Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
HCH2g0746 ATGAACGACTTGCTTACGGACTCGTTTGTTAGCGATGCTAAAGATCGGCCTTCGAGAGGGATCGATCTCGAGAAGGGAACACGAGTTCATCAAAGCATTGACATGGGAATGGAAGCTTTCAATAAGCAGATACAAGAGGTTGAGATACAAGTGGATAAGCTATCTGGGCTTCTTGTTAAATTGAAGGCTGCGAATGAGGAATCAAAGGCTGTAACAAAAGCATCAGAGATGAAAGTCGTCAAGAAGCGGATGGAGAAGGATATTGATGAAGTCGGGAAAATTGCTCGTAATGTCAAAGGGAAACTGGAAGCTATAAATAAGGATAACTTAACCAATAGGCAGAAGCCGGGATGCGAGAAGGGGACGGCCATCGACAGGGCAAGAATGAACATGACAAATGCCTTGACAAAAAAGTTCAAGGAACTGATGATAGAGTTTCAGATGCTTCGTCAAAGAATTCAAGACGAGTATCGAGAAGTCGTAGAAAGACGGGTCATTACAGTTACTGGTACCAAACCAGATGAGAAGATGATTGATCACCTCATAGAAACTGGAAACAGTGAGCAAATATTCCAGAATGCCTTTCAACATATGGGGCGAGGACAGGTCATCAGTACCGTGGAAGAAATTCAAGAACGACACGACGCAGTTAAGGAAATCGAGAGAAGGCTCTCCGAATTACATCAGATCTACATTGACATGGCAGTTCTAGTGGAGGCACAAGGGGAAATTTTGGATAACATTGAAAATCAGGTGACCAATGCAGTGGATCATGTTCGATTGGGGACAGATGCACTCAATACTGCAAAGAGCTTACAGAAGAAAAAAAGAAAATGTATGATGATTTCCATCTTACTGCTTCTGGTTATAGCAATCATAATCGTCCTCTCGGTTTTGAAGCCTTGGAAGAAGTAG 915 42.62 MNDLLTDSFVSDAKDRPSRGIDLEKGTRVHQSIDMGMEAFNKQIQEVEIQVDKLSGLLVKLKAANEESKAVTKASEMKVVKKRMEKDIDEVGKIARNVKGKLEAINKDNLTNRQKPGCEKGTAIDRARMNMTNALTKKFKELMIEFQMLRQRIQDEYREVVERRVITVTGTKPDEKMIDHLIETGNSEQIFQNAFQHMGRGQVISTVEEIQERHDAVKEIERRLSELHQIYIDMAVLVEAQGEILDNIENQVTNAVDHVRLGTDALNTAKSLQKKKRKCMMISILLLLVIAIIIVLSVLKPWKK 304
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
2 51142348 51145016 + evm.model.ptg000010l.758 HCH2g0746 539971

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
HCH2g0746 304 CDD SynN 37 194 IPR006011 GO:0016020(InterPro)
HCH2g0746 304 Gene3D - 197 300 - -
HCH2g0746 304 MobiDBLite consensus disorder prediction 1 21 - -
HCH2g0746 304 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 207 269 IPR000727 -
HCH2g0746 304 Gene3D - 37 165 - -
HCH2g0746 304 SMART tSNARE_6 202 269 IPR000727 -
HCH2g0746 304 Coils Coil 37 64 - -
HCH2g0746 304 Pfam SNARE domain 243 295 IPR000727 -
HCH2g0746 304 SUPERFAMILY t-snare proteins 34 260 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
HCH2g0746 304 SMART SynN_4 32 158 IPR006011 GO:0016020(InterPro)
HCH2g0746 304 PANTHER SYNTAXIN 39 289 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0005886(PANTHER)|GO:0006886(PANTHER)|GO:0006887(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
HCH2g0746 304 Pfam Syntaxin 40 242 IPR006011 GO:0016020(InterPro)
HCH2g0746 304 CDD SNARE_syntaxin1-like 206 268 - -
HCH2g0746 304 FunFam Syntaxin 132 200 300 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
HCH2g0746 K08486 - - csv:101214355 493.426
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
HCH2g0746 HCH-Chr2:51142348 HCH9g1403 HCH-Chr9:46347448 1.70E-86 dispersed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
HCH4g0394 . 8 339 SNARE and Associated Proteins AT3G24350 66.5 1.1e-103 373.6
HCH9g0881 . 1 308 SNARE and Associated Proteins AT1G08560 66.6 7.6e-106 380.6
HCH14g0577 . 1 304 SNARE and Associated Proteins AT2G18260 54.9 3.3e-85 312.0
HCH11g0485 . 19 279 SNARE and Associated Proteins AT3G11820 81.6 5.7e-117 417.5
HCH9g1199 . 27 282 SNARE and Associated Proteins AT3G11820 73.0 1.0e-102 370.2
HCH3g0609 . 21 280 SNARE and Associated Proteins AT3G11820 65.8 1.8e-94 342.8
HCH9g1403 . 31 285 SNARE and Associated Proteins AT3G11820 51.0 1.9e-67 253.1
HCH11g0485 . 1 279 SNARE and Associated Proteins AT3G52400 64.3 4.8e-93 338.2
HCH9g1199 . 1 282 SNARE and Associated Proteins AT3G52400 60.5 1.9e-86 316.2
HCH3g0609 . 1 280 SNARE and Associated Proteins AT3G52400 59.0 9.0e-84 307.4
HCH3g0609 . 1 295 SNARE and Associated Proteins AT4G03330 69.1 1.4e-107 386.3
HCH11g0485 . 1 279 SNARE and Associated Proteins AT4G03330 59.3 3.9e-86 315.1
HCH9g1199 . 1 288 SNARE and Associated Proteins AT4G03330 53.8 9.2e-80 293.9
HCH9g1403 . 1 290 SNARE and Associated Proteins AT4G03330 50.3 1.5e-69 260.0
HCH3g0609 . 1 304 SNARE and Associated Proteins AT1G61290 78.3 3.2e-125 444.9
HCH11g0485 . 1 279 SNARE and Associated Proteins AT1G61290 63.5 2.1e-92 335.9
HCH9g1199 . 1 298 SNARE and Associated Proteins AT1G61290 57.5 1.1e-85 313.5
HCH3g0609 . 1 304 SNARE and Associated Proteins AT1G11250 76.3 6.2e-121 430.6
HCH11g0485 . 1 279 SNARE and Associated Proteins AT1G11250 63.1 6.4e-94 340.9
HCH9g1199 . 1 288 SNARE and Associated Proteins AT1G11250 56.4 3.2e-85 312.0
HCH9g1403 . 1 308 SNARE and Associated Proteins AT3G03800 72.4 3.5e-119 424.9
HCH2g0746 . 1 304 SNARE and Associated Proteins AT3G03800 55.3 9.2e-80 293.9
HCH9g1403 . 1 203 SNARE and Associated Proteins AT5G08080 77.8 4.7e-81 297.7
HCH2g0746 . 1 203 SNARE and Associated Proteins AT5G08080 58.1 7.0e-53 204.1
HCH6g1130 . 1 256 SNARE and Associated Proteins AT5G16830 58.4 5.3e-74 274.6
HCH6g1130 . 1 256 SNARE and Associated Proteins AT5G46860 65.6 2.8e-80 295.4
HCH6g1130 . 1 256 SNARE and Associated Proteins AT4G17730 59.1 2.7e-72 268.9
HCH6g1130 . 65 256 SNARE and Associated Proteins AT1G32270 61.5 1.1e-52 204.1
HCH1g0387 . 1 340 SNARE and Associated Proteins AT5G05760 64.8 6.5e-111 397.5
HCH4g0394 . 8 339 SNARE and Associated Proteins AT3G24350 66.5 1.1e-103 373.6
HCH10g0899 . 1 325 SNARE and Associated Proteins AT5G26980 77.8 2.1e-130 462.2
HCH4g1049 . 1 320 SNARE and Associated Proteins AT5G26980 66.5 3.0e-105 378.6
HCH4g1049 . 1 320 SNARE and Associated Proteins AT4G02195 67.7 9.0e-110 393.7
HCH10g0899 . 1 327 SNARE and Associated Proteins AT4G02195 65.3 6.1e-106 380.9
HCH10g0899 . 1 326 SNARE and Associated Proteins AT3G05710 76.3 3.3e-131 464.9
HCH4g1049 . 1 320 SNARE and Associated Proteins AT3G05710 64.3 3.8e-103 371.7
HCH12g1219 . 1 233 SNARE and Associated Proteins AT1G16240 72.1 1.1e-88 323.2
HCH6g0844 . 41 270 SNARE and Associated Proteins AT1G16240 64.3 4.5e-79 291.2
HCH12g1219 . 1 233 SNARE and Associated Proteins AT1G79590 71.2 3.9e-87 318.2
HCH6g0844 . 40 270 SNARE and Associated Proteins AT1G79590 64.5 4.7e-80 294.7
HCH12g1197 . 54 244 SNARE and Associated Proteins AT1G28490 69.3 1.2e-64 243.0
HCH11g0272 . 1 264 SNARE and Associated Proteins AT3G09740 78.9 5.2e-111 397.5
HCH2g1168 . 1 265 SNARE and Associated Proteins AT3G09740 68.2 1.4e-95 346.3
HCH2g1168 . 1 265 SNARE and Associated Proteins AT3G45280 68.5 1.2e-94 343.2
HCH11g0272 . 1 264 SNARE and Associated Proteins AT3G45280 64.4 1.8e-87 319.3
HCH11g0272 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 3.9e-95 344.7
HCH2g1168 . 1 262 SNARE and Associated Proteins AT3G61450 59.5 1.8e-84 309.3
HCH13g0530 . 65 309 SNARE and Associated Proteins AT1G51740 74.0 1.5e-93 339.3
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0001189 1 6 1 1 1 2 3 2 2 2 2 2 3 2 3 3 2 4 3 2 3 1 2 3 3 2 3 8 3 2 77