Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cpe14g00975 ATGAGCTTTCAAGATATCGAGGCTGGTCGCCCGTTTGCTTCTTCGAGGAGAGACCTCATCAATGGCAAACAAGATCCCACGCAAGCCGTTGCCTCAGGTATATTTCAGATTAATACTGCCGTTGCTACGTTTCAGAGGCTTGTTAACACCTTAGGTACGCCGAAGGATACGCCTGAGCTACGCGAGAAGCTGCACAAGACCAGGTTACATATTGGACAGTTGGTTAAAGATACCTCTGCCAAACTTAAACAAGCAAGTGAAATAGATCATCACGCAGAAGTTAATGCCAGCAAGAAAATTGCAGATGCTAAACTTGCAAAAGATTTTCAAGCAGTGTTGAAAGAATTTCAGAAGGCTCAACGACTTGCAGCTGAGAGGGAAACAGCATATACACCTTTTGTTCCCCAGACTGTTCTACCTTCTAGCTACACAGCAGGCGAATCAGATGCAAGCTCAGAAAAGAATCTTGAACAGCGTGCTCTCCTTGTGGAATCCAGGAGACAAGAGGTCTTGCTGTTGGACAATGAAATCGCCTTCAATGAGGCAATAATTGAGGAAAGAGAGCAAGGTATTCATGAAATCCAGCACCAAATTGGAGAAGTGAATGAAATTTTTAAAGATCTTGCAGTTTTAGTCCATGAACAGGGAGCCATGATTGATGATATTGGATCCAACATAGAGGGCTCCCATGCTGCAACATCACAGGGAACAACTCAGCTGGTAAAAGCTTCAAAGACGCAAAGATCAAATTCATCACTGGCTTGCTTACTTTTGGTGATATTTGGTATTATCCTCCTGATTGTGATAATAATAGTTGTTGCTTAA 825 42.91 MSFQDIEAGRPFASSRRDLINGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSAKLKQASEIDHHAEVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYTPFVPQTVLPSSYTAGESDASSEKNLEQRALLVESRRQEVLLLDNEIAFNEAIIEEREQGIHEIQHQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIEGSHAATSQGTTQLVKASKTQRSNSSLACLLLVIFGIILLIVIIIVVA 274
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
14 8249458 8254178 - Cp4.1LG14g09830.1 Cpe14g00975 481359

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cpe14g00975 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
Cpe14g00975 274 Pfam Syntaxin-like protein 31 130 IPR006011 GO:0016020
Cpe14g00975 274 SMART tSNARE_6 176 243 IPR000727 -
Cpe14g00975 274 CDD SynN 24 158 IPR006011 GO:0016020
Cpe14g00975 274 Gene3D - 21 134 - -
Cpe14g00975 274 CDD SNARE_Qa 184 242 - -
Cpe14g00975 274 Pfam SNARE domain 218 269 IPR000727 -
Cpe14g00975 274 SMART SynN_4 16 128 IPR006011 GO:0016020
Cpe14g00975 274 Gene3D - 174 274 - -
Cpe14g00975 274 PANTHER SYNTAXIN 5 272 IPR045242 -
Cpe14g00975 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020|GO:0016192
Cpe14g00975 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484|GO:0006886|GO:0016020
Cpe14g00975 274 PANTHER SYNTAXIN OF PLANTS PROTEIN 5 272 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cpe14g00975 - - K08488 bhj:120089793 474.937
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cpe11g00890 Cpe-Chr11:7181930 Cpe14g00975 Cpe-Chr14:8249458 4.54E-11 dispersed
Cpe14g00975 Cpe-Chr14:8249458 Cpe08g00962 Cpe-Chr8:7547582 1.63E-09 dispersed
Cpe14g00975 Cpe-Chr14:8249458 Cpe08g00870 Cpe-Chr8:6869032 0 wgd
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cpe11g00567 . 8 340 SNARE and Associated Proteins AT3G24350 65.4 2.4e-103 372.9
Cpe07g00260 . 31 377 SNARE and Associated Proteins AT3G24350 60.2 2.1e-91 333.2
Cpe19g00189 . 1 308 SNARE and Associated Proteins AT1G08560 68.5 6.5e-102 367.9
Cpe10g01038 CST 1 312 SNARE and Associated Proteins AT1G08560 68.0 6.3e-97 351.3
Cpe10g00620 . 10 311 SNARE and Associated Proteins AT2G18260 53.6 1.8e-83 306.6
Cpe03g00316 . 19 279 SNARE and Associated Proteins AT3G11820 81.6 2.1e-116 416.0
Cpe08g00962 CST 19 279 SNARE and Associated Proteins AT3G11820 77.4 1.0e-110 397.1
Cpe19g00503 . 21 278 SNARE and Associated Proteins AT3G11820 70.2 4.0e-99 358.6
Cpe20g00409 . 31 281 SNARE and Associated Proteins AT3G11820 66.1 1.8e-91 333.2
Cpe03g00938 . 27 285 SNARE and Associated Proteins AT3G11820 52.1 5.6e-69 258.5
Cpe03g00316 . 1 279 SNARE and Associated Proteins AT3G52400 64.3 6.1e-93 338.2
Cpe08g00962 CST 1 279 SNARE and Associated Proteins AT3G52400 61.5 5.9e-88 321.6
Cpe19g00503 . 1 277 SNARE and Associated Proteins AT3G52400 59.4 1.4e-84 310.5
Cpe20g00409 . 1 281 SNARE and Associated Proteins AT3G52400 56.5 2.4e-81 299.7
Cpe20g00409 . 1 299 SNARE and Associated Proteins AT4G03330 67.5 1.1e-106 383.6
Cpe03g00316 . 1 279 SNARE and Associated Proteins AT4G03330 57.5 1.9e-82 303.1
Cpe08g00962 CST 1 284 SNARE and Associated Proteins AT4G03330 56.6 9.6e-82 300.8
Cpe19g00503 . 1 278 SNARE and Associated Proteins AT4G03330 52.8 3.9e-75 278.9
Cpe03g00938 . 1 285 SNARE and Associated Proteins AT4G03330 52.3 1.4e-69 260.4
Cpe20g00409 . 1 303 SNARE and Associated Proteins AT1G61290 76.9 1.8e-125 446.0
Cpe08g00962 CST 1 294 SNARE and Associated Proteins AT1G61290 59.8 2.3e-91 332.8
Cpe03g00316 . 1 279 SNARE and Associated Proteins AT1G61290 61.9 4.3e-90 328.6
Cpe19g00503 . 1 296 SNARE and Associated Proteins AT1G61290 54.9 2.8e-81 299.3
Cpe09g00868 . 1 220 SNARE and Associated Proteins AT1G61290 56.1 7.6e-79 291.2
Cpe20g00409 . 1 303 SNARE and Associated Proteins AT1G11250 76.2 1.1e-122 436.8
Cpe08g00962 CST 1 294 SNARE and Associated Proteins AT1G11250 60.2 6.3e-94 341.3
Cpe03g00316 . 1 279 SNARE and Associated Proteins AT1G11250 62.7 2.4e-93 339.3
Cpe19g00503 . 1 291 SNARE and Associated Proteins AT1G11250 54.6 1.9e-82 303.1
Cpe09g00868 . 1 220 SNARE and Associated Proteins AT1G11250 56.4 9.1e-77 284.3
Cpe03g00938 . 1 285 SNARE and Associated Proteins AT1G11250 50.5 3.7e-70 262.3
Cpe03g00938 . 1 308 SNARE and Associated Proteins AT3G03800 74.0 1.9e-117 419.5
Cpe03g00938 . 1 203 SNARE and Associated Proteins AT5G08080 77.3 7.8e-81 297.4
Cpe16g00449 CST 2 149 SNARE and Associated Proteins AT5G08080 56.5 2.7e-41 166.0
Cpe08g00870 . 1 256 SNARE and Associated Proteins AT5G16830 59.9 9.4e-76 280.8
Cpe14g00975 . 1 256 SNARE and Associated Proteins AT5G16830 59.9 9.4e-76 280.8
Cpe08g00870 . 1 256 SNARE and Associated Proteins AT5G46860 66.8 2.5e-81 299.3
Cpe14g00975 . 1 256 SNARE and Associated Proteins AT5G46860 66.8 1.2e-80 297.0
Cpe08g00870 . 1 256 SNARE and Associated Proteins AT4G17730 61.3 2.8e-74 275.8
Cpe14g00975 . 1 256 SNARE and Associated Proteins AT4G17730 61.7 6.3e-74 274.6
Cpe14g00975 . 65 256 SNARE and Associated Proteins AT1G32270 60.9 4.7e-53 205.7
Cpe08g00870 . 65 256 SNARE and Associated Proteins AT1G32270 60.4 1.2e-51 201.1
Cpe01g01046 CCT 1 334 SNARE and Associated Proteins AT5G05760 66.0 5.8e-112 401.4
Cpe01g00138 CCT 1 321 SNARE and Associated Proteins AT5G05760 60.1 3.6e-98 355.5
Cpe11g00567 . 8 340 SNARE and Associated Proteins AT3G24350 65.4 2.4e-103 372.9
Cpe07g00260 . 31 377 SNARE and Associated Proteins AT3G24350 60.2 2.1e-91 333.2
Cpe07g00878 CST 1 327 SNARE and Associated Proteins AT5G26980 75.5 3.9e-126 448.4
Cpe11g00890 CST 1 328 SNARE and Associated Proteins AT5G26980 75.9 1.5e-125 446.4
Cpe12g00911 . 1 287 SNARE and Associated Proteins AT5G26980 64.4 3.3e-88 322.4
Cpe11g00890 CST 1 330 SNARE and Associated Proteins AT4G02195 64.0 2.0e-106 382.9
Cpe07g00878 CST 1 329 SNARE and Associated Proteins AT4G02195 62.8 3.0e-102 369.0
Cpe12g00911 . 1 287 SNARE and Associated Proteins AT4G02195 65.5 1.1e-91 334.0
Cpe11g00890 CST 1 329 SNARE and Associated Proteins AT3G05710 75.1 5.6e-128 454.5
Cpe07g00878 CST 1 328 SNARE and Associated Proteins AT3G05710 74.2 6.2e-127 451.1
Cpe12g00911 . 1 287 SNARE and Associated Proteins AT3G05710 62.0 4.1e-86 315.5
Cpe02g00792 CCT,CST 1 233 SNARE and Associated Proteins AT1G16240 73.8 1.0e-91 333.6
Cpe06g00787 CCT,CST 1 221 SNARE and Associated Proteins AT1G16240 67.0 3.8e-78 288.5
Cpe14g00748 CCT 3 144 SNARE and Associated Proteins AT1G16240 53.5 2.2e-41 166.4
Cpe02g00792 CCT,CST 1 233 SNARE and Associated Proteins AT1G79590 73.4 5.7e-91 331.3
Cpe06g00787 CCT,CST 1 221 SNARE and Associated Proteins AT1G79590 67.8 2.5e-78 289.3
Cpe14g00748 CCT 2 144 SNARE and Associated Proteins AT1G79590 52.4 1.7e-42 170.2
Cpe12g00037 . 110 296 SNARE and Associated Proteins AT1G28490 69.0 1.1e-62 236.9
Cpe03g00174 . 1 264 SNARE and Associated Proteins AT3G09740 77.4 6.6e-111 397.5
Cpe02g00841 . 1 261 SNARE and Associated Proteins AT3G09740 77.6 2.8e-109 392.1
Cpe05g00828 . 1 263 SNARE and Associated Proteins AT3G09740 67.2 3.4e-91 332.0
Cpe03g00174 . 1 264 SNARE and Associated Proteins AT3G45280 62.9 1.1e-86 317.0
Cpe02g00841 . 1 261 SNARE and Associated Proteins AT3G45280 64.0 1.5e-86 316.6
Cpe05g00828 . 1 263 SNARE and Associated Proteins AT3G45280 62.7 1.7e-82 303.1
Cpe02g00841 . 1 261 SNARE and Associated Proteins AT3G61450 69.3 2.2e-95 345.9
Cpe03g00174 . 1 261 SNARE and Associated Proteins AT3G61450 68.9 2.9e-95 345.5
Cpe05g00828 . 1 260 SNARE and Associated Proteins AT3G61450 59.7 4.5e-80 295.0
Cpe01g02531 CCT 122 366 SNARE and Associated Proteins AT1G51740 74.4 6.8e-94 340.9
Cpe13g01079 CCT 171 415 SNARE and Associated Proteins AT1G51740 73.2 4.4e-93 338.2
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Cpe14g00975 Cpe_Chr14 FPKM 12.124304 12.800138 0.0 0.0 0.0 0.0 0.056562 0.138665 0.0 0.141242