Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Cre06g0825 ATGAATATTAAGTCCGGAGCTTCGAGAAATTCAATCGGTTGGAATTTCGGCGTCCACGTCAGACGGTCGTTGCGCGCTCCCGCATCGGTCCCAACATCCATCGGTACGCCCCGTTGCCCTCTCCCTTCACTCCCAACCAGCATTCACCTCTTTCTTCCTCAGATCTACACTATCCATCGCCCTCACTCTCAGGTTTTCTTCTCCTCTTTCTCCTACATCACTTTCAGAATGATTTATTCTGTATTCACGGACATTCGGAACGCCGATTCTCGTTTCGTATCTCGTTCTTGTCCGTCTTTGTTTTGCATTAATCGATTAGCTCCAATTCTAGATCTGGCTTTTCAAGCATTGCAGTTGAAGATGCCATCGGCTCAAGATCCGTTCTATGTTGTAAAAGACGAGATTCAAGAATCTATTGATAAACTGCAATCCAGCTTTCACCAATGGGAAAGGATATCTTCTGATCCAGGAGAGAGAATACAACAAACAAAAGAGTTGCTTGCTTCTTGTGAAAGCATTGAATGGCAGGTGGACGAGTTGGACAAAGCTATTGCTGTGGCAGCTAGAGATCCATCTTGGTATGGCATTGATGATGCAGAACTTGAAAAACGAAGGAGATGGACGAGTACTGCTAGAACACAGGTTGGAAATGTTAAGAAAGTAGTAGGAGCTGGGAAGGAGCAAACGGGAACTGCTAGTGCAAGTGGGATGCGTCGAGAATTGATGAGACTACCTAATGCACATGAAACAGACAGATCAAACTTATATACAGCCAACCAAGCAAATGATGACTTCATCACATCCGAATCAGATAGACAGCTGCTTCTAATAAAGCAGCAGGACGAGGAGTTGGATGAGTTGAGTGCAAGCGTGGAGAGAATTGGAGGTGTTGGGCTTACAATACACGAAGAGCTCCTTGCACAGGATAAAATTATCGACGACCTAGGAATGGAAATGGACAGTACATCAAATCGTCTTGATTTTGTTCAGAAAAAAGTAGCAGTGGTCATGAAGAAGGCCAGCGCCAAGGGGCAGATAATGATGATATTGTTCTTGGTGGCTTTGTTCATCATCCTTTTTGTGTTGGTGTTCCTCACCTAG 1101 44.69 MNIKSGASRNSIGWNFGVHVRRSLRAPASVPTSIGTPRCPLPSLPTSIHLFLPQIYTIHRPHSQVFFSSFSYITFRMIYSVFTDIRNADSRFVSRSCPSLFCINRLAPILDLAFQALQLKMPSAQDPFYVVKDEIQESIDKLQSSFHQWERISSDPGERIQQTKELLASCESIEWQVDELDKAIAVAARDPSWYGIDDAELEKRRRWTSTARTQVGNVKKVVGAGKEQTGTASASGMRRELMRLPNAHETDRSNLYTANQANDDFITSESDRQLLLIKQQDEELDELSASVERIGGVGLTIHEELLAQDKIIDDLGMEMDSTSNRLDFVQKKVAVVMKKASAKGQIMMILFLVALFIILFVLVFLT 366
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
6 1572091 1578237 - CrPI670011_06g008250.1 Cre06g0825 500287

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Cre06g0825 366 Gene3D - 281 345 - -
Cre06g0825 366 Pfam SNARE domain 311 362 IPR000727 -
Cre06g0825 366 CDD SNARE_NTD_AtSYP61-like 125 222 - -
Cre06g0825 366 ProSitePatterns Syntaxin / epimorphin family signature. 280 319 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Cre06g0825 366 Pfam Syntaxin 6, N-terminal 126 219 IPR015260 GO:0016020(InterPro)|GO:0048193(InterPro)
Cre06g0825 366 SUPERFAMILY SNARE fusion complex 273 336 - -
Cre06g0825 366 CDD SNARE_Qc 277 334 - -
Cre06g0825 366 FunFam syntaxin-61 isoform X1 277 338 - -
Cre06g0825 366 SUPERFAMILY DNA repair protein MutS, domain III 43 159 IPR036187 -
Cre06g0825 366 SUPERFAMILY t-snare proteins 125 220 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Cre06g0825 366 FunFam Syntaxin 10 123 225 - -
Cre06g0825 366 PANTHER SYNTAXIN 128 353 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Cre06g0825 366 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 274 336 IPR000727 -
Cre06g0825 366 SMART tSNARE_6 269 336 IPR000727 -
Cre06g0825 366 Gene3D - 122 224 - -
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cre06g0825 K08500 - - csv:101212527 418.698
       

Dupl-types


Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cre06g0825 Cre-Chr6:1572091 Cre10g0700 Cre-Chr10:6707462 7.20E-06 transposed
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cre08g1226 . 8 363 SNARE and Associated Proteins AT3G24350 55.8 6.3e-87 318.2
Cre04g0696 . 1 309 SNARE and Associated Proteins AT1G08560 69.0 7.3e-100 360.9
Cre04g1576 . 557 859 SNARE and Associated Proteins AT2G18260 55.5 2.4e-87 319.3
Cre10g1939 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.7e-115 411.8
Cre04g1143 . 26 282 SNARE and Associated Proteins AT3G11820 73.2 2.5e-103 372.5
Cre03g0844 . 31 281 SNARE and Associated Proteins AT3G11820 66.5 2.0e-92 336.3
Cre10g1499 . 30 284 SNARE and Associated Proteins AT3G11820 52.9 4.0e-69 258.8
Cre10g1939 . 1 279 SNARE and Associated Proteins AT3G52400 63.9 6.2e-92 334.7
Cre04g1143 . 33 282 SNARE and Associated Proteins AT3G52400 65.2 6.6e-86 314.7
Cre03g0844 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 6.4e-81 298.1
Cre03g0844 . 1 299 SNARE and Associated Proteins AT4G03330 68.9 1.2e-107 386.7
Cre10g1939 . 1 284 SNARE and Associated Proteins AT4G03330 57.2 3.2e-84 308.9
Cre04g1143 . 1 297 SNARE and Associated Proteins AT4G03330 52.6 2.4e-79 292.7
Cre10g1499 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 1.3e-69 260.4
Cre03g0844 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 1.8e-127 452.6
Cre10g1939 . 1 284 SNARE and Associated Proteins AT1G61290 62.0 2.7e-91 332.4
Cre04g1143 . 1 297 SNARE and Associated Proteins AT1G61290 56.9 4.5e-86 315.1
Cre03g0844 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 3.1e-124 441.8
Cre10g1939 . 1 284 SNARE and Associated Proteins AT1G11250 62.0 1.7e-93 339.7
Cre04g1143 . 1 292 SNARE and Associated Proteins AT1G11250 57.5 3.1e-87 318.9
Cre10g1499 . 1 303 SNARE and Associated Proteins AT3G03800 74.3 1.0e-114 410.2
Cre02g1184 . 1 304 SNARE and Associated Proteins AT3G03800 54.8 6.1e-83 304.7
Cre10g1499 . 1 202 SNARE and Associated Proteins AT5G08080 79.3 3.2e-81 298.5
Cre02g1184 . 1 204 SNARE and Associated Proteins AT5G08080 59.3 8.8e-55 210.7
Cre10g0399 . 1 261 SNARE and Associated Proteins AT5G16830 59.6 2.7e-77 285.8
Cre10g0399 . 1 261 SNARE and Associated Proteins AT5G46860 66.7 3.5e-82 302.0
Cre10g0399 . 1 257 SNARE and Associated Proteins AT4G17730 60.7 1.7e-73 273.1
Cre10g0399 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 4.8e-52 202.2
Cre07g0761 . 84 419 SNARE and Associated Proteins AT5G05760 65.9 1.2e-111 400.2
Cre08g1226 . 8 363 SNARE and Associated Proteins AT3G24350 55.8 6.3e-87 318.2
Cre02g1836 . 1 327 SNARE and Associated Proteins AT5G26980 76.8 5.0e-128 454.5
Cre09g0524 . 1 317 SNARE and Associated Proteins AT5G26980 66.2 6.9e-101 364.4
Cre02g1836 . 1 329 SNARE and Associated Proteins AT4G02195 64.4 3.5e-105 378.6
Cre09g0524 . 1 317 SNARE and Associated Proteins AT4G02195 66.8 3.9e-104 375.2
Cre02g1836 . 1 328 SNARE and Associated Proteins AT3G05710 76.3 4.2e-130 461.5
Cre09g0524 . 1 317 SNARE and Associated Proteins AT3G05710 63.7 2.8e-97 352.4
Cre09g1057 . 92 324 SNARE and Associated Proteins AT1G16240 72.1 2.6e-89 325.5
Cre10g0700 . 979 1200 SNARE and Associated Proteins AT1G16240 68.9 9.7e-81 297.0
Cre09g1057 . 91 324 SNARE and Associated Proteins AT1G79590 71.4 4.2e-88 321.6
Cre10g0700 . 974 1200 SNARE and Associated Proteins AT1G79590 67.4 4.5e-82 301.6
Cre06g0825 . 176 366 SNARE and Associated Proteins AT1G28490 71.7 9.0e-67 250.4
Cre10g2153 . 51 314 SNARE and Associated Proteins AT3G09740 79.7 2.9e-113 405.2
Cre02g2412 . 1 265 SNARE and Associated Proteins AT3G09740 67.8 1.6e-95 346.3
Cre02g2412 . 1 265 SNARE and Associated Proteins AT3G45280 65.9 8.3e-92 334.0
Cre10g2153 . 51 314 SNARE and Associated Proteins AT3G45280 64.4 9.4e-88 320.5
Cre10g2153 . 51 311 SNARE and Associated Proteins AT3G61450 68.2 7.8e-95 344.0
Cre02g2412 . 1 262 SNARE and Associated Proteins AT3G61450 61.4 3.3e-85 312.0
Cre11g1122 . 65 309 SNARE and Associated Proteins AT1G51740 72.5 2.4e-90 328.9
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003549 2 1 2 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 5 4 0 44