Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cone3ag0826 ATGGCAACTAGGAATCGGACTTTGCTTTATAGGAAATATAGAGATGCGTTGAAGAGCGTAAGAGTTCCGGCGAGCTCTTCGTCAGCTTCCGCCGCATCTTCGTCGAGAAGTCAGGGAGCTGGTGGTCCGGTGATCGAAATGGTCAGCACTTCGCTTTTGAATCCGAATCGATCTTATACTCCACTCAGTACCGAGGATCCGGGTAATTCAAGTAAGGGTGCTCTTACTGTGGGCTTACCTCCTGCTTGGGTGGATTTATCTGAAGAAATAACATCGAATGTTCAACGGGCACGGTTAAAAATGGCTGAGTTAGCCAAAGCTCATTCAAAGGCTCTAATGCCTTCATTTGGGGATGGAAAAGAAGATCAACAATTGATTGAATCTCTTACACAAGAGATAACTAATCTGATAAGGAAATCGGAGAAGAGATTGCAGAGACTCTCTGCAGCTGGACCTTCTGAGGATTCAAATGTTAGAAAAAATGTGCAGCGGTCACTTGCAACTGACCTTCAAACACTTTCAATGGAGCTGCGCAAGAAACAATCGGTTTACTTGAAGAGGCTCAGGCAACAAAAGGAGGGTCAAGATGGGGTTGATTTAGAGATGAATCTAAATGGAAATAGATCTGGAACAGAGGATGATGAATTAGACAACATGGTATTCAGTGAGCATCAGATGGCCAAGCTTAAAAAGAGTGAAGCATTTACAGCAGAAAGGGAAAGAGAGATCCAACAGGTTGTAGAGTCTGTAAATGAGCTTGCCCAGATAATGAAGGATTTATCAGTACTCGTAATAGACCAGGGAACCATTGTTGATAGGATTGACCACAATATTCAAGCTGTTGCAACTACAGTTGATGACGGCCTTAAGCAGCTAGAAAAGGCTGAGAGAACACAGAAGAAAGGGGGAATGGTAATGTGTGCATCTGTGCTTATTGTTATGTGTTTGGTCATGTTGGTCCTCCTGATTCTTAAGGAGATATTCTTTTGA 990 43.13 MATRNRTLLYRKYRDALKSVRVPASSSSASAASSSRSQGAGGPVIEMVSTSLLNPNRSYTPLSTEDPGNSSKGALTVGLPPAWVDLSEEITSNVQRARLKMAELAKAHSKALMPSFGDGKEDQQLIESLTQEITNLIRKSEKRLQRLSAAGPSEDSNVRKNVQRSLATDLQTLSMELRKKQSVYLKRLRQQKEGQDGVDLEMNLNGNRSGTEDDELDNMVFSEHQMAKLKKSEAFTAEREREIQQVVESVNELAQIMKDLSVLVIDQGTIVDRIDHNIQAVATTVDDGLKQLEKAERTQKKGGMVMCASVLIVMCLVMLVLLILKEIFF 329
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
3 4239376 4242748 + Conep03aG0085400.1 Cone3ag0826 434285

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cone3ag0826 329 Coils Coil 87 107 - -
Cone3ag0826 329 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 233 295 IPR000727 -
Cone3ag0826 329 Pfam SNARE domain 269 321 IPR000727 -
Cone3ag0826 329 SMART tSNARE_6 228 295 IPR000727 -
Cone3ag0826 329 PANTHER SYNTAXIN 90 316 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Cone3ag0826 329 SUPERFAMILY t-snare proteins 79 288 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Cone3ag0826 329 Gene3D - 80 287 - -
Cone3ag0826 329 ProSitePatterns Syntaxin / epimorphin family signature. 239 278 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Cone3ag0826 329 SMART SynN_4 74 189 IPR006011 GO:0016020(InterPro)
Cone3ag0826 329 CDD SNARE_syntaxin16 237 294 - -
Cone3ag0826 329 MobiDBLite consensus disorder prediction 24 40 - -
Cone3ag0826 329 MobiDBLite consensus disorder prediction 24 43 - -
Cone3ag0826 329 FunFam Syntaxin-43 80 287 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cone3ag0826 K08489 - - cit:102612546 519.235
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cone17ag0442 Cone-Chr17:2078757 Cone3ag0826 Cone-Chr3:4239376 1.81E-147 dispersed
Cone10ag0804 Cone-Chr10:4080924 Cone3ag0826 Cone-Chr3:4239376 2.90E-197 wgd
Cone20ag0971 Cone-Chr20:6911166 Cone3ag0826 Cone-Chr3:4239376 1.24E-65 wgd
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi14g133 . . . . . . . . . . Cma05g01087 Cma12g01045 Car05g00958 Car12g01004 . Cpe07g00878 Cpe11g00890 . . . . . . . Cla02g01497 Cam02g1577 Cec02g1601 Cco02g1642 Clacu02g1560 Cmu02g1513 Cre02g1836 Cone10ag0804 Cone3ag0826 . . . Csa02g00478 . Cme05g01576 . . Bda01g01638 . . . . Bma05g00265 Sed11g0396 Cmo05g01102 Cmo12g01056 . . . . . . Bhi06g01461 Tan08g0631 Cmetu05g1168 . Hepe08g2281 . . . . . . . . . Lsi11g00612 . Chy05g01060 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cone17ag1057 . 1 335 SNARE and Associated Proteins AT3G24350 61.3 2.1e-103 373.2
Cone20ag0645 . 1 323 SNARE and Associated Proteins AT3G24350 59.7 3.0e-94 342.8
Cone3ag0576 . 1 310 SNARE and Associated Proteins AT1G08560 59.8 1.1e-92 337.4
Cone10ag0552 . 1 311 SNARE and Associated Proteins AT1G08560 59.8 1.1e-92 337.4
Cone6ag1632 . 1 280 SNARE and Associated Proteins AT2G18260 54.6 3.7e-77 285.8
Cone19ag0431 . 19 278 SNARE and Associated Proteins AT3G11820 80.5 1.9e-113 406.4
Cone13ag0475 . 19 278 SNARE and Associated Proteins AT3G11820 78.5 3.8e-109 392.1
Cone1ag0131 . 31 281 SNARE and Associated Proteins AT3G11820 64.5 3.3e-89 325.9
Cone5ag1736 . 31 281 SNARE and Associated Proteins AT3G11820 62.9 4.8e-88 322.0
Cone13ag0457 . 32 286 SNARE and Associated Proteins AT3G11820 51.4 1.4e-66 250.8
Cone19ag0431 . 29 278 SNARE and Associated Proteins AT3G52400 69.2 2.9e-91 332.8
Cone13ag0475 . 29 278 SNARE and Associated Proteins AT3G52400 68.0 3.6e-89 325.9
Cone1ag0131 . 1 281 SNARE and Associated Proteins AT3G52400 54.0 6.4e-78 288.5
Cone5ag1736 . 1 281 SNARE and Associated Proteins AT3G52400 53.3 7.0e-77 285.0
Cone1ag0131 . 1 294 SNARE and Associated Proteins AT4G03330 69.0 8.4e-106 380.9
Cone5ag1736 . 1 294 SNARE and Associated Proteins AT4G03330 67.7 3.5e-104 375.6
Cone19ag0431 . 1 279 SNARE and Associated Proteins AT4G03330 58.7 1.2e-83 307.4
Cone13ag0475 . 1 279 SNARE and Associated Proteins AT4G03330 56.5 6.5e-82 301.6
Cone3ag1346 . 37 263 SNARE and Associated Proteins AT4G03330 50.2 6.1e-56 215.3
Cone1ag0131 . 1 293 SNARE and Associated Proteins AT1G61290 72.7 8.3e-114 407.5
Cone5ag1736 . 1 293 SNARE and Associated Proteins AT1G61290 72.7 3.2e-113 405.6
Cone19ag0431 . 1 279 SNARE and Associated Proteins AT1G61290 63.1 5.3e-92 335.1
Cone13ag0475 . 1 279 SNARE and Associated Proteins AT1G61290 63.5 1.2e-91 334.0
Cone1ag0131 . 1 293 SNARE and Associated Proteins AT1G11250 73.0 9.1e-113 404.1
Cone5ag1736 . 1 293 SNARE and Associated Proteins AT1G11250 71.3 1.9e-110 396.4
Cone19ag0431 . 1 279 SNARE and Associated Proteins AT1G11250 63.4 3.2e-94 342.4
Cone13ag0475 . 1 279 SNARE and Associated Proteins AT1G11250 63.1 4.7e-93 338.6
Cone13ag0457 . 1 303 SNARE and Associated Proteins AT3G03800 73.6 1.5e-115 413.3
Cone3ag0557 . 1 305 SNARE and Associated Proteins AT3G03800 69.2 2.8e-109 392.5
Cone10ag0529 . 1 305 SNARE and Associated Proteins AT3G03800 66.2 3.2e-105 379.0
Cone3ag1346 . 6 281 SNARE and Associated Proteins AT3G03800 62.3 4.4e-86 315.5
Cone13ag0457 . 1 204 SNARE and Associated Proteins AT5G08080 76.0 2.1e-77 286.2
Cone3ag0557 . 1 203 SNARE and Associated Proteins AT5G08080 71.9 2.8e-74 275.8
Cone10ag0529 . 1 203 SNARE and Associated Proteins AT5G08080 67.0 7.4e-67 251.1
Cone3ag1346 . 13 180 SNARE and Associated Proteins AT5G08080 67.9 1.2e-53 207.2
Cone15ag0918 . 1 256 SNARE and Associated Proteins AT5G16830 58.6 2.3e-73 273.1
Cone12ag0481 . 1 263 SNARE and Associated Proteins AT5G16830 58.0 5.0e-73 271.9
Cone14ag0930 . 1 252 SNARE and Associated Proteins AT5G16830 57.1 4.3e-72 268.9
Cone8ag0484 . 1 262 SNARE and Associated Proteins AT5G16830 56.1 8.0e-71 264.6
Cone14ag0931 . 1 137 SNARE and Associated Proteins AT5G16830 59.7 5.3e-38 155.6
Cone8ag0484 . 1 273 SNARE and Associated Proteins AT5G46860 62.6 2.7e-76 282.7
Cone12ag0481 . 1 274 SNARE and Associated Proteins AT5G46860 62.0 4.4e-74 275.4
Cone14ag0930 . 1 252 SNARE and Associated Proteins AT5G46860 53.2 7.2e-61 231.5
Cone15ag0918 . 1 256 SNARE and Associated Proteins AT5G46860 52.7 7.2e-61 231.5
Cone14ag0931 . 1 140 SNARE and Associated Proteins AT5G46860 66.4 6.2e-44 175.3
Cone8ag0484 . 1 256 SNARE and Associated Proteins AT4G17730 58.5 3.2e-69 259.2
Cone12ag0481 . 1 257 SNARE and Associated Proteins AT4G17730 58.0 3.5e-68 255.8
Cone14ag0930 . 1 244 SNARE and Associated Proteins AT4G17730 53.0 1.4e-61 233.8
Cone15ag0918 . 1 256 SNARE and Associated Proteins AT4G17730 51.9 2.4e-61 233.0
Cone14ag0931 . 1 140 SNARE and Associated Proteins AT4G17730 66.7 5.6e-42 168.7
Cone8ag0484 . 64 255 SNARE and Associated Proteins AT1G32270 60.4 6.0e-52 202.2
Cone12ag0481 . 65 256 SNARE and Associated Proteins AT1G32270 60.4 1.0e-51 201.4
Cone14ag0930 . 64 252 SNARE and Associated Proteins AT1G32270 57.7 1.1e-48 191.4
Cone15ag0918 . 64 255 SNARE and Associated Proteins AT1G32270 55.7 1.2e-47 188.0
Cone5ag0210 . 1 338 SNARE and Associated Proteins AT5G05760 68.8 1.2e-118 423.7
Cone17ag1057 . 1 335 SNARE and Associated Proteins AT3G24350 61.3 2.1e-103 373.2
Cone20ag0645 . 1 323 SNARE and Associated Proteins AT3G24350 59.7 3.0e-94 342.8
Cone3ag0826 . 1 328 SNARE and Associated Proteins AT5G26980 75.9 1.0e-125 447.2
Cone10ag0804 . 1 327 SNARE and Associated Proteins AT5G26980 75.8 8.5e-125 444.1
Cone17ag0442 . 1 321 SNARE and Associated Proteins AT5G26980 70.9 4.1e-111 398.7
Cone20ag0971 . 1 223 SNARE and Associated Proteins AT5G26980 53.1 3.1e-50 196.4
Cone17ag0442 . 1 319 SNARE and Associated Proteins AT4G02195 68.2 1.6e-110 396.7
Cone3ag0826 . 1 329 SNARE and Associated Proteins AT4G02195 66.5 5.2e-106 381.7
Cone10ag0804 . 1 328 SNARE and Associated Proteins AT4G02195 64.8 1.7e-104 376.7
Cone20ag0971 . 1 223 SNARE and Associated Proteins AT4G02195 50.4 1.3e-48 191.0
Cone3ag0826 . 1 327 SNARE and Associated Proteins AT3G05710 75.5 4.2e-127 451.8
Cone10ag0804 . 1 326 SNARE and Associated Proteins AT3G05710 75.5 4.7e-126 448.4
Cone17ag0442 . 1 319 SNARE and Associated Proteins AT3G05710 68.4 4.0e-109 392.1
Cone9ag0047 . 1 233 SNARE and Associated Proteins AT1G16240 74.2 4.9e-90 328.2
Cone6ag0041 . 1 232 SNARE and Associated Proteins AT1G16240 74.2 1.2e-88 323.6
Cone15ag1202 . 1 234 SNARE and Associated Proteins AT1G16240 63.2 2.0e-75 279.6
Cone14ag1185 . 1 189 SNARE and Associated Proteins AT1G16240 63.5 2.3e-63 239.6
Cone6ag0041 . 1 232 SNARE and Associated Proteins AT1G79590 75.1 1.3e-91 333.6
Cone9ag0047 . 1 233 SNARE and Associated Proteins AT1G79590 73.0 3.6e-89 325.5
Cone15ag1202 . 1 234 SNARE and Associated Proteins AT1G79590 63.7 2.7e-76 282.7
Cone14ag1185 . 1 189 SNARE and Associated Proteins AT1G79590 64.0 8.2e-65 244.6
Cone14ag1146 . 56 247 SNARE and Associated Proteins AT1G28490 71.4 2.5e-66 249.2
Cone15ag1164 . 13 213 SNARE and Associated Proteins AT1G28490 67.8 9.5e-66 247.3
Cone19ag1262 . 1 265 SNARE and Associated Proteins AT3G09740 81.2 1.7e-115 412.9
Cone13ag1275 . 1 265 SNARE and Associated Proteins AT3G09740 80.8 1.1e-114 410.2
Cone5ag1222 . 1 233 SNARE and Associated Proteins AT3G09740 53.1 3.3e-58 222.6
Cone13ag1275 . 1 265 SNARE and Associated Proteins AT3G45280 64.0 1.0e-86 317.4
Cone19ag1262 . 1 265 SNARE and Associated Proteins AT3G45280 63.3 1.7e-86 316.6
Cone5ag1222 . 1 230 SNARE and Associated Proteins AT3G45280 53.8 2.5e-61 233.0
Cone13ag1275 . 1 262 SNARE and Associated Proteins AT3G61450 66.8 2.9e-91 332.4
Cone19ag1262 . 1 262 SNARE and Associated Proteins AT3G61450 66.0 1.5e-90 330.1
Cone11ag1168 . 65 309 SNARE and Associated Proteins AT1G51740 76.4 1.7e-96 349.7
Cone18ag0421 . 65 309 SNARE and Associated Proteins AT1G51740 76.8 6.4e-96 347.8
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003497 3 1 2 2 1 1 2 1 1 1 1 1 2 1 1 2 1 2 2 1 1 1 1 1 1 1 1 4 4 2 46