Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Cmo15g00963	ATGGAACGACACGGTGTGGGGCGTGAGGAAAAGCATGACCAGGACGACATGTCGCCAAGGACTCGCTTGACGCTTACTAGACATGAATTGGCAATTGGTTGGCGCTGGTCTGTTGTAACCTTCAGGTATAAGCGAAATGACGACGCTTGCGTGGGGAAAAGATCGTTGCCCGCTTTGGTCAATGCAAACAGGAAGGAATACGAAGGGGAAGTGGTGGAGAGCAAGATGAGTGGCGGTGGCAGTAGCACTTCTCGAAGCACTAGGGATTTGATCTGCCATGCCGGTGCTGGTGCTGCTGCAGGTGCTATAGCAGCCACGTTCGTCTGCCCTTTAGATGTGATCAAGACGAGGCTGCAAGTGCATGGTCTTCCATCTGGTCAAAGAGGAGGTAGTATTATTGTCACTAGCCTACAAGACATAATGCGTTCTGAAGGTTTCAGGGGACTGTACCGTGGCCTTTCACCAACAATATTAGCACTTCTTCCAAACTGGGCTGTCTACTTCACAGTTTATGAGCATCTAAAAGGCATACTTCATTCAGATGGGGACGATGGTCATCAACTCTCGTTCGGCGCAAATATGGTTGCTGCTGCTGGGGCTGGGGGATCTACTGCCACTGCAACAAATCCTTTATGGGTTGTTAAGACCAGACTTCAAACACAGGGAATGAGGCCTGGTGTGGTTCCTTACACAGGCATGGTTTCAGCATTTACCAGGATCATACAGGAAGAAGGAATTCGCGGGCTTTACAGTGGTATCCTCCCTTCATTGGTTGGGATAAGTCATGTTGCCATTCAATTTCCAGCATACGAAAAGCTCAAATCATATATGGCAAAAAGAGATAACACAACCATTGAAAAGCTAACTCCGGGACATTTAGCTATTGCCTCGTCATTGTCGAAAGTTATGGCCTCGGTAACGACTTACCCACATGAGGTAGTTCGTTCCAGGATGCAAGAGCAAGGCCAAGCCAGAAATGTTGCTCCTCAATACTCCGGCGTACTGGACTGTATCAAAAAGGTTTTTCAAAAGGAAGGTCTTCCCGGTTTTTACAGGGGTTGTGCGACAAATCTGTTACGAACAACTCCATCCGCCGTAATAACTTTCACCAGCTATGAGATGATACATAGGTTTCTACTGCAATTTATACCTCAAGGCGAGGAGAAACCTTCCCCCCATCTGAATTCGAATAGCAATAGCCATGTGAAGCCCCAAAAGGCGAACCGAGACGACTCGAAGGAAGAGAGTGATTCCGGCTTACAACAATCACAATCCCAACCAAGTAAGCAAACTAGAATTCCTCTGGGGAACAAAGAACAGTTAGCATCTAGACACTGA	1338	47.53	MERHGVGREEKHDQDDMSPRTRLTLTRHELAIGWRWSVVTFRYKRNDDACVGKRSLPALVNANRKEYEGEVVESKMSGGGSSTSRSTRDLICHAGAGAAAGAIAATFVCPLDVIKTRLQVHGLPSGQRGGSIIVTSLQDIMRSEGFRGLYRGLSPTILALLPNWAVYFTVYEHLKGILHSDGDDGHQLSFGANMVAAAGAGGSTATATNPLWVVKTRLQTQGMRPGVVPYTGMVSAFTRIIQEEGIRGLYSGILPSLVGISHVAIQFPAYEKLKSYMAKRDNTTIEKLTPGHLAIASSLSKVMASVTTYPHEVVRSRMQEQGQARNVAPQYSGVLDCIKKVFQKEGLPGFYRGCATNLLRTTPSAVITFTSYEMIHRFLLQFIPQGEEKPSPHLNSNSNSHVKPQKANRDDSKEESDSGLQQSQSQPSKQTRIPLGNKEQLASRH	445

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
15	5025679	5033570	+	CmoCh15G009630.1	Cmo15g00963	398471

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Cmo15g00963	445	ProSiteProfiles	Solute carrier (Solcar) repeat profile.	288	378	IPR018108	-
Cmo15g00963	445	MobiDBLite	consensus disorder prediction	389	445	-	-
Cmo15g00963	445	PRINTS	Mitochondrial carrier protein signature	93	106	IPR002067	GO:0055085
Cmo15g00963	445	PRINTS	Mitochondrial carrier protein signature	106	120	IPR002067	GO:0055085
Cmo15g00963	445	PRINTS	Mitochondrial carrier protein signature	297	319	IPR002067	GO:0055085
Cmo15g00963	445	PRINTS	Mitochondrial carrier protein signature	203	221	IPR002067	GO:0055085
Cmo15g00963	445	PRINTS	Mitochondrial carrier protein signature	250	268	IPR002067	GO:0055085
Cmo15g00963	445	PRINTS	Mitochondrial carrier protein signature	152	172	IPR002067	GO:0055085
Cmo15g00963	445	MobiDBLite	consensus disorder prediction	1	20	-	-
Cmo15g00963	445	Gene3D	Mitochondrial carrier domain	65	183	IPR023395	-
Cmo15g00963	445	Gene3D	Mitochondrial carrier domain	184	383	IPR023395	-
Cmo15g00963	445	ProSiteProfiles	Solute carrier (Solcar) repeat profile.	88	177	IPR018108	-
Cmo15g00963	445	PANTHER	NICOTINAMIDE ADENINE DINUCLEOTIDE TRANSPORTER 1, CHLOROPLASTIC	83	388	-	-
Cmo15g00963	445	SUPERFAMILY	Mitochondrial carrier	88	374	IPR023395	-
Cmo15g00963	445	ProSiteProfiles	Solute carrier (Solcar) repeat profile.	188	276	IPR018108	-
Cmo15g00963	445	PANTHER	MITOCHONDRIAL NICOTINAMIDE ADENINE DINUCLEOTIDE TRANSPORTER 1-RELATED-RELATED	83	388	IPR044712	GO:0006862\|GO:0055085
Cmo15g00963	445	MobiDBLite	consensus disorder prediction	418	437	-	-
Cmo15g00963	445	Pfam	Mitochondrial carrier protein	290	380	IPR018108	-
Cmo15g00963	445	Pfam	Mitochondrial carrier protein	93	179	IPR018108	-
Cmo15g00963	445	Pfam	Mitochondrial carrier protein	187	280	IPR018108	-

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Cmo15g00963	K15115	SLC25A32, MFT; solute carrier family 25 (mitochondrial folate transporter), member 32	-	csv:101216902	617.461

Dupl-types

Select	Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
	Cmo15g00963	Cmo-Chr15:5025679	Cmo17g01033	Cmo-Chr17:8792819	5.28E-92	dispersed
	Cmo15g00963	Cmo-Chr15:5025679	Cmo08g00433	Cmo-Chr8:2683606	7.04E-135	transposed

Deco-Alignment

Select	Vvi1	Blo1	Blo2	Bda1	Bda2	Bpe1	Bpe2	Bma1	Bma2	Cmo1	Cmo2	Cma1	Cma2	Car1	Car2	Sed1	Cpe1	Cpe2	Bhi1	Tan1	Cmetu1	Lac1	Hepe1	Mch1	Lcy1	Cla1	Cam1	Cec1	Cco1	Clacu1	Cmu1	Cre1	Cone1	Cone2	Cone3	Cone4	Lsi1	Csa1	Chy1	Cme1	Blo3	Blo4	Bda3	Bda4	Bpe3	Bpe4	Bma3	Bma4	Sed2	Cmo3	Cmo4	Cma3	Cma4	Car3	Car4	Cpe3	Cpe4	Bhi2	Tan2	Cmetu2	Lac2	Hepe2	Mch2	Lcy2	Cla2	Cam2	Cec2	Cco2	Clacu2	Cmu2	Cre2	Lsi2	Csa2	Chy2	Cme2
	Vvi1g346	.	.	Bda01g02021	Bda11g00163	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Cone6ag0430	Cone9ag0448	.	Csa05g02065	.	.	.	.	.	Bda11g00163	.	Bpe02g02209	.	.	.	.	Cmo15g00963	.	Cma15g00924	.	Car15g00866	Cpe13g00396	.	Bhi12g00835	.	.	.	Hepe02g2690	.	Lcy10g1474	Cla01g00571	Cam01g0597	Cec01g0586	Cco01g0612	Clacu01g0590	Cmu01g0562	Cre09g1945	Lsi09g00619	.	Chy09g00893	Cme09g01426

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Cmo01g00616	.	157	488	Chloroplast and Mitochondria Gene Families	AT2G28800	73.0	1.3e-128	457.2
Cmo05g00063	.	71	410	Chloroplast and Mitochondria Gene Families	AT2G28800	57.1	7.5e-100	361.7
Cmo12g00034	.	71	423	Chloroplast and Mitochondria Gene Families	AT2G28800	53.5	2.5e-95	346.7
Cmo11g01491	.	6	258	Chloroplast and Mitochondria Gene Families	AT1G15820	82.0	3.0e-120	428.7
Cmo15g00609	.	3	255	Chloroplast and Mitochondria Gene Families	AT1G15820	82.4	3.9e-120	428.3
Cmo11g01832	.	98	346	Chloroplast and Mitochondria Gene Families	AT3G27690	88.0	5.1e-132	468.0
Cmo19g00879	.	952	1168	Chloroplast and Mitochondria Gene Families	AT3G27690	93.1	3.0e-124	442.2
Cmo01g00276	.	1	265	Chloroplast and Mitochondria Gene Families	AT3G27690	77.2	7.7e-120	427.6
Cmo13g00573	.	2	265	Chloroplast and Mitochondria Gene Families	AT3G27690	76.7	1.7e-119	426.4
Cmo03g01376	CST	2	265	Chloroplast and Mitochondria Gene Families	AT3G27690	76.7	2.9e-119	425.6
Cmo20g00287	CST	2	267	Chloroplast and Mitochondria Gene Families	AT3G27690	76.6	3.8e-119	425.2
Cmo07g00130	.	2	265	Chloroplast and Mitochondria Gene Families	AT3G27690	76.7	3.8e-119	425.2
Cmo07g00129	CST	2	265	Chloroplast and Mitochondria Gene Families	AT3G27690	76.7	5.0e-119	424.9
Cmo02g00036	CST	3	269	Chloroplast and Mitochondria Gene Families	AT3G27690	76.2	6.5e-119	424.5
Cmo14g00978	.	1	265	Chloroplast and Mitochondria Gene Families	AT3G27690	76.5	6.1e-117	417.9
Cmo04g00986	.	5	269	Chloroplast and Mitochondria Gene Families	AT3G27690	66.9	1.1e-97	354.0
Cmo16g00863	.	5	264	Chloroplast and Mitochondria Gene Families	AT3G27690	66.4	4.1e-97	352.1
Cmo09g00013	.	113	329	Chloroplast and Mitochondria Gene Families	AT3G27690	51.6	3.6e-53	206.1
Cmo01g00935	.	73	276	Chloroplast and Mitochondria Gene Families	AT3G27690	52.2	2.4e-52	203.4
Cmo09g01192	.	222	425	Chloroplast and Mitochondria Gene Families	AT3G27690	50.7	9.9e-51	198.0
Cmo04g01932	.	3	262	Chloroplast and Mitochondria Gene Families	AT3G61470	81.7	4.0e-125	444.9
Cmo18g00628	.	27	240	Chloroplast and Mitochondria Gene Families	AT3G61470	77.8	5.8e-108	387.9
Cmo11g00756	.	61	266	Chloroplast and Mitochondria Gene Families	AT3G61470	65.5	5.3e-85	311.6
Cmo10g00213	CST	22	250	Chloroplast and Mitochondria Gene Families	AT3G61470	50.6	1.2e-63	240.7
Cmo01g00834	.	288	511	Chloroplast and Mitochondria Gene Families	AT3G61470	50.6	1.4e-61	233.8
Cmo15g00458	CST	1	198	Chloroplast and Mitochondria Gene Families	AT3G54890	81.6	5.0e-89	324.7
Cmo04g02705	CST	1	198	Chloroplast and Mitochondria Gene Families	AT3G54890	80.4	4.3e-88	321.6
Cmo07g01093	.	1	286	Chloroplast and Mitochondria Gene Families	AT3G08940	82.0	4.5e-133	471.5
Cmo03g00375	.	54	210	Chloroplast and Mitochondria Gene Families	AT3G08940	77.2	7.6e-64	241.5
Cmo09g00013	.	3	336	Chloroplast and Mitochondria Gene Families	AT1G76570	71.3	2.8e-139	492.3
Cmo19g00879	.	951	1159	Chloroplast and Mitochondria Gene Families	AT1G76570	50.2	6.8e-53	205.3
Cmo11g01832	.	148	346	Chloroplast and Mitochondria Gene Families	AT1G76570	50.2	1.6e-49	194.1
Cmo10g00908	.	1	273	Chloroplast and Mitochondria Gene Families	AT1G61520	85.7	1.6e-135	479.6
Cmo11g00916	.	1	261	Chloroplast and Mitochondria Gene Families	AT1G61520	82.5	3.9e-126	448.4
Cmo11g01832	.	102	346	Chloroplast and Mitochondria Gene Families	AT2G05070	89.4	6.0e-132	467.6
Cmo19g00879	.	952	1168	Chloroplast and Mitochondria Gene Families	AT2G05070	92.2	1.9e-122	436.0
Cmo13g00573	.	7	265	Chloroplast and Mitochondria Gene Families	AT2G05070	78.8	3.1e-120	428.7
Cmo03g01376	CST	5	265	Chloroplast and Mitochondria Gene Families	AT2G05070	78.6	9.0e-120	427.2
Cmo20g00287	CST	7	267	Chloroplast and Mitochondria Gene Families	AT2G05070	78.9	1.5e-119	426.4
Cmo07g00130	.	5	265	Chloroplast and Mitochondria Gene Families	AT2G05070	78.2	4.4e-119	424.9
Cmo07g00129	CST	5	265	Chloroplast and Mitochondria Gene Families	AT2G05070	77.8	5.8e-119	424.5
Cmo02g00036	CST	8	269	Chloroplast and Mitochondria Gene Families	AT2G05070	77.8	2.9e-118	422.2
Cmo01g00276	.	8	265	Chloroplast and Mitochondria Gene Families	AT2G05070	78.8	3.8e-118	421.8
Cmo14g00978	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G05070	77.2	2.1e-116	416.0
Cmo04g00986	.	8	269	Chloroplast and Mitochondria Gene Families	AT2G05070	67.5	3.7e-97	352.1
Cmo16g00863	.	8	264	Chloroplast and Mitochondria Gene Families	AT2G05070	67.7	6.2e-97	351.3
Cmo01g00935	.	73	276	Chloroplast and Mitochondria Gene Families	AT2G05070	52.6	1.6e-52	203.8
Cmo09g00013	.	113	329	Chloroplast and Mitochondria Gene Families	AT2G05070	51.2	1.0e-51	201.1
Cmo11g01832	.	102	338	Chloroplast and Mitochondria Gene Families	AT2G05100	89.5	1.7e-125	446.4
Cmo19g00879	.	952	1140	Chloroplast and Mitochondria Gene Families	AT2G05100	91.5	7.0e-103	371.3
Cmo13g00573	.	7	237	Chloroplast and Mitochondria Gene Families	AT2G05100	76.7	1.7e-101	366.7
Cmo03g01376	CST	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	76.1	2.9e-101	365.9
Cmo07g00129	CST	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	75.9	1.5e-100	363.6
Cmo01g00276	.	8	237	Chloroplast and Mitochondria Gene Families	AT2G05100	77.6	3.2e-100	362.5
Cmo20g00287	CST	7	239	Chloroplast and Mitochondria Gene Families	AT2G05100	76.5	4.2e-100	362.1
Cmo07g00130	.	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	75.9	4.2e-100	362.1
Cmo02g00036	CST	8	241	Chloroplast and Mitochondria Gene Families	AT2G05100	76.1	9.4e-100	360.9
Cmo14g00978	.	1	237	Chloroplast and Mitochondria Gene Families	AT2G05100	75.4	2.3e-98	356.3
Cmo04g00986	.	8	241	Chloroplast and Mitochondria Gene Families	AT2G05100	67.5	2.3e-82	303.1
Cmo16g00863	.	8	236	Chloroplast and Mitochondria Gene Families	AT2G05100	67.2	5.2e-82	302.0
Cmo01g00935	.	73	260	Chloroplast and Mitochondria Gene Families	AT2G05100	50.8	1.6e-43	174.1
Cmo07g01093	.	4	168	Chloroplast and Mitochondria Gene Families	AT2G40100	71.0	9.8e-65	243.8
Cmo03g00375	.	53	212	Chloroplast and Mitochondria Gene Families	AT2G40100	71.3	1.3e-61	233.4
Cmo20g00287	CST	1	267	Chloroplast and Mitochondria Gene Families	AT1G29930	88.1	1.5e-135	479.6
Cmo13g00573	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29930	87.6	7.6e-135	477.2
Cmo02g00036	CST	3	269	Chloroplast and Mitochondria Gene Families	AT1G29930	88.8	1.7e-134	476.1
Cmo03g01376	CST	1	265	Chloroplast and Mitochondria Gene Families	AT1G29930	87.3	8.4e-134	473.8
Cmo07g00129	CST	1	265	Chloroplast and Mitochondria Gene Families	AT1G29930	87.3	1.1e-133	473.4
Cmo07g00130	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29930	86.9	1.4e-133	473.0
Cmo01g00276	.	4	265	Chloroplast and Mitochondria Gene Families	AT1G29930	85.3	1.7e-126	449.5
Cmo14g00978	.	3	265	Chloroplast and Mitochondria Gene Families	AT1G29930	83.1	7.1e-125	444.1
Cmo19g00879	.	952	1168	Chloroplast and Mitochondria Gene Families	AT1G29930	86.7	3.7e-113	405.2
Cmo11g01832	.	104	346	Chloroplast and Mitochondria Gene Families	AT1G29930	77.7	6.9e-104	374.4
Cmo16g00863	.	46	264	Chloroplast and Mitochondria Gene Families	AT1G29930	74.5	1.9e-93	339.7
Cmo04g00986	.	51	269	Chloroplast and Mitochondria Gene Families	AT1G29930	74.5	1.9e-93	339.7
Cmo01g00935	.	73	276	Chloroplast and Mitochondria Gene Families	AT1G29930	51.4	1.2e-52	204.1
Cmo09g01192	.	222	425	Chloroplast and Mitochondria Gene Families	AT1G29930	50.5	1.1e-51	201.1
Cmo20g00287	CST	1	267	Chloroplast and Mitochondria Gene Families	AT1G29920	87.7	5.8e-135	477.6
Cmo03g01376	CST	1	265	Chloroplast and Mitochondria Gene Families	AT1G29920	87.6	1.7e-134	476.1
Cmo13g00573	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29920	87.3	2.9e-134	475.3
Cmo02g00036	CST	3	269	Chloroplast and Mitochondria Gene Families	AT1G29920	88.4	6.4e-134	474.2
Cmo07g00129	CST	1	265	Chloroplast and Mitochondria Gene Families	AT1G29920	86.9	4.2e-133	471.5
Cmo07g00130	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29920	86.5	5.5e-133	471.1
Cmo01g00276	.	4	265	Chloroplast and Mitochondria Gene Families	AT1G29920	85.3	2.2e-126	449.1
Cmo14g00978	.	3	265	Chloroplast and Mitochondria Gene Families	AT1G29920	83.1	9.3e-125	443.7
Cmo19g00879	.	952	1168	Chloroplast and Mitochondria Gene Families	AT1G29920	86.7	3.7e-113	405.2
Cmo11g01832	.	132	346	Chloroplast and Mitochondria Gene Families	AT1G29920	83.6	9.1e-104	374.0
Cmo16g00863	.	46	264	Chloroplast and Mitochondria Gene Families	AT1G29920	74.5	1.9e-93	339.7
Cmo04g00986	.	51	269	Chloroplast and Mitochondria Gene Families	AT1G29920	74.5	1.9e-93	339.7
Cmo01g00935	.	73	276	Chloroplast and Mitochondria Gene Families	AT1G29920	51.4	1.2e-52	204.1
Cmo09g01192	.	222	425	Chloroplast and Mitochondria Gene Families	AT1G29920	50.5	1.1e-51	201.1
Cmo20g00287	CST	1	267	Chloroplast and Mitochondria Gene Families	AT1G29910	87.7	5.8e-135	477.6
Cmo03g01376	CST	1	265	Chloroplast and Mitochondria Gene Families	AT1G29910	87.6	1.7e-134	476.1
Cmo13g00573	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29910	87.3	2.9e-134	475.3
Cmo02g00036	CST	3	269	Chloroplast and Mitochondria Gene Families	AT1G29910	88.4	6.4e-134	474.2
Cmo07g00129	CST	1	265	Chloroplast and Mitochondria Gene Families	AT1G29910	86.9	4.2e-133	471.5
Cmo07g00130	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29910	86.5	5.5e-133	471.1
Cmo01g00276	.	4	265	Chloroplast and Mitochondria Gene Families	AT1G29910	85.3	2.2e-126	449.1
Cmo14g00978	.	3	265	Chloroplast and Mitochondria Gene Families	AT1G29910	83.1	9.3e-125	443.7
Cmo19g00879	.	952	1168	Chloroplast and Mitochondria Gene Families	AT1G29910	86.7	3.7e-113	405.2
Cmo11g01832	.	132	346	Chloroplast and Mitochondria Gene Families	AT1G29910	83.6	9.1e-104	374.0
Cmo16g00863	.	46	264	Chloroplast and Mitochondria Gene Families	AT1G29910	74.5	1.9e-93	339.7
Cmo04g00986	.	51	269	Chloroplast and Mitochondria Gene Families	AT1G29910	74.5	1.9e-93	339.7
Cmo01g00935	.	73	276	Chloroplast and Mitochondria Gene Families	AT1G29910	51.4	1.2e-52	204.1
Cmo09g01192	.	222	425	Chloroplast and Mitochondria Gene Families	AT1G29910	50.5	1.1e-51	201.1
Cmo01g00935	.	11	291	Chloroplast and Mitochondria Gene Families	AT4G10340	82.6	1.3e-132	469.9
Cmo09g01192	.	163	440	Chloroplast and Mitochondria Gene Families	AT4G10340	83.2	1.3e-132	469.9
Cmo13g00573	.	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	53.4	3.0e-57	219.5
Cmo03g01376	CST	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.5	8.7e-57	218.0
Cmo07g00130	.	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.0	1.1e-56	217.6
Cmo07g00129	CST	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.0	1.1e-56	217.6
Cmo14g00978	.	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	1.1e-56	217.6
Cmo02g00036	CST	53	257	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	1.5e-56	217.2
Cmo20g00287	CST	51	255	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	1.5e-56	217.2
Cmo01g00276	.	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	53.6	3.3e-56	216.1
Cmo19g00879	.	952	1156	Chloroplast and Mitochondria Gene Families	AT4G10340	52.6	2.6e-53	206.5
Cmo16g00863	.	46	252	Chloroplast and Mitochondria Gene Families	AT4G10340	54.0	5.0e-52	202.2
Cmo04g00986	.	51	257	Chloroplast and Mitochondria Gene Families	AT4G10340	54.0	5.0e-52	202.2
Cmo11g01832	.	150	346	Chloroplast and Mitochondria Gene Families	AT4G10340	52.2	4.2e-51	199.1
Cmo20g00287	CST	1	267	Chloroplast and Mitochondria Gene Families	AT2G34420	88.1	9.9e-135	476.9
Cmo02g00036	CST	3	269	Chloroplast and Mitochondria Gene Families	AT2G34420	88.1	1.1e-133	473.4
Cmo03g01376	CST	1	265	Chloroplast and Mitochondria Gene Families	AT2G34420	87.3	5.4e-133	471.1
Cmo07g00129	CST	1	265	Chloroplast and Mitochondria Gene Families	AT2G34420	87.3	7.1e-133	470.7
Cmo07g00130	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34420	86.9	9.2e-133	470.3
Cmo13g00573	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34420	86.5	4.6e-132	468.0
Cmo01g00276	.	4	265	Chloroplast and Mitochondria Gene Families	AT2G34420	86.0	2.6e-127	452.2
Cmo14g00978	.	3	265	Chloroplast and Mitochondria Gene Families	AT2G34420	83.5	1.4e-125	446.4
Cmo19g00879	.	952	1168	Chloroplast and Mitochondria Gene Families	AT2G34420	86.7	1.1e-112	403.7
Cmo11g01832	.	104	346	Chloroplast and Mitochondria Gene Families	AT2G34420	76.1	3.1e-104	375.6
Cmo16g00863	.	46	264	Chloroplast and Mitochondria Gene Families	AT2G34420	75.0	2.5e-93	339.3
Cmo04g00986	.	51	269	Chloroplast and Mitochondria Gene Families	AT2G34420	75.0	2.5e-93	339.3
Cmo01g00935	.	73	276	Chloroplast and Mitochondria Gene Families	AT2G34420	50.5	6.1e-52	201.8
Cmo03g01376	CST	1	265	Chloroplast and Mitochondria Gene Families	AT2G34430	87.2	4.4e-135	478.0
Cmo20g00287	CST	1	267	Chloroplast and Mitochondria Gene Families	AT2G34430	87.3	9.9e-135	476.9
Cmo13g00573	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34430	86.8	1.3e-134	476.5
Cmo07g00129	CST	1	265	Chloroplast and Mitochondria Gene Families	AT2G34430	87.6	1.3e-134	476.5
Cmo07g00130	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34430	87.2	1.7e-134	476.1
Cmo02g00036	CST	3	269	Chloroplast and Mitochondria Gene Families	AT2G34430	88.1	1.9e-133	472.6
Cmo01g00276	.	4	265	Chloroplast and Mitochondria Gene Families	AT2G34430	86.0	3.6e-129	458.4
Cmo14g00978	.	3	265	Chloroplast and Mitochondria Gene Families	AT2G34430	83.8	2.0e-127	452.6
Cmo19g00879	.	952	1168	Chloroplast and Mitochondria Gene Families	AT2G34430	86.7	1.4e-112	403.3
Cmo11g01832	.	131	346	Chloroplast and Mitochondria Gene Families	AT2G34430	83.1	4.5e-103	371.7
Cmo04g00986	.	34	269	Chloroplast and Mitochondria Gene Families	AT2G34430	71.0	1.4e-93	340.1
Cmo16g00863	.	46	264	Chloroplast and Mitochondria Gene Families	AT2G34430	75.0	3.2e-93	339.0
Cmo07g01093	.	1	286	Chloroplast and Mitochondria Gene Families	AT5G01530	81.0	9.1e-134	473.8
Cmo03g00375	.	56	210	Chloroplast and Mitochondria Gene Families	AT5G01530	75.6	4.5e-64	242.3
Cmo04g00920	.	48	307	Chloroplast and Mitochondria Gene Families	AT5G40810	93.8	8.7e-144	506.9
Cmo16g00800	.	48	348	Chloroplast and Mitochondria Gene Families	AT5G40810	81.4	2.5e-138	488.8
Cmo04g00920	.	1	307	Chloroplast and Mitochondria Gene Families	AT3G27240	84.8	1.4e-148	523.1
Cmo16g00800	.	1	348	Chloroplast and Mitochondria Gene Families	AT3G27240	75.5	1.0e-143	506.9
Cmo20g00352	CST	5	327	Chloroplast and Mitochondria Gene Families	AT2G30160	74.4	4.0e-141	498.4
Cmo02g00725	CST	5	327	Chloroplast and Mitochondria Gene Families	AT2G30160	73.8	4.4e-140	495.0
Cmo03g00342	CST	3	303	Chloroplast and Mitochondria Gene Families	AT2G30160	65.4	5.6e-111	398.3
Cmo07g01125	CST	9	306	Chloroplast and Mitochondria Gene Families	AT2G30160	66.7	7.3e-111	397.9
Cmo20g00352	CST	1	327	Chloroplast and Mitochondria Gene Families	AT1G07030	74.4	9.6e-140	493.8
Cmo02g00725	CST	5	327	Chloroplast and Mitochondria Gene Families	AT1G07030	74.5	2.1e-139	492.7
Cmo03g00342	CST	3	303	Chloroplast and Mitochondria Gene Families	AT1G07030	68.6	5.1e-117	418.3
Cmo07g01125	CST	5	303	Chloroplast and Mitochondria Gene Families	AT1G07030	68.1	2.0e-113	406.4
Cmo08g00433	CST	1	305	Chloroplast and Mitochondria Gene Families	AT2G47490	75.4	2.2e-133	472.6
Cmo15g00963	.	86	387	Chloroplast and Mitochondria Gene Families	AT2G47490	63.0	3.8e-109	392.1
Cmo17g01033	CST	1	309	Chloroplast and Mitochondria Gene Families	AT2G47490	63.2	1.8e-103	373.2
Cmo15g00963	.	78	438	Chloroplast and Mitochondria Gene Families	AT1G25380	62.4	1.4e-123	440.3
Cmo08g00433	CST	11	296	Chloroplast and Mitochondria Gene Families	AT1G25380	64.4	5.0e-105	378.6
Cmo17g01033	CST	11	292	Chloroplast and Mitochondria Gene Families	AT1G25380	53.6	9.8e-77	284.6
Cmo13g00698	.	1018	1572	Chloroplast and Mitochondria Gene Families	AT4G21490	73.4	2.6e-241	832.0
Cmo02g00128	CCT	5	588	Chloroplast and Mitochondria Gene Families	AT4G21490	67.7	1.8e-234	809.3
Cmo19g00997	CCT	1	574	Chloroplast and Mitochondria Gene Families	AT4G21490	64.4	9.4e-223	770.4
Cmo17g00685	.	15	186	Chloroplast and Mitochondria Gene Families	AT1G17530	67.6	1.7e-61	233.0
Cmo08g00750	CCT	4	168	Chloroplast and Mitochondria Gene Families	AT1G17530	67.3	7.5e-57	217.6
Cmo10g01063	.	5	180	Chloroplast and Mitochondria Gene Families	AT1G17530	57.3	1.8e-50	196.4
Cmo11g01005	.	10	179	Chloroplast and Mitochondria Gene Families	AT1G17530	55.8	7.7e-46	181.0
Cmo10g01063	.	15	184	Chloroplast and Mitochondria Gene Families	AT3G04800	59.1	1.1e-50	197.2
Cmo11g01005	.	12	183	Chloroplast and Mitochondria Gene Families	AT3G04800	53.8	6.1e-46	181.4
Cmo17g00685	.	22	190	Chloroplast and Mitochondria Gene Families	AT3G04800	55.0	6.3e-43	171.4
Cmo08g00750	CCT	22	168	Chloroplast and Mitochondria Gene Families	AT3G04800	55.7	1.8e-37	153.3
Cmo17g00685	.	5	190	Chloroplast and Mitochondria Gene Families	AT1G72750	65.8	1.9e-63	239.6
Cmo08g00750	CCT	15	168	Chloroplast and Mitochondria Gene Families	AT1G72750	70.4	1.9e-55	213.0
Cmo10g01063	.	5	184	Chloroplast and Mitochondria Gene Families	AT1G72750	59.0	1.1e-52	203.8
Cmo11g01005	.	10	183	Chloroplast and Mitochondria Gene Families	AT1G72750	54.8	3.2e-47	185.7
Cmo18g01070	.	57	296	Chloroplast and Mitochondria Gene Families	AT1G26100	57.9	2.4e-71	266.2
Cmo04g02972	CST	34	259	Chloroplast and Mitochondria Gene Families	AT5G38630	70.5	3.8e-90	328.6
Cmo15g00206	CST	1	269	Chloroplast and Mitochondria Gene Families	AT5G38630	57.4	1.2e-80	297.0
Cmo19g00423	.	23	221	Chloroplast and Mitochondria Gene Families	AT4G25570	73.4	5.4e-83	305.1
Cmo02g01080	.	23	225	Chloroplast and Mitochondria Gene Families	AT4G25570	65.5	4.6e-74	275.4
Cmo04g02319	CCT,ECH	9	364	Chloroplast and Mitochondria Gene Families	AT5G14040	81.8	2.1e-170	595.9
Cmo15g00842	.	9	363	Chloroplast and Mitochondria Gene Families	AT5G14040	80.3	7.3e-168	587.4
Cmo11g01578	CCT,ECH	9	365	Chloroplast and Mitochondria Gene Families	AT5G14040	77.3	1.3e-161	566.6
Cmo10g00024	CST	39	347	Chloroplast and Mitochondria Gene Families	AT5G14040	84.6	5.4e-155	544.7
Cmo11g01793	.	11	298	Chloroplast and Mitochondria Gene Families	AT5G14040	52.4	2.0e-85	313.5
Cmo11g01578	CCT,ECH	11	365	Chloroplast and Mitochondria Gene Families	AT3G48850	73.2	1.4e-147	520.0
Cmo04g02319	CCT,ECH	8	363	Chloroplast and Mitochondria Gene Families	AT3G48850	71.0	7.6e-146	514.2
Cmo15g00842	.	8	358	Chloroplast and Mitochondria Gene Families	AT3G48850	71.1	1.1e-144	510.4
Cmo10g00024	CST	12	347	Chloroplast and Mitochondria Gene Families	AT3G48850	69.6	1.5e-141	500.0
Cmo11g01793	.	11	297	Chloroplast and Mitochondria Gene Families	AT3G48850	51.9	4.4e-85	312.4
Cmo11g01793	.	8	305	Chloroplast and Mitochondria Gene Families	AT2G17270	72.9	2.0e-126	449.5
Cmo11g01578	CCT,ECH	67	368	Chloroplast and Mitochondria Gene Families	AT2G17270	51.8	1.2e-86	317.4
Cmo15g00842	.	62	352	Chloroplast and Mitochondria Gene Families	AT2G17270	52.6	2.9e-85	312.8
Cmo04g02319	CCT,ECH	62	363	Chloroplast and Mitochondria Gene Families	AT2G17270	50.7	1.1e-84	310.8
Cmo10g00024	CST	51	348	Chloroplast and Mitochondria Gene Families	AT2G17270	50.2	4.1e-84	308.9
Cmo15g00236	CST	16	319	Chloroplast and Mitochondria Gene Families	AT5G15640	76.5	2.7e-131	465.7
Cmo04g02937	CST	16	319	Chloroplast and Mitochondria Gene Families	AT5G15640	75.9	2.3e-130	462.6
Cmo09g00356	.	12	344	Chloroplast and Mitochondria Gene Families	AT5G26200	66.7	1.0e-123	440.7
Cmo17g00679	.	1	342	Chloroplast and Mitochondria Gene Families	AT5G26200	59.3	4.7e-105	378.6
Cmo08g00754	.	1	336	Chloroplast and Mitochondria Gene Families	AT5G26200	57.3	6.4e-102	368.2
Cmo17g00679	.	1	346	Chloroplast and Mitochondria Gene Families	AT1G72820	76.8	2.1e-148	522.7
Cmo08g00754	.	1	340	Chloroplast and Mitochondria Gene Families	AT1G72820	74.2	1.4e-144	510.0
Cmo09g00356	.	1	345	Chloroplast and Mitochondria Gene Families	AT1G72820	69.6	2.1e-129	459.5
Cmo16g00108	CST	97	301	Chloroplast and Mitochondria Gene Families	AT5G52570	58.5	1.5e-57	220.3
Cmo15g01313	.	75	289	Chloroplast and Mitochondria Gene Families	AT5G52570	50.2	3.9e-50	195.7
Cmo18g01298	CST	1	219	Chloroplast and Mitochondria Gene Families	AT4G25700	64.0	3.0e-68	255.8
Cmo16g00108	CST	1	219	Chloroplast and Mitochondria Gene Families	AT4G25700	61.5	2.0e-67	253.1
Cmo15g01313	.	35	206	Chloroplast and Mitochondria Gene Families	AT4G25700	58.8	7.2e-54	208.0
Cmo16g00863	.	443	711	Chloroplast and Mitochondria Gene Families	AT5G54290	83.3	4.9e-121	431.8
Cmo11g00421	.	43	546	Chloroplast and Mitochondria Gene Families	AT2G18710	84.5	4.3e-241	831.2

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0002161	2	2	0	1	2	2	3	2	2	2	2	2	2	2	2	3	2	4	2	2	2	2	2	2	2	2	2	4	2	2	63

Transcriptome

Select	Gene	Chr	Type	da1	da2	da3	da4	da5	da6	da7	da8	da9	da10
	Cmo15g00963	Cmo_Chr15	FPKM	27.241058	30.212008	24.733784	26.971153	22.546793	21.831816	21.629013	29.52704	27.883142	24.910141