Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Csa03g00149 ATGAGCTTTCAAGATATCGAGGCTGGTCGCCCCTTTGCTTCTTCGAGGAGAGACCTCATCAATGGCAAACAAGATCCTACGCAAGCTGTTGCTTCCGGTATATTTCAGATTAATACTGCTGTTGCTACGTTTCAAAGGCTTGTTAATACCTTAGGTACACCAAAGGATACGCCTGAGCTACGCGAGAAGCTGAGAAATTTCTGTTCGTCGAGAAGATCTGCATGGGAGATATACATGGTTTGGACTGGGCCATCTTGTCCTTGGGGGAAGGGTATCCTATTCCTACATTTCAATGCAGTTCCAGTTTCTAGAGCTCTAAGTGTTTGTCTCTCTGCAGTTTTGTTGGGAGCAGTATTGGAAGATAACAGAAACTATCTGAGATATTGTCAGTCCACTCGTTTGGTTTCTTCTAGTGGTTTGAAGCCTCTTGGGTTAAGAGATGAGAATAACGATGTAGGGAAGAAGTTGTTTGATTTCTTCTTGTGTACTCTTGGGGAAATACCACTTGGCTTTGAAAGGCACAAGACGAGGTTACATATTGGACAGTTGGTTAAAGACACCTCTGCTAAACTTAAACAAGCCAGTGATATAGATCATCATGCTGAAGTGAATGCCAGCAAGAAAATTGCAGATGCTAAACTTGCGAAAGATTTTCAAGCAGTGTTGAAAGAGTTTCAGAAGGCTCAACGACTTGCAGCCGAGAGGGAAACAGCATATTCACCTTTTGTTCCCCCAACTGTTCTACCTTCTAGCTACACAGCTTGGGAGGCAGATGCAAGCTCAGAAAAGAATCTCGAACAGCGTGCCCTTCTTGTGGAATCCAGGAGGCAAGAGGTCTTGCTGTTGGACAATGAAATAGCCTTCAATGAGGCAATAATTGAGGAAAGAGAGCAAGGCATTCATGAAATCCAGCAGCAAATTGGAGAAGTGAATGAAATTTTTAAAGATCTTGCAGTTCTAGTTCATGAACAGGGGGCCATGATTGATGATATTGGATCCAACATAGAGGGGGCACATGCTGCAACGTCACAGGGAACAACCCAGCTTGTAAAAGCTTCAAAGACACAAAGATCGAATTCATCTCTGTGCCTCTGTATTGCAAGTCCTGGGCTATTAGCGGACGGTACAAAGTCTTCATTTAGTTCTGATGTTCGCATTAGGATAGGAGGGCAAAAACTCATAGGAGGGTAG 1191 43.66 MSFQDIEAGRPFASSRRDLINGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLRNFCSSRRSAWEIYMVWTGPSCPWGKGILFLHFNAVPVSRALSVCLSAVLLGAVLEDNRNYLRYCQSTRLVSSSGLKPLGLRDENNDVGKKLFDFFLCTLGEIPLGFERHKTRLHIGQLVKDTSAKLKQASDIDHHAEVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYSPFVPPTVLPSSYTAWEADASSEKNLEQRALLVESRRQEVLLLDNEIAFNEAIIEEREQGIHEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIEGAHAATSQGTTQLVKASKTQRSNSSLCLCIASPGLLADGTKSSFSSDVRIRIGGQKLIGG* 397
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
3 1148834 1152437 + CsaV3_3G001490.1 Csa03g00149 521054

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Csa03g00149 396 Pfam SNARE domain 327 366 IPR000727 -
Csa03g00149 396 PANTHER SYNTAXIN 175 364 IPR045242 -
Csa03g00149 396 CDD SNARE_Qa 293 351 - -
Csa03g00149 396 Gene3D - 284 372 - -
Csa03g00149 396 Gene3D - 21 74 - -
Csa03g00149 396 Gene3D - 171 242 - -
Csa03g00149 396 SMART tSNARE_6 285 352 IPR000727 -
Csa03g00149 396 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 290 352 IPR000727 -
Csa03g00149 396 PANTHER SYNTAXIN 5 66 IPR045242 -
Csa03g00149 396 PANTHER SYNTAXIN OF PLANTS PROTEIN 175 364 - -
Csa03g00149 396 PANTHER SYNTAXIN OF PLANTS PROTEIN 5 66 - -
Csa03g00149 396 ProSitePatterns Syntaxin / epimorphin family signature. 296 335 IPR006012 GO:0005484|GO:0006886|GO:0016020
Csa03g00149 396 SUPERFAMILY t-snare proteins 173 345 IPR010989 GO:0016020|GO:0016192
Csa03g00149 396 Pfam Syntaxin-like protein 31 67 IPR006011 GO:0016020
Csa03g00149 396 Pfam Syntaxin-like protein 174 239 IPR006011 GO:0016020
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Csa03g00149 - - K08488 csv:101207682 338.576
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Csa03g00149 Csa-Chr3:1148834 Csa03g04004 Csa-Chr3:34985908 1.24E-09 dispersed
Csa03g00149 Csa-Chr3:1148834 Csa03g03501 Csa-Chr3:31360235 1.77E-09 transposed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Csa02g02340 . 479 810 SNARE and Associated Proteins AT3G24350 64.6 2.1e-102 369.4
Csa04g01137 . 1 310 SNARE and Associated Proteins AT1G08560 67.9 9.7e-101 363.6
Csa06g03248 . 1 303 SNARE and Associated Proteins AT2G18260 54.2 2.8e-84 308.9
Csa03g03501 . 22 279 SNARE and Associated Proteins AT3G11820 80.6 1.0e-113 406.8
Csa06g02729 . 25 284 SNARE and Associated Proteins AT3G11820 70.4 8.4e-100 360.5
Csa06g02728 . 25 284 SNARE and Associated Proteins AT3G11820 69.6 4.1e-99 358.2
Csa01g01182 . 26 281 SNARE and Associated Proteins AT3G11820 65.0 1.4e-91 333.2
Csa03g04004 . 26 285 SNARE and Associated Proteins AT3G11820 51.2 1.2e-66 250.4
Csa03g03501 . 31 279 SNARE and Associated Proteins AT3G52400 69.5 1.7e-90 329.7
Csa06g02729 . 19 284 SNARE and Associated Proteins AT3G52400 63.0 1.7e-85 313.2
Csa06g02728 . 36 284 SNARE and Associated Proteins AT3G52400 65.5 8.2e-85 310.8
Csa01g01182 . 1 281 SNARE and Associated Proteins AT3G52400 56.0 1.6e-80 296.6
Csa01g01182 . 1 299 SNARE and Associated Proteins AT4G03330 67.2 2.0e-106 382.5
Csa03g03501 . 1 278 SNARE and Associated Proteins AT4G03330 57.2 9.9e-82 300.4
Csa06g02728 . 1 295 SNARE and Associated Proteins AT4G03330 54.5 2.7e-79 292.4
Csa06g02729 . 1 302 SNARE and Associated Proteins AT4G03330 53.3 3.0e-78 288.9
Csa03g04004 . 1 285 SNARE and Associated Proteins AT4G03330 50.2 3.1e-67 252.3
Csa01g01182 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 2.0e-127 452.2
Csa03g03501 . 1 279 SNARE and Associated Proteins AT1G61290 62.3 1.7e-89 326.2
Csa06g02729 . 1 284 SNARE and Associated Proteins AT1G61290 57.7 1.7e-81 299.7
Csa06g02728 . 1 301 SNARE and Associated Proteins AT1G61290 54.8 8.4e-81 297.4
Csa01g01182 . 1 299 SNARE and Associated Proteins AT1G11250 77.9 3.5e-124 441.4
Csa03g03501 . 1 279 SNARE and Associated Proteins AT1G11250 62.4 3.0e-91 332.0
Csa06g02729 . 1 284 SNARE and Associated Proteins AT1G11250 56.3 3.9e-83 305.1
Csa06g02728 . 1 284 SNARE and Associated Proteins AT1G11250 56.0 8.8e-83 303.9
Csa03g04004 . 1 309 SNARE and Associated Proteins AT3G03800 72.8 4.4e-114 407.9
Csa02g02691 . 1 305 SNARE and Associated Proteins AT3G03800 54.1 7.6e-82 300.8
Csa03g04004 . 1 203 SNARE and Associated Proteins AT5G08080 75.9 3.2e-77 285.0
Csa02g02691 . 1 204 SNARE and Associated Proteins AT5G08080 58.8 4.2e-53 204.9
Csa03g00149 . 174 365 SNARE and Associated Proteins AT1G32270 60.1 2.7e-51 199.5
Csa05g00800 . 1 218 SNARE and Associated Proteins AT5G05760 59.0 1.8e-60 229.9
Csa02g02340 . 479 810 SNARE and Associated Proteins AT3G24350 64.6 2.1e-102 369.4
Csa02g00478 . 1 327 SNARE and Associated Proteins AT5G26980 75.8 1.5e-125 446.0
Csa07g01878 . 1 318 SNARE and Associated Proteins AT5G26980 66.8 1.3e-103 373.2
Csa07g01878 . 1 318 SNARE and Associated Proteins AT4G02195 66.8 5.2e-105 377.9
Csa02g00478 . 1 330 SNARE and Associated Proteins AT4G02195 63.9 3.7e-103 371.7
Csa02g00478 . 1 328 SNARE and Associated Proteins AT3G05710 74.2 7.1e-126 447.2
Csa07g01878 . 1 321 SNARE and Associated Proteins AT3G05710 64.0 1.1e-99 360.1
Csa07g01013 . 1 234 SNARE and Associated Proteins AT1G16240 73.1 8.9e-91 330.1
Csa03g00456 . 1 234 SNARE and Associated Proteins AT1G16240 66.2 1.2e-79 293.1
Csa07g01013 . 1 234 SNARE and Associated Proteins AT1G79590 72.6 6.6e-90 327.4
Csa03g00456 . 1 234 SNARE and Associated Proteins AT1G79590 67.1 1.9e-81 299.3
Csa06g00630 . 56 247 SNARE and Associated Proteins AT1G28490 71.9 1.7e-66 249.2
Csa03g03265 . 1 264 SNARE and Associated Proteins AT3G09740 78.6 4.7e-112 401.0
Csa03g02736 . 1 264 SNARE and Associated Proteins AT3G09740 78.2 4.0e-111 397.9
Csa06g01683 . 1 267 SNARE and Associated Proteins AT3G09740 67.3 4.0e-95 344.7
Csa06g01683 . 1 267 SNARE and Associated Proteins AT3G45280 66.2 7.8e-91 330.5
Csa03g02736 . 1 264 SNARE and Associated Proteins AT3G45280 65.2 4.8e-88 321.2
Csa03g03265 . 1 264 SNARE and Associated Proteins AT3G45280 64.8 1.1e-87 320.1
Csa03g03265 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.7e-95 344.0
Csa03g02736 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 2.0e-94 342.4
Csa06g01683 . 1 263 SNARE and Associated Proteins AT3G61450 61.0 2.2e-85 312.4
Csa06g00159 . 47 291 SNARE and Associated Proteins AT1G51740 73.7 1.3e-92 336.3
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Csa03g00149 Csa_Chr03 FPKM 4.729145 4.35895 0.886575 0.70414 2.477492 1.779418 1.882962 0.0 0.062324 0.0