Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Cmo05g01102 ATGGCGTCGAGGAATCGGACTTTGATTTTTAGGAAATACAGGGACGCGTTGAGGAGTGTGAGGGTTCCTACCGGCTCTTCGCCTGCTTCTGCATCTCCATCGACTAGCTCTGGCACTGGTGGACCGGTGATTGAATTGGTTAGCTCGTCGTTGTTGCATCCGAATCGGTCGTACGCTCCCTTAAGTACTGAGGATCCGGGTAATTCAAGTAAGGGTGCTCTTACTGTGGGTCTACCTCCGGCTTGGGTGGATGTATCCGAAGAAATAGCTGCAAATGTGCAGCGAGCACGAGTAAAGATGATGGAGTTAGCTAAAGCTCATGCAAAAGCTTTAATGCCTTCATTTGGAGATGATAAAGAAGATCAACGGTTAATTGAATCTCTCACGCAAGACATAACTAACTTAATCAAGAAATCGGAGAAGGGGCTCAAGAGATTTTCCGTAGCTGGACCTTCGGAAGATTCCAATATCAGAAAAAATGTTCAGCGATCTCTTGCCACTGACCTTCAGAACCTCTCCATGGAGCTTCGCAAGAAACAATCAACTTATTTAAAGCGCCTACGGCAGCAAAAAGAGGAAGGTCAAGATGGGATTGACATAGAGATGAATCTAAATGGAAACAGGTCGAGAATGGAGGAGGACGATGATTTAGAAGACATGGTATTTAACGAGCATCAGATGGCTAAGGTGCGAAAGACTGAAGCATTCACTGCAGAAAGAGAGAGAGAGATCCAACAAGTAGTAGAATCCGTGAACGAGCTCGCTCAGATCATGAAGGATCTATCAGTACTAGTCATAGACCAGGTTAGAGAAGGTGCCCATCCTACGACCTGCGGAGAGAACACAGAAACAAGGGGGGATGGTAATGTGCGCGTCCGTGCTCATTATCATGTGCTTCGTCATGTTGGTTCTCTTAATCCTTAA 924 46.1 MASRNRTLIFRKYRDALRSVRVPTGSSPASASPSTSSGTGGPVIELVSSSLLHPNRSYAPLSTEDPGNSSKGALTVGLPPAWVDVSEEIAANVQRARVKMMELAKAHAKALMPSFGDDKEDQRLIESLTQDITNLIKKSEKGLKRFSVAGPSEDSNIRKNVQRSLATDLQNLSMELRKKQSTYLKRLRQQKEEGQDGIDIEMNLNGNRSRMEEDDDLEDMVFNEHQMAKVRKTEAFTAEREREIQQVVESVNELAQIMKDLSVLVIDQVREGAHPTTCGENTETRGDGNVRVRAHYHVLRHVGSLNP 307
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
5 8787283 8791425 - CmoCh05G011020.1 Cmo05g01102 383237

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Cmo05g01102 307 MobiDBLite consensus disorder prediction 21 44 - -
Cmo05g01102 307 Gene3D - 79 280 - -
Cmo05g01102 307 SUPERFAMILY t-snare proteins 77 268 IPR010989 GO:0016020|GO:0016192
Cmo05g01102 307 SMART SynN_4 73 188 IPR006011 GO:0016020
Cmo05g01102 307 MobiDBLite consensus disorder prediction 23 44 - -
Cmo05g01102 307 PANTHER SYNTAXIN-43-LIKE 1 268 - -
Cmo05g01102 307 PANTHER SYNTAXIN 1 268 IPR045242 -
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cmo05g01102 K08489 STX16; syntaxin 16 - csv:101207998 464.151
       

WGDs- Genes


Select Gene_1 Gene_2 Event_name
Cmo05g01102 Cmo12g01056 CST
       

Dupl-types


Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cmo05g01102 Cmo-Chr5:8787283 Cmo17g01031 Cmo-Chr17:8784234 1.41E-100 dispersed
Cmo12g01056 Cmo-Chr12:9759088 Cmo05g01102 Cmo-Chr5:8787283 3.98E-171 wgd
       

Deco-Alignment


Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi14g133 . . . . . . . . . . Cma05g01087 Cma12g01045 Car05g00958 Car12g01004 . Cpe07g00878 Cpe11g00890 . . . . . . . Cla02g01497 Cam02g1577 Cec02g1601 Cco02g1642 Clacu02g1560 Cmu02g1513 Cre02g1836 Cone10ag0804 Cone3ag0826 . . . Csa02g00478 . Cme05g01576 . . Bda01g01638 . . . . Bma05g00265 Sed11g0396 Cmo05g01102 Cmo12g01056 . . . . . . Bhi06g01461 Tan08g0631 Cmetu05g1168 . Hepe08g2281 . . . . . . . . . Lsi11g00612 . Chy05g01060 .
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cmo12g00252 . 443 752 SNARE and Associated Proteins AT3G24350 63.3 1.4e-91 334.0
Cmo05g00672 . 51 348 SNARE and Associated Proteins AT3G24350 62.0 8.8e-86 314.7
Cmo07g01220 CST 1 308 SNARE and Associated Proteins AT1G08560 68.4 1.7e-101 366.7
Cmo03g00262 CST 1 312 SNARE and Associated Proteins AT1G08560 67.7 3.6e-96 349.0
Cmo03g00768 . 387 687 SNARE and Associated Proteins AT2G18260 53.1 2.9e-82 302.8
Cmo14g00363 . 1344 1604 SNARE and Associated Proteins AT3G11820 81.6 2.5e-116 416.0
Cmo06g00530 . 19 279 SNARE and Associated Proteins AT3G11820 77.4 9.0e-111 397.5
Cmo07g00850 . 21 280 SNARE and Associated Proteins AT3G11820 69.6 1.6e-99 360.1
Cmo18g00322 . 31 281 SNARE and Associated Proteins AT3G11820 67.3 2.6e-94 342.8
Cmo13g00695 . 31 281 SNARE and Associated Proteins AT3G11820 66.1 2.1e-91 333.2
Cmo14g01110 . 44 302 SNARE and Associated Proteins AT3G11820 52.1 6.5e-69 258.5
Cmo14g00363 . 1326 1604 SNARE and Associated Proteins AT3G52400 64.3 7.0e-93 338.2
Cmo06g00530 . 1 279 SNARE and Associated Proteins AT3G52400 61.5 6.8e-88 321.6
Cmo07g00850 . 1 280 SNARE and Associated Proteins AT3G52400 58.8 4.1e-85 312.4
Cmo13g00695 . 1 281 SNARE and Associated Proteins AT3G52400 56.5 2.1e-81 300.1
Cmo18g00322 . 1 281 SNARE and Associated Proteins AT3G52400 55.3 1.5e-79 293.9
Cmo14g01110 . 54 302 SNARE and Associated Proteins AT3G52400 50.2 4.6e-60 229.2
Cmo18g00322 . 1 295 SNARE and Associated Proteins AT4G03330 69.8 1.0e-106 384.0
Cmo13g00695 . 1 299 SNARE and Associated Proteins AT4G03330 67.5 1.3e-106 383.6
Cmo14g00363 . 1326 1604 SNARE and Associated Proteins AT4G03330 57.5 2.2e-82 303.1
Cmo06g00530 . 1 284 SNARE and Associated Proteins AT4G03330 56.6 1.1e-81 300.8
Cmo07g00850 . 1 278 SNARE and Associated Proteins AT4G03330 52.8 3.5e-75 279.3
Cmo14g01110 . 54 302 SNARE and Associated Proteins AT4G03330 55.4 1.8e-68 256.9
Cmo18g00322 . 1 303 SNARE and Associated Proteins AT1G61290 78.5 6.0e-128 454.5
Cmo13g00695 . 1 303 SNARE and Associated Proteins AT1G61290 77.2 7.3e-126 447.6
Cmo06g00530 . 1 294 SNARE and Associated Proteins AT1G61290 59.8 2.6e-91 332.8
Cmo14g00363 . 1326 1604 SNARE and Associated Proteins AT1G61290 61.9 5.0e-90 328.6
Cmo07g00850 . 1 292 SNARE and Associated Proteins AT1G61290 54.9 1.4e-81 300.4
Cmo14g01110 . 52 302 SNARE and Associated Proteins AT1G61290 51.0 4.7e-64 242.3
Cmo18g00322 . 1 303 SNARE and Associated Proteins AT1G11250 78.2 3.2e-126 448.7
Cmo13g00695 . 1 303 SNARE and Associated Proteins AT1G11250 76.6 4.4e-123 438.3
Cmo06g00530 . 1 294 SNARE and Associated Proteins AT1G11250 60.2 7.3e-94 341.3
Cmo14g00363 . 1326 1604 SNARE and Associated Proteins AT1G11250 62.7 2.8e-93 339.3
Cmo07g00850 . 1 292 SNARE and Associated Proteins AT1G11250 54.5 7.5e-83 304.7
Cmo14g01110 . 37 302 SNARE and Associated Proteins AT1G11250 51.1 8.9e-68 254.6
Cmo14g01110 . 21 325 SNARE and Associated Proteins AT3G03800 73.1 1.7e-114 409.8
Cmo20g00615 CST 1 305 SNARE and Associated Proteins AT3G03800 55.7 5.0e-82 302.0
Cmo14g01110 . 21 220 SNARE and Associated Proteins AT5G08080 77.0 2.5e-78 289.3
Cmo20g00615 CST 1 204 SNARE and Associated Proteins AT5G08080 58.8 1.6e-53 206.8
Cmo16g01226 CST 1 256 SNARE and Associated Proteins AT5G16830 59.9 1.1e-75 280.8
Cmo06g00644 CST 1 256 SNARE and Associated Proteins AT5G16830 59.9 1.1e-75 280.8
Cmo06g00644 CST 1 256 SNARE and Associated Proteins AT5G46860 66.8 2.8e-81 299.3
Cmo16g01226 CST 1 256 SNARE and Associated Proteins AT5G46860 66.8 1.4e-80 297.0
Cmo06g00644 CST 1 256 SNARE and Associated Proteins AT4G17730 61.3 3.3e-74 275.8
Cmo16g01226 CST 1 256 SNARE and Associated Proteins AT4G17730 61.7 7.3e-74 274.6
Cmo16g01226 CST 65 256 SNARE and Associated Proteins AT1G32270 60.9 5.5e-53 205.7
Cmo06g00644 CST 65 256 SNARE and Associated Proteins AT1G32270 60.4 1.3e-51 201.1
Cmo04g01191 CST 25 358 SNARE and Associated Proteins AT5G05760 66.3 6.0e-113 404.8
Cmo04g00161 CST 1 334 SNARE and Associated Proteins AT5G05760 61.5 7.4e-103 371.3
Cmo12g00252 . 443 752 SNARE and Associated Proteins AT3G24350 63.3 1.4e-91 334.0
Cmo05g00672 . 51 348 SNARE and Associated Proteins AT3G24350 62.0 8.8e-86 314.7
Cmo12g01056 CST 1 327 SNARE and Associated Proteins AT5G26980 75.2 1.0e-125 447.2
Cmo17g01031 . 1 320 SNARE and Associated Proteins AT5G26980 66.5 4.2e-103 372.1
Cmo05g01102 CST 1 268 SNARE and Associated Proteins AT5G26980 74.6 3.4e-97 352.4
Cmo17g01031 . 1 320 SNARE and Associated Proteins AT4G02195 65.0 2.7e-102 369.4
Cmo12g01056 CST 1 329 SNARE and Associated Proteins AT4G02195 62.8 3.5e-102 369.0
Cmo05g01102 CST 1 268 SNARE and Associated Proteins AT4G02195 62.5 3.8e-80 295.8
Cmo12g01056 CST 1 328 SNARE and Associated Proteins AT3G05710 73.9 1.6e-126 449.9
Cmo17g01031 . 1 320 SNARE and Associated Proteins AT3G05710 64.3 2.6e-100 362.8
Cmo05g01102 CST 1 268 SNARE and Associated Proteins AT3G05710 72.9 1.9e-98 356.7
Cmo01g01156 CCT,CST 1 233 SNARE and Associated Proteins AT1G16240 73.4 3.4e-91 332.0
Cmo09g00974 CCT,CST 3 212 SNARE and Associated Proteins AT1G16240 68.9 5.3e-76 281.6
Cmo16g00959 CCT 38 259 SNARE and Associated Proteins AT1G16240 57.1 1.6e-64 243.4
Cmo01g01156 CCT,CST 1 233 SNARE and Associated Proteins AT1G79590 73.0 1.9e-90 329.7
Cmo09g00974 CCT,CST 2 212 SNARE and Associated Proteins AT1G79590 70.0 4.6e-76 282.0
Cmo16g00959 CCT 37 259 SNARE and Associated Proteins AT1G79590 57.5 7.4e-66 248.1
Cmo01g00984 . 5 199 SNARE and Associated Proteins AT1G28490 69.7 1.9e-66 249.6
Cmo17g00043 . 127 314 SNARE and Associated Proteins AT1G28490 53.2 8.5e-38 154.5
Cmo01g01094 . 1 263 SNARE and Associated Proteins AT3G09740 77.4 1.4e-109 393.3
Cmo14g00195 . 1 261 SNARE and Associated Proteins AT3G09740 76.8 1.2e-108 390.2
Cmo02g00885 CST 1 264 SNARE and Associated Proteins AT3G09740 67.5 6.5e-94 341.3
Cmo01g01094 . 1 263 SNARE and Associated Proteins AT3G45280 63.5 1.7e-86 316.6
Cmo02g00885 CST 1 264 SNARE and Associated Proteins AT3G45280 63.8 6.5e-86 314.7
Cmo14g00195 . 1 261 SNARE and Associated Proteins AT3G45280 62.9 3.2e-85 312.4
Cmo14g00195 . 1 261 SNARE and Associated Proteins AT3G61450 69.3 1.2e-95 347.1
Cmo01g01094 . 1 261 SNARE and Associated Proteins AT3G61450 68.9 7.5e-95 344.4
Cmo02g00885 CST 1 261 SNARE and Associated Proteins AT3G61450 60.5 3.0e-83 305.8
Cmo04g03046 CST 65 309 SNARE and Associated Proteins AT1G51740 74.4 6.0e-94 341.3
Cmo15g00129 CST 65 284 SNARE and Associated Proteins AT1G51740 61.5 5.9e-65 245.0
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003497 3 1 2 2 1 1 2 1 1 1 1 1 2 1 1 2 1 2 2 1 1 1 1 1 1 1 1 4 4 2 46
       

Transcriptome


Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Cmo05g01102 Cmo_Chr05 FPKM 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0