Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cone14ag0931 ATGAGCTTCCATGATATTCAAGCTCCTACCCACCACCAAAAACAATCACTTCTCTCCAATGCAAAGCAAGACCCATCTCAAGCTGTTGCTGCTGGAATTTTTCAAATAAACACAGCCGTTTCCACTTTCCAACGCCTCGTTAATACACTTGGCACTCCTAAAGATACACTTGAACTCCGCGAGAAACTACATAAGACAAGGTTACATATTGCACAGTTGGTAAGAGATACTTCTGCTAAATTAAAACAAGCTTGTGAAACAGACCGGTACACAGAAGATGGTGCAAACAAGAAGATTTCAGATGCTAAACTTGCCAAGGATTTACAGTCAGTTCTTAAAGAATTCCAGAAGGCGCAAAGGCTTGCAGTCGAGAGGGAAACAACATATGCTCCCTTGGTTCCTAAAGCGGTCCTTCCATCTAAGTGA 426 42.25 MSFHDIQAPTHHQKQSLLSNAKQDPSQAVAAGIFQINTAVSTFQRLVNTLGTPKDTLELREKLHKTRLHIAQLVRDTSAKLKQACETDRYTEDGANKKISDAKLAKDLQSVLKEFQKAQRLAVERETTYAPLVPKAVLPSK 141
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
14 7523639 7524813 + Conep14aG0095100.1 Cone14ag0931 452780

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cone14ag0931 141 Gene3D - 13 133 - -
Cone14ag0931 141 SUPERFAMILY t-snare proteins 23 133 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Cone14ag0931 141 SMART SynN_4 13 127 IPR006011 GO:0016020(InterPro)
Cone14ag0931 141 MobiDBLite consensus disorder prediction 1 22 - -
Cone14ag0931 141 FunFam Syntaxin-22 like 20 133 - -
Cone14ag0931 141 Pfam Syntaxin-like protein 30 129 IPR006011 GO:0016020(InterPro)
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cone14ag0931 - - - - 0.0
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cone14ag0931 Cone-Chr14:7523639 Cone15ag0918 Cone-Chr15:7248142 4.12E-73 dispersed
Cone14ag0930 Cone-Chr14:7509045 Cone14ag0931 Cone-Chr14:7523639 1.01E-75 tandem
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cone17ag1057 . 1 335 SNARE and Associated Proteins AT3G24350 61.3 2.1e-103 373.2
Cone20ag0645 . 1 323 SNARE and Associated Proteins AT3G24350 59.7 3.0e-94 342.8
Cone3ag0576 . 1 310 SNARE and Associated Proteins AT1G08560 59.8 1.1e-92 337.4
Cone10ag0552 . 1 311 SNARE and Associated Proteins AT1G08560 59.8 1.1e-92 337.4
Cone6ag1632 . 1 280 SNARE and Associated Proteins AT2G18260 54.6 3.7e-77 285.8
Cone19ag0431 . 19 278 SNARE and Associated Proteins AT3G11820 80.5 1.9e-113 406.4
Cone13ag0475 . 19 278 SNARE and Associated Proteins AT3G11820 78.5 3.8e-109 392.1
Cone1ag0131 . 31 281 SNARE and Associated Proteins AT3G11820 64.5 3.3e-89 325.9
Cone5ag1736 . 31 281 SNARE and Associated Proteins AT3G11820 62.9 4.8e-88 322.0
Cone13ag0457 . 32 286 SNARE and Associated Proteins AT3G11820 51.4 1.4e-66 250.8
Cone19ag0431 . 29 278 SNARE and Associated Proteins AT3G52400 69.2 2.9e-91 332.8
Cone13ag0475 . 29 278 SNARE and Associated Proteins AT3G52400 68.0 3.6e-89 325.9
Cone1ag0131 . 1 281 SNARE and Associated Proteins AT3G52400 54.0 6.4e-78 288.5
Cone5ag1736 . 1 281 SNARE and Associated Proteins AT3G52400 53.3 7.0e-77 285.0
Cone1ag0131 . 1 294 SNARE and Associated Proteins AT4G03330 69.0 8.4e-106 380.9
Cone5ag1736 . 1 294 SNARE and Associated Proteins AT4G03330 67.7 3.5e-104 375.6
Cone19ag0431 . 1 279 SNARE and Associated Proteins AT4G03330 58.7 1.2e-83 307.4
Cone13ag0475 . 1 279 SNARE and Associated Proteins AT4G03330 56.5 6.5e-82 301.6
Cone3ag1346 . 37 263 SNARE and Associated Proteins AT4G03330 50.2 6.1e-56 215.3
Cone1ag0131 . 1 293 SNARE and Associated Proteins AT1G61290 72.7 8.3e-114 407.5
Cone5ag1736 . 1 293 SNARE and Associated Proteins AT1G61290 72.7 3.2e-113 405.6
Cone19ag0431 . 1 279 SNARE and Associated Proteins AT1G61290 63.1 5.3e-92 335.1
Cone13ag0475 . 1 279 SNARE and Associated Proteins AT1G61290 63.5 1.2e-91 334.0
Cone1ag0131 . 1 293 SNARE and Associated Proteins AT1G11250 73.0 9.1e-113 404.1
Cone5ag1736 . 1 293 SNARE and Associated Proteins AT1G11250 71.3 1.9e-110 396.4
Cone19ag0431 . 1 279 SNARE and Associated Proteins AT1G11250 63.4 3.2e-94 342.4
Cone13ag0475 . 1 279 SNARE and Associated Proteins AT1G11250 63.1 4.7e-93 338.6
Cone13ag0457 . 1 303 SNARE and Associated Proteins AT3G03800 73.6 1.5e-115 413.3
Cone3ag0557 . 1 305 SNARE and Associated Proteins AT3G03800 69.2 2.8e-109 392.5
Cone10ag0529 . 1 305 SNARE and Associated Proteins AT3G03800 66.2 3.2e-105 379.0
Cone3ag1346 . 6 281 SNARE and Associated Proteins AT3G03800 62.3 4.4e-86 315.5
Cone13ag0457 . 1 204 SNARE and Associated Proteins AT5G08080 76.0 2.1e-77 286.2
Cone3ag0557 . 1 203 SNARE and Associated Proteins AT5G08080 71.9 2.8e-74 275.8
Cone10ag0529 . 1 203 SNARE and Associated Proteins AT5G08080 67.0 7.4e-67 251.1
Cone3ag1346 . 13 180 SNARE and Associated Proteins AT5G08080 67.9 1.2e-53 207.2
Cone15ag0918 . 1 256 SNARE and Associated Proteins AT5G16830 58.6 2.3e-73 273.1
Cone12ag0481 . 1 263 SNARE and Associated Proteins AT5G16830 58.0 5.0e-73 271.9
Cone14ag0930 . 1 252 SNARE and Associated Proteins AT5G16830 57.1 4.3e-72 268.9
Cone8ag0484 . 1 262 SNARE and Associated Proteins AT5G16830 56.1 8.0e-71 264.6
Cone14ag0931 . 1 137 SNARE and Associated Proteins AT5G16830 59.7 5.3e-38 155.6
Cone8ag0484 . 1 273 SNARE and Associated Proteins AT5G46860 62.6 2.7e-76 282.7
Cone12ag0481 . 1 274 SNARE and Associated Proteins AT5G46860 62.0 4.4e-74 275.4
Cone14ag0930 . 1 252 SNARE and Associated Proteins AT5G46860 53.2 7.2e-61 231.5
Cone15ag0918 . 1 256 SNARE and Associated Proteins AT5G46860 52.7 7.2e-61 231.5
Cone14ag0931 . 1 140 SNARE and Associated Proteins AT5G46860 66.4 6.2e-44 175.3
Cone8ag0484 . 1 256 SNARE and Associated Proteins AT4G17730 58.5 3.2e-69 259.2
Cone12ag0481 . 1 257 SNARE and Associated Proteins AT4G17730 58.0 3.5e-68 255.8
Cone14ag0930 . 1 244 SNARE and Associated Proteins AT4G17730 53.0 1.4e-61 233.8
Cone15ag0918 . 1 256 SNARE and Associated Proteins AT4G17730 51.9 2.4e-61 233.0
Cone14ag0931 . 1 140 SNARE and Associated Proteins AT4G17730 66.7 5.6e-42 168.7
Cone8ag0484 . 64 255 SNARE and Associated Proteins AT1G32270 60.4 6.0e-52 202.2
Cone12ag0481 . 65 256 SNARE and Associated Proteins AT1G32270 60.4 1.0e-51 201.4
Cone14ag0930 . 64 252 SNARE and Associated Proteins AT1G32270 57.7 1.1e-48 191.4
Cone15ag0918 . 64 255 SNARE and Associated Proteins AT1G32270 55.7 1.2e-47 188.0
Cone5ag0210 . 1 338 SNARE and Associated Proteins AT5G05760 68.8 1.2e-118 423.7
Cone17ag1057 . 1 335 SNARE and Associated Proteins AT3G24350 61.3 2.1e-103 373.2
Cone20ag0645 . 1 323 SNARE and Associated Proteins AT3G24350 59.7 3.0e-94 342.8
Cone3ag0826 . 1 328 SNARE and Associated Proteins AT5G26980 75.9 1.0e-125 447.2
Cone10ag0804 . 1 327 SNARE and Associated Proteins AT5G26980 75.8 8.5e-125 444.1
Cone17ag0442 . 1 321 SNARE and Associated Proteins AT5G26980 70.9 4.1e-111 398.7
Cone20ag0971 . 1 223 SNARE and Associated Proteins AT5G26980 53.1 3.1e-50 196.4
Cone17ag0442 . 1 319 SNARE and Associated Proteins AT4G02195 68.2 1.6e-110 396.7
Cone3ag0826 . 1 329 SNARE and Associated Proteins AT4G02195 66.5 5.2e-106 381.7
Cone10ag0804 . 1 328 SNARE and Associated Proteins AT4G02195 64.8 1.7e-104 376.7
Cone20ag0971 . 1 223 SNARE and Associated Proteins AT4G02195 50.4 1.3e-48 191.0
Cone3ag0826 . 1 327 SNARE and Associated Proteins AT3G05710 75.5 4.2e-127 451.8
Cone10ag0804 . 1 326 SNARE and Associated Proteins AT3G05710 75.5 4.7e-126 448.4
Cone17ag0442 . 1 319 SNARE and Associated Proteins AT3G05710 68.4 4.0e-109 392.1
Cone9ag0047 . 1 233 SNARE and Associated Proteins AT1G16240 74.2 4.9e-90 328.2
Cone6ag0041 . 1 232 SNARE and Associated Proteins AT1G16240 74.2 1.2e-88 323.6
Cone15ag1202 . 1 234 SNARE and Associated Proteins AT1G16240 63.2 2.0e-75 279.6
Cone14ag1185 . 1 189 SNARE and Associated Proteins AT1G16240 63.5 2.3e-63 239.6
Cone6ag0041 . 1 232 SNARE and Associated Proteins AT1G79590 75.1 1.3e-91 333.6
Cone9ag0047 . 1 233 SNARE and Associated Proteins AT1G79590 73.0 3.6e-89 325.5
Cone15ag1202 . 1 234 SNARE and Associated Proteins AT1G79590 63.7 2.7e-76 282.7
Cone14ag1185 . 1 189 SNARE and Associated Proteins AT1G79590 64.0 8.2e-65 244.6
Cone14ag1146 . 56 247 SNARE and Associated Proteins AT1G28490 71.4 2.5e-66 249.2
Cone15ag1164 . 13 213 SNARE and Associated Proteins AT1G28490 67.8 9.5e-66 247.3
Cone19ag1262 . 1 265 SNARE and Associated Proteins AT3G09740 81.2 1.7e-115 412.9
Cone13ag1275 . 1 265 SNARE and Associated Proteins AT3G09740 80.8 1.1e-114 410.2
Cone5ag1222 . 1 233 SNARE and Associated Proteins AT3G09740 53.1 3.3e-58 222.6
Cone13ag1275 . 1 265 SNARE and Associated Proteins AT3G45280 64.0 1.0e-86 317.4
Cone19ag1262 . 1 265 SNARE and Associated Proteins AT3G45280 63.3 1.7e-86 316.6
Cone5ag1222 . 1 230 SNARE and Associated Proteins AT3G45280 53.8 2.5e-61 233.0
Cone13ag1275 . 1 262 SNARE and Associated Proteins AT3G61450 66.8 2.9e-91 332.4
Cone19ag1262 . 1 262 SNARE and Associated Proteins AT3G61450 66.0 1.5e-90 330.1
Cone11ag1168 . 65 309 SNARE and Associated Proteins AT1G51740 76.4 1.7e-96 349.7
Cone18ag0421 . 65 309 SNARE and Associated Proteins AT1G51740 76.8 6.4e-96 347.8