Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Cre08g1226 ATGGCTGTCAAAACAGCTCAATCATTTAGAGATCGGACGCTGGAATTCCAGAACATAACAGAGAGGCTAAAGAAGTCTTTCTCATCTGGCACGGGACCAACTGGACCAAGTGCTGTTTCAAAATCAGAAGAGCAGCGCTCTTCTGTGGCTCTACAGTCTGAATTTAATAAGAGGGCTTCCAAGATTGGGTTAGGGATACACCAGACATCTCAGAAACTCTCAAAGTTGGCAAAATTGGCAAAGAGGACTTCAGTTTTTGATGACCCAACAATGGAAATTCAGGAGCTAACTGCTCTTATTAAGCAGGACATTACAACATTGAACTCTGCCGTTGTAGATCTTCAGCTTCTCTGCAACTCTAGAAATGAAAATGGAAACATATCCAGTGATACTACTAGTCATTCAACCACTGTGGTAGATGATCTTAAGAATCGACTGATGAGCACCACAAAAGAATTTAAAGAAGTTCTGACAATGCGAACAGAAAATTTGAAGGTTCATGAGAACAGAAGACAACTATTTTCTTCTACTGCTTCAAAGGAATCTACAAATCCTTTTGTTCGCCAGCGCCCATTAGCATCTAGGTCGGCTGCTGGTGCCCCAAGTGCACCCCCTCCTCCATGGGCCAAGGCGTCTACATCTTTTTCCAAAACATCTCCTGGGAAGCAGGTGGATGGGGAGGGTCAACCATTATTGCAGCAGCAACAGCAACAGCAACAGATGGTTCCCTTACAAGATACTTACATGCAGAGCAGAGCTGAAGCTCTTCAAAATGTAGAATCCACCATTCATGAATTGAGCAATATCTTCAACCAGCTGGCAACTCTGGTTTCTGAACAAGGAGAGATTGCTATCAGGCTGGACAATAGGCGTGCATGGACGCAACAGCCTGTTGGAACAGAACATGTCACTGTGAGTGCTGGCAAATGCCTGACTTATCGGTTGAATAATTTGGGCAATTTGTCAAATAGCTGGATCGATGAGAACATGGACGATACTCTCGCAAATGTGGAGGGAGCGCAGGGAGCTTTGCTCAAGTATCTAAGCAGTATATCATCAAACAGACGGAAGATCTGGATTCTAGTCAAGTATAATGTTGATAATGTGTCAGTTCGTGTTTATGCCTTCAACTTCTCTTCTAATTTTGGGAACGCATCGCTGAAGAACTCAAACGCATCAAATTACTACAGTTTGAAGAGCACTCTTTCTTTATCGGTCTCCAGAAGGATGGAATGCCTTAAATGA 1245 43.37 MAVKTAQSFRDRTLEFQNITERLKKSFSSGTGPTGPSAVSKSEEQRSSVALQSEFNKRASKIGLGIHQTSQKLSKLAKLAKRTSVFDDPTMEIQELTALIKQDITTLNSAVVDLQLLCNSRNENGNISSDTTSHSTTVVDDLKNRLMSTTKEFKEVLTMRTENLKVHENRRQLFSSTASKESTNPFVRQRPLASRSAAGAPSAPPPPWAKASTSFSKTSPGKQVDGEGQPLLQQQQQQQQMVPLQDTYMQSRAEALQNVESTIHELSNIFNQLATLVSEQGEIAIRLDNRRAWTQQPVGTEHVTVSAGKCLTYRLNNLGNLSNSWIDENMDDTLANVEGAQGALLKYLSSISSNRRKIWILVKYNVDNVSVRVYAFNFSSNFGNASLKNSNASNYYSLKSTLSLSVSRRMECLK 414
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
8 25485306 25490170 + CrPI670011_08g012260.1 Cre08g1226 506144

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Cre08g1226 414 MobiDBLite consensus disorder prediction 170 190 - -
Cre08g1226 414 SUPERFAMILY t-snare proteins 52 289 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Cre08g1226 414 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 246 289 IPR000727 -
Cre08g1226 414 SMART tSNARE_6 241 306 IPR000727 -
Cre08g1226 414 MobiDBLite consensus disorder prediction 24 46 - -
Cre08g1226 414 CDD SNARE_syntaxin5 249 363 - -
Cre08g1226 414 MobiDBLite consensus disorder prediction 209 242 - -
Cre08g1226 414 Pfam Syntaxin-5 N-terminal, Sly1p-binding domain 6 25 IPR021538 -
Cre08g1226 414 MobiDBLite consensus disorder prediction 168 242 - -
Cre08g1226 414 Gene3D - 50 296 - -
Cre08g1226 414 Pfam SNARE domain 326 362 IPR000727 -
Cre08g1226 414 PANTHER SYNTAXIN 54 361 IPR045242 GO:0000139(PANTHER)|GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006888(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Cre08g1226 K08490 - - csv:101203633 511.916
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Cre07g0761 Cre-Chr7:5780108 Cre08g1226 Cre-Chr8:25485306 1.40E-66 dispersed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Cre08g1226 . 8 363 SNARE and Associated Proteins AT3G24350 55.8 6.3e-87 318.2
Cre04g0696 . 1 309 SNARE and Associated Proteins AT1G08560 69.0 7.3e-100 360.9
Cre04g1576 . 557 859 SNARE and Associated Proteins AT2G18260 55.5 2.4e-87 319.3
Cre10g1939 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.7e-115 411.8
Cre04g1143 . 26 282 SNARE and Associated Proteins AT3G11820 73.2 2.5e-103 372.5
Cre03g0844 . 31 281 SNARE and Associated Proteins AT3G11820 66.5 2.0e-92 336.3
Cre10g1499 . 30 284 SNARE and Associated Proteins AT3G11820 52.9 4.0e-69 258.8
Cre10g1939 . 1 279 SNARE and Associated Proteins AT3G52400 63.9 6.2e-92 334.7
Cre04g1143 . 33 282 SNARE and Associated Proteins AT3G52400 65.2 6.6e-86 314.7
Cre03g0844 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 6.4e-81 298.1
Cre03g0844 . 1 299 SNARE and Associated Proteins AT4G03330 68.9 1.2e-107 386.7
Cre10g1939 . 1 284 SNARE and Associated Proteins AT4G03330 57.2 3.2e-84 308.9
Cre04g1143 . 1 297 SNARE and Associated Proteins AT4G03330 52.6 2.4e-79 292.7
Cre10g1499 . 1 284 SNARE and Associated Proteins AT4G03330 52.4 1.3e-69 260.4
Cre03g0844 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 1.8e-127 452.6
Cre10g1939 . 1 284 SNARE and Associated Proteins AT1G61290 62.0 2.7e-91 332.4
Cre04g1143 . 1 297 SNARE and Associated Proteins AT1G61290 56.9 4.5e-86 315.1
Cre03g0844 . 1 299 SNARE and Associated Proteins AT1G11250 78.3 3.1e-124 441.8
Cre10g1939 . 1 284 SNARE and Associated Proteins AT1G11250 62.0 1.7e-93 339.7
Cre04g1143 . 1 292 SNARE and Associated Proteins AT1G11250 57.5 3.1e-87 318.9
Cre10g1499 . 1 303 SNARE and Associated Proteins AT3G03800 74.3 1.0e-114 410.2
Cre02g1184 . 1 304 SNARE and Associated Proteins AT3G03800 54.8 6.1e-83 304.7
Cre10g1499 . 1 202 SNARE and Associated Proteins AT5G08080 79.3 3.2e-81 298.5
Cre02g1184 . 1 204 SNARE and Associated Proteins AT5G08080 59.3 8.8e-55 210.7
Cre10g0399 . 1 261 SNARE and Associated Proteins AT5G16830 59.6 2.7e-77 285.8
Cre10g0399 . 1 261 SNARE and Associated Proteins AT5G46860 66.7 3.5e-82 302.0
Cre10g0399 . 1 257 SNARE and Associated Proteins AT4G17730 60.7 1.7e-73 273.1
Cre10g0399 . 65 256 SNARE and Associated Proteins AT1G32270 59.9 4.8e-52 202.2
Cre07g0761 . 84 419 SNARE and Associated Proteins AT5G05760 65.9 1.2e-111 400.2
Cre08g1226 . 8 363 SNARE and Associated Proteins AT3G24350 55.8 6.3e-87 318.2
Cre02g1836 . 1 327 SNARE and Associated Proteins AT5G26980 76.8 5.0e-128 454.5
Cre09g0524 . 1 317 SNARE and Associated Proteins AT5G26980 66.2 6.9e-101 364.4
Cre02g1836 . 1 329 SNARE and Associated Proteins AT4G02195 64.4 3.5e-105 378.6
Cre09g0524 . 1 317 SNARE and Associated Proteins AT4G02195 66.8 3.9e-104 375.2
Cre02g1836 . 1 328 SNARE and Associated Proteins AT3G05710 76.3 4.2e-130 461.5
Cre09g0524 . 1 317 SNARE and Associated Proteins AT3G05710 63.7 2.8e-97 352.4
Cre09g1057 . 92 324 SNARE and Associated Proteins AT1G16240 72.1 2.6e-89 325.5
Cre10g0700 . 979 1200 SNARE and Associated Proteins AT1G16240 68.9 9.7e-81 297.0
Cre09g1057 . 91 324 SNARE and Associated Proteins AT1G79590 71.4 4.2e-88 321.6
Cre10g0700 . 974 1200 SNARE and Associated Proteins AT1G79590 67.4 4.5e-82 301.6
Cre06g0825 . 176 366 SNARE and Associated Proteins AT1G28490 71.7 9.0e-67 250.4
Cre10g2153 . 51 314 SNARE and Associated Proteins AT3G09740 79.7 2.9e-113 405.2
Cre02g2412 . 1 265 SNARE and Associated Proteins AT3G09740 67.8 1.6e-95 346.3
Cre02g2412 . 1 265 SNARE and Associated Proteins AT3G45280 65.9 8.3e-92 334.0
Cre10g2153 . 51 314 SNARE and Associated Proteins AT3G45280 64.4 9.4e-88 320.5
Cre10g2153 . 51 311 SNARE and Associated Proteins AT3G61450 68.2 7.8e-95 344.0
Cre02g2412 . 1 262 SNARE and Associated Proteins AT3G61450 61.4 3.3e-85 312.0
Cre11g1122 . 65 309 SNARE and Associated Proteins AT1G51740 72.5 2.4e-90 328.9
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0008511 1 1 1 0 1 1 2 1 1 0 1 1 1 1 1 1 1 2 1 1 0 1 1 1 1 1 1 6 1 2 35