Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Cpe13g00986	ATGGATGCGAATAGTTCGCGATTTCAGTCGTTTGGTCAAACCGAGATTAACTGGGACAAGCTTGATAAAGCAAAATTTTATGGCATCGGAGCTGGTCTCTTTACCGGGATTACAGTCGCACTGTACCCTGTTTCCGTTGTAAAAACAAGGATGCAGGTTGCTGTAAAGGATTCTGCAGAGAAAAACGCGGTGTCTGTTGTTAAAGGCTTACTTAAGAATGATGGGGTTCCTGGTCTTTACAGAGGGTTTGGCACAGTAATCACTGGTGCAATTCCTGCAAGGATTATCTTTCTTACCGCTTTGGAGACGACCAAAGTGGGAGCCTTTAAAATGGTTGAGCCATTTAAATTTTCTGAACCCTCACAGGCTGCTATAGCAAATGGGTTAGCTGGCATGACTGCATCACTTTTCTCTCAAGCTGTTTTTGTTCCAATTGATGTGATTAGTCAAAAGCTAATGGTTCAAGGATACTCGGGTAATGCAAGATATAATGGGGGCTTAGATGTTGCTCGTAAACTGATAAAGTCCGATGGCATCCGGGGATTGTATAAAGGTTTTGGGTTATCTGTTATAACCTACTCTCCATCTAGTGCTGTATGGTTCTTAGGCCAAAACTCAGCTTCTGAGAGCTTTGCTCCAAGCCATACCCAACTTATTTCAGTGCAAGCTGGTGGTGGAATAATTGCAGGTGCAACAGCTTCCTGCATTACAACACCATTGGACACCATAAAGACTCGCTTACAGGTGATGGGCGATAAAGGGAAGACAGCAAGACAAATTGTTGAAAGCTTAATCGCTGAGGATGGATGGAAAGGTTTCTACAGGGGGCTGGGTCCTCGGTTCTTCAGTATGTCAGCCTGGGGAACCTCCATGATATTGGCTTACGAGTACTTAAAGCGCTTGTGTGCAAATGATGAACAGAGTTGA	927	44.12	MDANSSRFQSFGQTEINWDKLDKAKFYGIGAGLFTGITVALYPVSVVKTRMQVAVKDSAEKNAVSVVKGLLKNDGVPGLYRGFGTVITGAIPARIIFLTALETTKVGAFKMVEPFKFSEPSQAAIANGLAGMTASLFSQAVFVPIDVISQKLMVQGYSGNARYNGGLDVARKLIKSDGIRGLYKGFGLSVITYSPSSAVWFLGQNSASESFAPSHTQLISVQAGGGIIAGATASCITTPLDTIKTRLQVMGDKGKTARQIVESLIAEDGWKGFYRGLGPRFFSMSAWGTSMILAYEYLKRLCANDEQS	308

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
13	8149902	8153909	-	Cp4.1LG13g07990.1	Cpe13g00986	480184

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Cpe13g00986	308	ProSiteProfiles	Solute carrier (Solcar) repeat profile.	19	107	IPR018108	-
Cpe13g00986	308	ProSiteProfiles	Solute carrier (Solcar) repeat profile.	217	301	IPR018108	-
Cpe13g00986	308	PANTHER	MITOCHONDRIAL SUBSTRATE CARRIER FAMILY PROTEIN J	1	305	-	-
Cpe13g00986	308	Pfam	Mitochondrial carrier protein	30	106	IPR018108	-
Cpe13g00986	308	Pfam	Mitochondrial carrier protein	225	304	IPR018108	-
Cpe13g00986	308	Pfam	Mitochondrial carrier protein	125	211	IPR018108	-
Cpe13g00986	308	PRINTS	Mitochondrial carrier protein signature	183	201	IPR002067	GO:0055085
Cpe13g00986	308	PRINTS	Mitochondrial carrier protein signature	39	53	IPR002067	GO:0055085
Cpe13g00986	308	PRINTS	Mitochondrial carrier protein signature	226	248	IPR002067	GO:0055085
Cpe13g00986	308	ProSiteProfiles	Solute carrier (Solcar) repeat profile.	122	210	IPR018108	-
Cpe13g00986	308	Gene3D	Mitochondrial carrier domain	30	308	IPR023395	-
Cpe13g00986	308	SUPERFAMILY	Mitochondrial carrier	19	298	IPR023395	-
Cpe13g00986	308	PANTHER	MITOCHONDRIAL SUBSTRATE CARRIER FAMILY PROTEIN	1	305	-	-

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Cpe13g00986	K15121	SLC25A44; solute carrier family 25, member 44	-	csv:101206140	563.148

WGDs- Genes

Select	Gene_1	Gene_2	Event_name
	Cpe01g02433	Cpe13g00986	CCT

Dupl-types

Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
Cpe12g00598	Cpe-Chr12:5973612	Cpe13g00986	Cpe-Chr13:8149902	1.14E-79	dispersed
Cpe13g00986	Cpe-Chr13:8149902	Cpe17g00470	Cpe-Chr17:3502403	7.19E-73	dispersed
Cpe03g01311	Cpe-Chr3:10613913	Cpe13g00986	Cpe-Chr13:8149902	1.88E-96	transposed
Cpe01g02433	Cpe-Chr1:20187854	Cpe13g00986	Cpe-Chr13:8149902	2.58E-07	wgd

Deco-Alignment

Select	Vvi1	Blo1	Blo2	Bda1	Bda2	Bpe1	Bpe2	Bma1	Bma2	Cmo1	Cmo2	Cma1	Cma2	Car1	Car2	Sed1	Cpe1	Cpe2	Bhi1	Tan1	Cmetu1	Lac1	Hepe1	Mch1	Lcy1	Cla1	Cam1	Cec1	Cco1	Clacu1	Cmu1	Cre1	Cone1	Cone2	Cone3	Cone4	Lsi1	Csa1	Chy1	Cme1	Blo3	Blo4	Bda3	Bda4	Bpe3	Bpe4	Bma3	Bma4	Sed2	Cmo3	Cmo4	Cma3	Cma4	Car3	Car4	Cpe3	Cpe4	Bhi2	Tan2	Cmetu2	Lac2	Hepe2	Mch2	Lcy2	Cla2	Cam2	Cec2	Cco2	Clacu2	Cmu2	Cre2	Lsi2	Csa2	Chy2	Cme2
	Vvi14g1007	Blo10g00165	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Cpe13g00986	Bhi06g00306	.	.	.	Hepe02g3214	.	.	Cla11g00459	Cam11g0513	Cec11g0505	Cco11g0501	.	Cmu11g0495	Cre11g0975	Cone11ag0356	Cone18ag1144	.	.	.	Csa05g03044	.	.	.	.	Bda07g01026	.	.	.	.	.	.	Cmo04g02937	Cmo15g00236	Cma04g02808	Cma15g00225	Car04g02706	Car15g00230	.	Cpe01g02433	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Lsi03g00181	.	Chy09g00188	Cme09g00204

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Cpe02g01243	.	70	517	Chloroplast and Mitochondria Gene Families	AT2G28800	61.1	4.8e-135	478.4
Cpe11g00044	.	71	421	Chloroplast and Mitochondria Gene Families	AT2G28800	56.5	5.9e-101	365.2
Cpe07g00037	.	71	423	Chloroplast and Mitochondria Gene Families	AT2G28800	53.8	7.4e-96	348.2
Cpe13g00676	.	3	255	Chloroplast and Mitochondria Gene Families	AT1G15820	83.1	8.9e-121	430.3
Cpe04g00386	.	6	258	Chloroplast and Mitochondria Gene Families	AT1G15820	81.6	1.3e-119	426.4
Cpe04g00672	.	1	265	Chloroplast and Mitochondria Gene Families	AT3G27690	89.5	1.7e-144	509.2
Cpe02g01544	CCT	1	265	Chloroplast and Mitochondria Gene Families	AT3G27690	77.2	6.6e-120	427.6
Cpe10g00102	.	2	265	Chloroplast and Mitochondria Gene Families	AT3G27690	76.7	2.5e-119	425.6
Cpe16g00726	.	2	267	Chloroplast and Mitochondria Gene Families	AT3G27690	76.6	4.3e-119	424.9
Cpe19g01123	.	2	265	Chloroplast and Mitochondria Gene Families	AT3G27690	76.7	4.3e-119	424.9
Cpe03g00823	CCT	1	245	Chloroplast and Mitochondria Gene Families	AT3G27690	69.4	3.7e-102	368.6
Cpe14g00702	.	7	266	Chloroplast and Mitochondria Gene Families	AT3G27690	66.4	3.6e-97	352.1
Cpe01g00833	.	5	264	Chloroplast and Mitochondria Gene Families	AT3G27690	66.4	7.9e-97	350.9
Cpe02g00975	.	73	276	Chloroplast and Mitochondria Gene Families	AT3G27690	52.2	2.0e-52	203.4
Cpe20g00513	.	1	107	Chloroplast and Mitochondria Gene Families	AT3G27690	56.9	7.8e-44	174.9
Cpe09g00591	CST	45	271	Chloroplast and Mitochondria Gene Families	AT3G61470	81.6	3.5e-117	418.3
Cpe01g01617	CST	27	227	Chloroplast and Mitochondria Gene Families	AT3G61470	74.4	2.1e-98	355.9
Cpe04g01009	.	60	265	Chloroplast and Mitochondria Gene Families	AT3G61470	65.5	2.7e-85	312.4
Cpe18g00788	CCT,ECH	22	250	Chloroplast and Mitochondria Gene Families	AT3G61470	50.2	2.2e-63	239.6
Cpe04g01495	CCT,ECH	22	249	Chloroplast and Mitochondria Gene Families	AT3G61470	50.8	2.5e-62	236.1
Cpe02g01055	.	22	245	Chloroplast and Mitochondria Gene Families	AT3G61470	50.6	4.2e-62	235.3
Cpe13g00808	CCT	1	198	Chloroplast and Mitochondria Gene Families	AT3G54890	81.6	4.3e-89	324.7
Cpe01g02245	CCT	1	198	Chloroplast and Mitochondria Gene Families	AT3G54890	80.4	3.7e-88	321.6
Cpe10g00945	.	54	338	Chloroplast and Mitochondria Gene Families	AT3G08940	83.6	4.9e-136	481.1
Cpe19g00292	.	58	323	Chloroplast and Mitochondria Gene Families	AT3G08940	75.4	1.3e-117	419.9
Cpe04g00672	.	47	256	Chloroplast and Mitochondria Gene Families	AT1G76570	50.5	4.5e-53	205.7
Cpe18g00215	.	1	273	Chloroplast and Mitochondria Gene Families	AT1G61520	85.3	1.8e-135	479.2
Cpe04g00872	.	1	269	Chloroplast and Mitochondria Gene Families	AT1G61520	85.0	6.9e-132	467.2
Cpe04g00672	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G05070	89.4	3.4e-144	508.1
Cpe10g00102	.	5	265	Chloroplast and Mitochondria Gene Families	AT2G05070	78.6	7.7e-120	427.2
Cpe16g00726	.	7	267	Chloroplast and Mitochondria Gene Families	AT2G05070	78.6	2.9e-119	425.2
Cpe19g01123	.	5	265	Chloroplast and Mitochondria Gene Families	AT2G05070	77.8	5.0e-119	424.5
Cpe02g01544	CCT	8	265	Chloroplast and Mitochondria Gene Families	AT2G05070	78.8	3.2e-118	421.8
Cpe03g00823	CCT	1	245	Chloroplast and Mitochondria Gene Families	AT2G05070	70.0	1.2e-101	366.7
Cpe14g00702	.	10	266	Chloroplast and Mitochondria Gene Families	AT2G05070	67.7	5.4e-97	351.3
Cpe01g00833	.	8	264	Chloroplast and Mitochondria Gene Families	AT2G05070	67.7	9.2e-97	350.5
Cpe02g00975	.	73	276	Chloroplast and Mitochondria Gene Families	AT2G05070	52.6	1.4e-52	203.8
Cpe20g00513	.	1	107	Chloroplast and Mitochondria Gene Families	AT2G05070	56.9	1.5e-43	173.7
Cpe04g00672	.	1	237	Chloroplast and Mitochondria Gene Families	AT2G05100	89.5	1.5e-125	446.4
Cpe10g00102	.	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	76.1	2.5e-101	365.9
Cpe02g01544	CCT	8	237	Chloroplast and Mitochondria Gene Families	AT2G05100	77.6	2.8e-100	362.5
Cpe19g01123	.	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	76.4	2.8e-100	362.5
Cpe16g00726	.	7	239	Chloroplast and Mitochondria Gene Families	AT2G05100	76.1	8.1e-100	360.9
Cpe03g00823	CCT	1	210	Chloroplast and Mitochondria Gene Families	AT2G05100	74.2	3.3e-85	312.4
Cpe14g00702	.	10	238	Chloroplast and Mitochondria Gene Families	AT2G05100	67.2	4.5e-82	302.0
Cpe01g00833	.	8	236	Chloroplast and Mitochondria Gene Families	AT2G05100	67.2	1.0e-81	300.8
Cpe02g00975	.	73	260	Chloroplast and Mitochondria Gene Families	AT2G05100	50.8	1.4e-43	174.1
Cpe10g00945	.	53	221	Chloroplast and Mitochondria Gene Families	AT2G40100	72.8	6.3e-68	254.2
Cpe19g00292	.	61	215	Chloroplast and Mitochondria Gene Families	AT2G40100	71.1	8.2e-60	227.3
Cpe16g00726	.	1	267	Chloroplast and Mitochondria Gene Families	AT1G29930	87.7	2.9e-135	478.4
Cpe10g00102	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29930	87.6	1.9e-134	475.7
Cpe19g01123	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29930	87.3	9.5e-134	473.4
Cpe02g01544	CCT	4	265	Chloroplast and Mitochondria Gene Families	AT1G29930	85.3	1.5e-126	449.5
Cpe04g00672	.	3	265	Chloroplast and Mitochondria Gene Families	AT1G29930	78.3	2.0e-115	412.5
Cpe03g00823	CCT	3	245	Chloroplast and Mitochondria Gene Families	AT1G29930	75.9	9.5e-110	393.7
Cpe01g00833	.	46	264	Chloroplast and Mitochondria Gene Families	AT1G29930	74.5	1.6e-93	339.7
Cpe14g00702	.	48	266	Chloroplast and Mitochondria Gene Families	AT1G29930	74.5	1.6e-93	339.7
Cpe02g00975	.	73	276	Chloroplast and Mitochondria Gene Families	AT1G29930	51.4	1.1e-52	204.1
Cpe20g00513	.	1	107	Chloroplast and Mitochondria Gene Families	AT1G29930	59.0	4.4e-46	182.2
Cpe16g00726	.	1	267	Chloroplast and Mitochondria Gene Families	AT1G29920	87.3	1.1e-134	476.5
Cpe10g00102	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29920	87.3	7.3e-134	473.8
Cpe19g01123	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29920	86.9	3.6e-133	471.5
Cpe02g01544	CCT	4	265	Chloroplast and Mitochondria Gene Families	AT1G29920	85.3	1.9e-126	449.1
Cpe04g00672	.	31	265	Chloroplast and Mitochondria Gene Families	AT1G29920	83.7	2.6e-115	412.1
Cpe03g00823	CCT	3	245	Chloroplast and Mitochondria Gene Families	AT1G29920	75.9	1.2e-109	393.3
Cpe01g00833	.	46	264	Chloroplast and Mitochondria Gene Families	AT1G29920	74.5	1.6e-93	339.7
Cpe14g00702	.	48	266	Chloroplast and Mitochondria Gene Families	AT1G29920	74.5	1.6e-93	339.7
Cpe02g00975	.	73	276	Chloroplast and Mitochondria Gene Families	AT1G29920	51.4	1.1e-52	204.1
Cpe20g00513	.	1	107	Chloroplast and Mitochondria Gene Families	AT1G29920	59.0	4.4e-46	182.2
Cpe16g00726	.	1	267	Chloroplast and Mitochondria Gene Families	AT1G29910	87.3	1.1e-134	476.5
Cpe10g00102	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29910	87.3	7.3e-134	473.8
Cpe19g01123	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29910	86.9	3.6e-133	471.5
Cpe02g01544	CCT	4	265	Chloroplast and Mitochondria Gene Families	AT1G29910	85.3	1.9e-126	449.1
Cpe04g00672	.	31	265	Chloroplast and Mitochondria Gene Families	AT1G29910	83.7	2.6e-115	412.1
Cpe03g00823	CCT	3	245	Chloroplast and Mitochondria Gene Families	AT1G29910	75.9	1.2e-109	393.3
Cpe01g00833	.	46	264	Chloroplast and Mitochondria Gene Families	AT1G29910	74.5	1.6e-93	339.7
Cpe14g00702	.	48	266	Chloroplast and Mitochondria Gene Families	AT1G29910	74.5	1.6e-93	339.7
Cpe02g00975	.	73	276	Chloroplast and Mitochondria Gene Families	AT1G29910	51.4	1.1e-52	204.1
Cpe20g00513	.	1	107	Chloroplast and Mitochondria Gene Families	AT1G29910	59.0	4.4e-46	182.2
Cpe02g00975	.	11	291	Chloroplast and Mitochondria Gene Families	AT4G10340	82.6	1.1e-132	469.9
Cpe10g00102	.	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.5	7.5e-57	218.0
Cpe19g01123	.	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.0	9.8e-57	217.6
Cpe16g00726	.	51	255	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	1.3e-56	217.2
Cpe02g01544	CCT	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	53.6	2.9e-56	216.1
Cpe04g00672	.	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.2	3.5e-54	209.1
Cpe01g00833	.	46	252	Chloroplast and Mitochondria Gene Families	AT4G10340	54.0	4.3e-52	202.2
Cpe14g00702	.	48	254	Chloroplast and Mitochondria Gene Families	AT4G10340	54.0	4.3e-52	202.2
Cpe16g00726	.	1	267	Chloroplast and Mitochondria Gene Families	AT2G34420	87.7	1.9e-134	475.7
Cpe10g00102	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34420	87.6	1.2e-133	473.0
Cpe19g01123	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34420	87.3	6.1e-133	470.7
Cpe02g01544	CCT	4	265	Chloroplast and Mitochondria Gene Families	AT2G34420	86.0	2.2e-127	452.2
Cpe04g00672	.	3	265	Chloroplast and Mitochondria Gene Families	AT2G34420	76.8	8.8e-116	413.7
Cpe03g00823	CCT	3	245	Chloroplast and Mitochondria Gene Families	AT2G34420	76.3	1.9e-110	396.0
Cpe01g00833	.	46	264	Chloroplast and Mitochondria Gene Families	AT2G34420	75.0	2.1e-93	339.3
Cpe14g00702	.	48	266	Chloroplast and Mitochondria Gene Families	AT2G34420	75.0	2.1e-93	339.3
Cpe02g00975	.	73	276	Chloroplast and Mitochondria Gene Families	AT2G34420	50.5	5.3e-52	201.8
Cpe20g00513	.	1	107	Chloroplast and Mitochondria Gene Families	AT2G34420	59.6	4.3e-46	182.2
Cpe10g00102	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34430	87.6	1.0e-135	479.9
Cpe16g00726	.	1	267	Chloroplast and Mitochondria Gene Families	AT2G34430	87.3	1.1e-134	476.5
Cpe19g01123	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34430	87.6	1.1e-134	476.5
Cpe02g01544	CCT	4	265	Chloroplast and Mitochondria Gene Families	AT2G34430	86.0	3.1e-129	458.4
Cpe04g00672	.	30	265	Chloroplast and Mitochondria Gene Families	AT2G34430	83.3	1.3e-114	409.8
Cpe03g00823	CCT	3	245	Chloroplast and Mitochondria Gene Families	AT2G34430	77.0	9.2e-113	403.7
Cpe01g00833	.	46	264	Chloroplast and Mitochondria Gene Families	AT2G34430	75.0	2.8e-93	339.0
Cpe14g00702	.	48	266	Chloroplast and Mitochondria Gene Families	AT2G34430	75.0	2.8e-93	339.0
Cpe20g00513	.	1	107	Chloroplast and Mitochondria Gene Families	AT2G34430	59.6	4.3e-46	182.2
Cpe10g00945	.	56	338	Chloroplast and Mitochondria Gene Families	AT5G01530	83.1	1.3e-136	483.0
Cpe19g00292	.	58	323	Chloroplast and Mitochondria Gene Families	AT5G01530	74.8	7.2e-119	424.1
Cpe01g00782	.	48	307	Chloroplast and Mitochondria Gene Families	AT5G40810	93.8	7.5e-144	506.9
Cpe14g00637	.	52	339	Chloroplast and Mitochondria Gene Families	AT5G40810	85.1	6.6e-140	493.8
Cpe01g00782	.	1	307	Chloroplast and Mitochondria Gene Families	AT3G27240	84.8	1.2e-148	523.1
Cpe14g00637	.	26	339	Chloroplast and Mitochondria Gene Families	AT3G27240	80.1	6.0e-140	494.2
Cpe16g00674	CCT,ECH	5	327	Chloroplast and Mitochondria Gene Families	AT2G30160	74.4	4.4e-141	498.0
Cpe05g00987	CCT,ECH	5	327	Chloroplast and Mitochondria Gene Families	AT2G30160	74.1	7.6e-141	497.3
Cpe10g00970	.	3	303	Chloroplast and Mitochondria Gene Families	AT2G30160	65.7	4.3e-112	401.7
Cpe19g00268	.	9	310	Chloroplast and Mitochondria Gene Families	AT2G30160	65.2	1.8e-110	396.4
Cpe05g00987	CCT,ECH	5	329	Chloroplast and Mitochondria Gene Families	AT1G07030	74.4	2.8e-140	495.4
Cpe16g00674	CCT,ECH	1	327	Chloroplast and Mitochondria Gene Families	AT1G07030	74.4	1.1e-139	493.4
Cpe10g00970	.	3	303	Chloroplast and Mitochondria Gene Families	AT1G07030	68.6	3.4e-117	418.7
Cpe19g00268	.	5	310	Chloroplast and Mitochondria Gene Families	AT1G07030	65.6	1.9e-112	402.9
Cpe12g00913	CCT	1	305	Chloroplast and Mitochondria Gene Families	AT2G47490	76.4	3.1e-136	481.9
Cpe17g00770	CCT	593	862	Chloroplast and Mitochondria Gene Families	AT2G47490	72.9	6.5e-118	421.0
Cpe13g00396	.	11	290	Chloroplast and Mitochondria Gene Families	AT2G47490	59.7	2.8e-97	352.4
Cpe13g00396	.	3	341	Chloroplast and Mitochondria Gene Families	AT1G25380	57.8	1.8e-106	383.3
Cpe12g00913	CCT	11	297	Chloroplast and Mitochondria Gene Families	AT1G25380	63.8	3.9e-106	382.1
Cpe17g00770	CCT	596	853	Chloroplast and Mitochondria Gene Families	AT1G25380	62.1	2.4e-95	346.3
Cpe20g00406	.	1	584	Chloroplast and Mitochondria Gene Families	AT4G21490	74.2	2.0e-258	888.6
Cpe15g00785	CCT	1	574	Chloroplast and Mitochondria Gene Families	AT4G21490	64.4	1.4e-222	769.6
Cpe05g01477	CCT	5	534	Chloroplast and Mitochondria Gene Families	AT4G21490	63.1	5.5e-203	704.5
Cpe17g00473	.	4	186	Chloroplast and Mitochondria Gene Families	AT1G17530	65.6	2.3e-62	235.7
Cpe12g00606	.	15	186	Chloroplast and Mitochondria Gene Families	AT1G17530	67.6	1.5e-61	233.0
Cpe04g00023	.	10	179	Chloroplast and Mitochondria Gene Families	AT1G17530	59.9	1.2e-50	196.8
Cpe05g00848	.	5	180	Chloroplast and Mitochondria Gene Families	AT1G17530	57.3	1.5e-50	196.4
Cpe05g00848	.	15	184	Chloroplast and Mitochondria Gene Families	AT3G04800	59.1	9.2e-51	197.2
Cpe04g00023	.	12	183	Chloroplast and Mitochondria Gene Families	AT3G04800	57.2	1.6e-50	196.4
Cpe17g00473	.	22	190	Chloroplast and Mitochondria Gene Families	AT3G04800	55.0	1.4e-43	173.3
Cpe12g00606	.	22	190	Chloroplast and Mitochondria Gene Families	AT3G04800	55.0	5.4e-43	171.4
Cpe17g00473	.	15	190	Chloroplast and Mitochondria Gene Families	AT1G72750	69.1	9.5e-64	240.4
Cpe12g00606	.	5	190	Chloroplast and Mitochondria Gene Families	AT1G72750	65.8	1.6e-63	239.6
Cpe05g00848	.	5	184	Chloroplast and Mitochondria Gene Families	AT1G72750	59.0	9.9e-53	203.8
Cpe04g00023	.	10	183	Chloroplast and Mitochondria Gene Families	AT1G72750	58.8	4.9e-52	201.4
Cpe09g00268	.	1	240	Chloroplast and Mitochondria Gene Families	AT1G26100	58.3	3.5e-71	265.4
Cpe01g02464	CCT,ECH	34	281	Chloroplast and Mitochondria Gene Families	AT5G38630	64.3	4.9e-86	314.7
Cpe15g00317	.	23	218	Chloroplast and Mitochondria Gene Families	AT4G25570	75.0	2.9e-85	312.4
Cpe05g00656	.	23	218	Chloroplast and Mitochondria Gene Families	AT4G25570	67.3	1.5e-76	283.5
Cpe01g01926	CCT,ECH	9	364	Chloroplast and Mitochondria Gene Families	AT5G14040	81.3	1.2e-169	593.2
Cpe13g00493	CCT,ECH	9	364	Chloroplast and Mitochondria Gene Families	AT5G14040	80.8	3.7e-168	588.2
Cpe18g00933	.	39	347	Chloroplast and Mitochondria Gene Families	AT5G14040	84.6	4.7e-155	544.7
Cpe04g00457	.	9	354	Chloroplast and Mitochondria Gene Families	AT5G14040	73.2	1.8e-151	532.7
Cpe13g00493	CCT,ECH	8	356	Chloroplast and Mitochondria Gene Families	AT3G48850	71.2	9.5e-145	510.4
Cpe01g01926	CCT,ECH	8	362	Chloroplast and Mitochondria Gene Families	AT3G48850	69.7	4.7e-144	508.1
Cpe18g00933	.	12	347	Chloroplast and Mitochondria Gene Families	AT3G48850	69.6	1.3e-141	500.0
Cpe04g00457	.	11	351	Chloroplast and Mitochondria Gene Families	AT3G48850	69.9	3.3e-137	485.3
Cpe04g00636	.	10	271	Chloroplast and Mitochondria Gene Families	AT2G17270	68.0	5.7e-106	381.3
Cpe13g00493	CCT,ECH	62	352	Chloroplast and Mitochondria Gene Families	AT2G17270	52.2	2.5e-85	312.8
Cpe01g01926	CCT,ECH	62	353	Chloroplast and Mitochondria Gene Families	AT2G17270	51.4	3.6e-84	308.9
Cpe18g00933	.	51	348	Chloroplast and Mitochondria Gene Families	AT2G17270	50.2	3.6e-84	308.9
Cpe13g00986	CCT	16	306	Chloroplast and Mitochondria Gene Families	AT5G15640	73.0	1.1e-120	430.3
Cpe01g02433	CCT	16	261	Chloroplast and Mitochondria Gene Families	AT5G15640	76.9	1.6e-103	373.2
Cpe02g00281	CCT	1	341	Chloroplast and Mitochondria Gene Families	AT5G26200	66.6	2.1e-125	446.0
Cpe06g00253	CCT	12	344	Chloroplast and Mitochondria Gene Families	AT5G26200	67.3	6.0e-125	444.5
Cpe17g00470	.	1	333	Chloroplast and Mitochondria Gene Families	AT5G26200	57.5	3.6e-101	365.5
Cpe12g00598	.	1	319	Chloroplast and Mitochondria Gene Families	AT5G26200	60.6	2.0e-99	359.8
Cpe17g00470	.	1	340	Chloroplast and Mitochondria Gene Families	AT1G72820	73.9	5.9e-144	507.7
Cpe12g00598	.	1	323	Chloroplast and Mitochondria Gene Families	AT1G72820	76.7	5.4e-137	484.6
Cpe02g00281	CCT	1	342	Chloroplast and Mitochondria Gene Families	AT1G72820	69.9	2.2e-130	462.6
Cpe06g00253	CCT	1	345	Chloroplast and Mitochondria Gene Families	AT1G72820	69.6	3.2e-129	458.8
Cpe09g00069	CCT,ECH	97	300	Chloroplast and Mitochondria Gene Families	AT5G52570	58.3	1.1e-56	217.2
Cpe13g00137	.	130	318	Chloroplast and Mitochondria Gene Families	AT5G52570	51.9	1.5e-45	180.3
Cpe14g00086	CCT,ECH	1	219	Chloroplast and Mitochondria Gene Families	AT4G25700	62.8	1.2e-68	256.9
Cpe09g00069	CCT,ECH	1	219	Chloroplast and Mitochondria Gene Families	AT4G25700	62.3	2.2e-67	252.7
Cpe13g00137	.	62	235	Chloroplast and Mitochondria Gene Families	AT4G25700	56.3	3.2e-50	195.7
Cpe14g00700	.	88	321	Chloroplast and Mitochondria Gene Families	AT5G54290	75.2	1.7e-101	366.7
Cpe04g01282	.	43	570	Chloroplast and Mitochondria Gene Families	AT2G18710	80.6	8.5e-238	820.1

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0002174	2	4	1	1	1	2	3	2	2	2	2	1	4	2	2	3	2	3	3	1	2	2	2	2	2	2	2	2	3	2	64

Transcriptome

Select	Gene	Chr	Type	da1	da2	da3	da4	da5	da6	da7	da8	da9	da10
	Cpe13g00986	Cpe_Chr13	FPKM	25.749664	24.38563	19.222067	18.453686	20.877304	22.768892	20.26338	34.147011	34.63311	32.155876