9
Cmetu04g2542 . 17 209 SNARE and Associated Proteins AT5G08080 75.5 7.0e-73 270.8
Cmetu11g1082 . 2 169 SNARE and Associated Proteins AT5G08080 63.1 2.9e-50 195.7
Cmetu06g0720 . 1 249 SNARE and Associated Proteins AT5G16830 54.7 1.3e-65 246.9
Cmetu06g0720 . 1 249 SNARE and Associated Proteins AT5G46860 59.5 3.6e-68 255.4
Cmetu06g0720 . 1 249 SNARE and Associated Proteins AT4G17730 54.8 2.0e-63 239.6
Cmetu06g0720 . 61 249 SNARE and Associated Proteins AT1G32270 58.9 9.7e-50 194.5
Cmetu10g1254 . 1 336 SNARE and Associated Proteins AT5G05760 65.6 1.7e-110 396.4
Cmetu03g1681 . 8 336 SNARE and Associated Proteins AT3G24350 62.8 3.0e-102 369.0
Cmetu05g1168 . 1 327 SNARE and Associated Proteins AT5G26980 75.5 7.9e-126 447.2
Cmetu01g0565 . 1 318 SNARE and Associated Proteins AT5G26980 66.8 5.5e-103 371.3
Cmetu05g1168 . 1 329 SNARE and Associated Proteins AT4G02195 64.0 5.9e-105 377.9
Cmetu01g0565 . 1 318 SNARE and Associated Proteins AT4G02195 67.1 7.7e-105 377.5
Cmetu05g1168 . 1 328 SNARE and Associated Proteins AT3G05710 75.4 4.6e-129 458.0
Cmetu01g0565 . 1 318 SNARE and Associated Proteins AT3G05710 64.3 4.9e-99 358.2
Cmetu01g0482 . 1 233 SNARE and Associated Proteins AT1G16240 73.0 1.7e-90 329.3
Cmetu06g0075 . 58 286 SNARE and Associated Proteins AT1G16240 68.6 2.5e-81 298.9
Cmetu01g0482 . 1 233 SNARE and Associated Proteins AT1G79590 73.0 9.7e-90 327.0
Cmetu06g0075 . 58 286 SNARE and Associated Proteins AT1G79590 67.7 8.2e-81 297.4
Cmetu11g2412 . 56 246 SNARE and Associated Proteins AT1G28490 71.7 1.1e-66 250.0
Cmetu04g1845 . 1 264 SNARE and Associated Proteins AT3G09740 78.9 2.4e-112 402.1
Cmetu11g0284 . 1 263 SNARE and Associated Proteins AT3G09740 67.2 2.5e-93 339.0
Cmetu11g0284 . 1 263 SNARE and Associated Proteins AT3G45280 64.9 3.2e-88 322.0
Cmetu04g1845 . 1 264 SNARE and Associated Proteins AT3G45280 65.2 5.4e-88 321.2
Cmetu04g1845 . 1 261 SNARE and Associated Proteins AT3G61450 68.6 3.4e-95 345.1
Cmetu11g0284 . 1 263 SNARE and Associated Proteins AT3G61450 61.4 3.8e-86 315.1
Cmetu03g1342 . 65 308 SNARE and Associated Proteins AT1G51740 73.2 5.7e-92 334.3
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0005716 1 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 2 1 1 37