Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Csa07g01878 ATGGCGACGAGGAATCGAACTGCACAGTTTAGAAGGCACAGGGATGCCGTGAAGAGCGTCCGTGCCCCTCTATCCTCTTCGGCAGCTGGTTCCAGTGGACCGGTTATTGAGATGGTGAGTTCGTCTCTTCTTCGTTCAAAGCGCTCTTCTTCTTATGCTCCTCTCAGCACTGAAGATCCAGGACCTTCGAGCAGCGATGCATTTATGGTGGGTCTACCTCCAGCTTGGGTGGATGATTCTGAAGAAATAACTGTTAATATACAGAAAATTCGAAGGAAGATGGCAGAGTTAGTTAAGGCTCATTCCAAAGCTTTAATGCCTTCTTTTGCTGATGGCGAAGAAGACGAGCATACGATTGAGGCACTTACGCTAGAGATTACTAATCTTTTGAAAACCTCAGAGAAGAGGTTGAAGAAAATTTCTAGTACAGGGTCTTCAGAGGATATTAACATCAGAAAAAATGTCCAGCGTTCTCTTGCTACAGAGCTTCAGAATCTTTCTATGGATCTTCGTAGAAGACAATCAATGTATTTGAAACGTCTACAGCAGCAAAAGGAGGGACATGATGGAATTGATTTGGAGATAAATTTGAATGGAAACCGAGCTCTCCAGGAGGATGACGGATATGATGAATTTGGAACAAATGAAAATCAAACGATGACATTAGATGGGAAGCACATTCAGGGAAGGGAGAAAGAGATTAAACAGGTTGTAAAATCCGTAAATGAGCTTGCCCAAATTATGAAGGATCTCTCAACCCTTGTCATAGACCAGGGTACCATTGTCGATAGAATTGACCACAATATTCAGAATGTTGCTGTTTCAGTTGAAGAGGGCTTGAAACAACTTCAAAAGGCAGAGAAGACACAGAAAAATGGAGGAATGGTGAAGTGTGCAACAGTGCTTGTTATTATGTGTTTCGTAATGCTGGTTCTTTTGATACTAAAGGAGATAATTATGTAA 963 41.95 MATRNRTAQFRRHRDAVKSVRAPLSSSAAGSSGPVIEMVSSSLLRSKRSSSYAPLSTEDPGPSSSDAFMVGLPPAWVDDSEEITVNIQKIRRKMAELVKAHSKALMPSFADGEEDEHTIEALTLEITNLLKTSEKRLKKISSTGSSEDINIRKNVQRSLATELQNLSMDLRRRQSMYLKRLQQQKEGHDGIDLEINLNGNRALQEDDGYDEFGTNENQTMTLDGKHIQGREKEIKQVVKSVNELAQIMKDLSTLVIDQGTIVDRIDHNIQNVAVSVEEGLKQLQKAEKTQKNGGMVKCATVLVIMCFVMLVLLILKEIIM* 321
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
7 18758684 18763013 + CsaV3_7G029670.1 Csa07g01878 537441

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Csa07g01878 320 PANTHER SYNTAXIN OF PLANTS PROTEIN 1 315 - -
Csa07g01878 320 CDD SNARE_syntaxin16 227 285 - -
Csa07g01878 320 SMART tSNARE_6 216 286 IPR000727 -
Csa07g01878 320 SMART SynN_4 67 182 IPR006011 GO:0016020
Csa07g01878 320 Pfam SNARE domain 260 312 IPR000727 -
Csa07g01878 320 Gene3D - 73 278 - -
Csa07g01878 320 SUPERFAMILY t-snare proteins 72 279 IPR010989 GO:0016020|GO:0016192
Csa07g01878 320 MobiDBLite consensus disorder prediction 1 33 - -
Csa07g01878 320 ProSitePatterns Syntaxin / epimorphin family signature. 230 269 IPR006012 GO:0005484|GO:0006886|GO:0016020
Csa07g01878 320 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 224 286 IPR000727 -
Csa07g01878 320 PANTHER SYNTAXIN 1 315 IPR045242 -
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Csa07g01878 K08489 STX16; syntaxin 16 - csv:101204192 598.971
       

Dupl-types


Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Csa02g00478 Csa-Chr2:3398835 Csa07g01878 Csa-Chr7:18758684 4.26E-140 dispersed
       

Deco-Alignment


Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi7g353 . . . . . . . . . Cmo17g01031 . . . . . . . Bhi09g00937 Tan06g0762 . . Hepe03g1868 . . Cla09g00505 Cam09g0545 Cec09g0536 Cco09g0532 Clacu09g0546 . Cre09g0524 Cone17ag0442 Cone20ag0971 . . Lsi02g02441 Csa07g01878 . Cme01g02227 . . . . . . . . . . . . Cma17g01060 . Car17g01008 . Cpe12g00911 . . . . . . . . . . . . . . . . Chy01g01727 .
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Csa02g02340 . 479 810 SNARE and Associated Proteins AT3G24350 64.6 2.1e-102 369.4
Csa04g01137 . 1 310 SNARE and Associated Proteins AT1G08560 67.9 9.7e-101 363.6
Csa06g03248 . 1 303 SNARE and Associated Proteins AT2G18260 54.2 2.8e-84 308.9
Csa03g03501 . 22 279 SNARE and Associated Proteins AT3G11820 80.6 1.0e-113 406.8
Csa06g02729 . 25 284 SNARE and Associated Proteins AT3G11820 70.4 8.4e-100 360.5
Csa06g02728 . 25 284 SNARE and Associated Proteins AT3G11820 69.6 4.1e-99 358.2
Csa01g01182 . 26 281 SNARE and Associated Proteins AT3G11820 65.0 1.4e-91 333.2
Csa03g04004 . 26 285 SNARE and Associated Proteins AT3G11820 51.2 1.2e-66 250.4
Csa03g03501 . 31 279 SNARE and Associated Proteins AT3G52400 69.5 1.7e-90 329.7
Csa06g02729 . 19 284 SNARE and Associated Proteins AT3G52400 63.0 1.7e-85 313.2
Csa06g02728 . 36 284 SNARE and Associated Proteins AT3G52400 65.5 8.2e-85 310.8
Csa01g01182 . 1 281 SNARE and Associated Proteins AT3G52400 56.0 1.6e-80 296.6
Csa01g01182 . 1 299 SNARE and Associated Proteins AT4G03330 67.2 2.0e-106 382.5
Csa03g03501 . 1 278 SNARE and Associated Proteins AT4G03330 57.2 9.9e-82 300.4
Csa06g02728 . 1 295 SNARE and Associated Proteins AT4G03330 54.5 2.7e-79 292.4
Csa06g02729 . 1 302 SNARE and Associated Proteins AT4G03330 53.3 3.0e-78 288.9
Csa03g04004 . 1 285 SNARE and Associated Proteins AT4G03330 50.2 3.1e-67 252.3
Csa01g01182 . 1 299 SNARE and Associated Proteins AT1G61290 79.3 2.0e-127 452.2
Csa03g03501 . 1 279 SNARE and Associated Proteins AT1G61290 62.3 1.7e-89 326.2
Csa06g02729 . 1 284 SNARE and Associated Proteins AT1G61290 57.7 1.7e-81 299.7
Csa06g02728 . 1 301 SNARE and Associated Proteins AT1G61290 54.8 8.4e-81 297.4
Csa01g01182 . 1 299 SNARE and Associated Proteins AT1G11250 77.9 3.5e-124 441.4
Csa03g03501 . 1 279 SNARE and Associated Proteins AT1G11250 62.4 3.0e-91 332.0
Csa06g02729 . 1 284 SNARE and Associated Proteins AT1G11250 56.3 3.9e-83 305.1
Csa06g02728 . 1 284 SNARE and Associated Proteins AT1G11250 56.0 8.8e-83 303.9
Csa03g04004 . 1 309 SNARE and Associated Proteins AT3G03800 72.8 4.4e-114 407.9
Csa02g02691 . 1 305 SNARE and Associated Proteins AT3G03800 54.1 7.6e-82 300.8
Csa03g04004 . 1 203 SNARE and Associated Proteins AT5G08080 75.9 3.2e-77 285.0
Csa02g02691 . 1 204 SNARE and Associated Proteins AT5G08080 58.8 4.2e-53 204.9
Csa03g00149 . 174 365 SNARE and Associated Proteins AT1G32270 60.1 2.7e-51 199.5
Csa05g00800 . 1 218 SNARE and Associated Proteins AT5G05760 59.0 1.8e-60 229.9
Csa02g02340 . 479 810 SNARE and Associated Proteins AT3G24350 64.6 2.1e-102 369.4
Csa02g00478 . 1 327 SNARE and Associated Proteins AT5G26980 75.8 1.5e-125 446.0
Csa07g01878 . 1 318 SNARE and Associated Proteins AT5G26980 66.8 1.3e-103 373.2
Csa07g01878 . 1 318 SNARE and Associated Proteins AT4G02195 66.8 5.2e-105 377.9
Csa02g00478 . 1 330 SNARE and Associated Proteins AT4G02195 63.9 3.7e-103 371.7
Csa02g00478 . 1 328 SNARE and Associated Proteins AT3G05710 74.2 7.1e-126 447.2
Csa07g01878 . 1 321 SNARE and Associated Proteins AT3G05710 64.0 1.1e-99 360.1
Csa07g01013 . 1 234 SNARE and Associated Proteins AT1G16240 73.1 8.9e-91 330.1
Csa03g00456 . 1 234 SNARE and Associated Proteins AT1G16240 66.2 1.2e-79 293.1
Csa07g01013 . 1 234 SNARE and Associated Proteins AT1G79590 72.6 6.6e-90 327.4
Csa03g00456 . 1 234 SNARE and Associated Proteins AT1G79590 67.1 1.9e-81 299.3
Csa06g00630 . 56 247 SNARE and Associated Proteins AT1G28490 71.9 1.7e-66 249.2
Csa03g03265 . 1 264 SNARE and Associated Proteins AT3G09740 78.6 4.7e-112 401.0
Csa03g02736 . 1 264 SNARE and Associated Proteins AT3G09740 78.2 4.0e-111 397.9
Csa06g01683 . 1 267 SNARE and Associated Proteins AT3G09740 67.3 4.0e-95 344.7
Csa06g01683 . 1 267 SNARE and Associated Proteins AT3G45280 66.2 7.8e-91 330.5
Csa03g02736 . 1 264 SNARE and Associated Proteins AT3G45280 65.2 4.8e-88 321.2
Csa03g03265 . 1 264 SNARE and Associated Proteins AT3G45280 64.8 1.1e-87 320.1
Csa03g03265 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 6.7e-95 344.0
Csa03g02736 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 2.0e-94 342.4
Csa06g01683 . 1 263 SNARE and Associated Proteins AT3G61450 61.0 2.2e-85 312.4
Csa06g00159 . 47 291 SNARE and Associated Proteins AT1G51740 73.7 1.3e-92 336.3
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0012598 0 2 0 0 0 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 1 1 1 1 2 2 0 29