Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
HCH4g0393 ATGGCATCACATCAAAACCGCCCTTCCCATTTTCCTCCCCTTGAAACCATGGAAAACCAGCCTGAAACCATTCCTCCGATAACCACATCCAGTTTTCCGGTCAAGATGATGCACAAAGTGAAGACCAATCTGGTTTTCCGGTCAAGATGGGCAGAGTTAAACGGGGCTATGGGGGACTTAGGAACTTATATTCCCATAGTCTTAGCCTTGACGCTATCCAAAAACCTCAACTTAGGCACAACATTGATCTTCACCGGAATCTACAACATCATCACCGGCCTCATCTACGGTGTTCCGATGCCGGTCCAACCGATGAAATCGATAGCTGCTGCAGCGCTAGCAGAAGCCGCTTTCGTCATACCAGAGATTATGGCAGCCGGAATCCTCACCGGAGGAATTCTTTTTGTGTTAGGCATCACGGGTTTGATGCACTTTGTTTATAAGTTCATTCCCTTATCAGTTGTTAGGGGAATTCAGCTAGCACAAGGGTTATCATTTGCATTAACGGCTGTTAAATATATTCGTTATGATCAAAATTTGGCCAAATCTAAGTCACTGGATTATAGGGAATGGTTTGGATTTGATGGGTTGGTTTTGGCTATTATTTGTGCTTGTTTTATAGTCATAGTTAATGGAGCAGGAGATGAGTTATCAGAGGCTGAAAATGACACAGAAAATTCAAAAGTGAGGAAATTCATAACGTCTCTTCCTTCAGCTTTCATTATTTTCATTCTGGGAGTCGTTTTTATCTTCGTACAAAAGCCGGGTTCGGTGAAAGATATAGAATTTGGGCCGTCTTCAATAAGCATCGTGAAGATGAATAAGATGCAATGGAAAGAAGGGTTTATTAAAGGGACAATTCCTCAGCTTCCTTTATCCATTTTGAACTCAGTGATAGCAGTTTCTAAGCTGTCGATGGATCTTTTTCCCGGGAAGGTTGTCTCCGTTACGTCTTTATCAGTCACGGTCGGGTTGATGAACATGGTCGGGTGCTGGTTCGGGGCAATTCCGACGTGCCATGGCGCGGGTGGATTGGCGGGGCAGTACAAGTTTGGTGGGAGGAGTGGTGGGTGTGTGGCGTTGCTTGGGGCGGCAAAGTTGGTGTTGGGCTTGGTGATGGGGAGCTCTTTGGTGAAGATTTTGAACTTGTTTCCTGTGGGGTTATTAGGGGTTTTGTTGCTATTTGCTGGCGTAGAGCTTGCTATGGCTGCCAGAGATATGAATACCAAAGAGGAGTATTTTGTTATGCTTGTTTGTGTAGGAGTCTCGCTTGTGGGCTCGAGCGCTGCGCTCGGGTTCTTGTGTGCGATGGTTGTGCATGTGCTGTTGTGGCTTAGAAAATGGGGCAACAAGAAGTCTTCTACTACTCCAGTCCATGTGGAAGAAAACGTTTAG 1395 45.45 MASHQNRPSHFPPLETMENQPETIPPITTSSFPVKMMHKVKTNLVFRSRWAELNGAMGDLGTYIPIVLALTLSKNLNLGTTLIFTGIYNIITGLIYGVPMPVQPMKSIAAAALAEAAFVIPEIMAAGILTGGILFVLGITGLMHFVYKFIPLSVVRGIQLAQGLSFALTAVKYIRYDQNLAKSKSLDYREWFGFDGLVLAIICACFIVIVNGAGDELSEAENDTENSKVRKFITSLPSAFIIFILGVVFIFVQKPGSVKDIEFGPSSISIVKMNKMQWKEGFIKGTIPQLPLSILNSVIAVSKLSMDLFPGKVVSVTSLSVTVGLMNMVGCWFGAIPTCHGAGGLAGQYKFGGRSGGCVALLGAAKLVLGLVMGSSLVKILNLFPVGLLGVLLLFAGVELAMAARDMNTKEEYFVMLVCVGVSLVGSSAALGFLCAMVVHVLLWLRKWGNKKSSTTPVHVEENV 464
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
4 2575487 2576881 - evm.model.ptg000015l.393 HCH4g0393 542637

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
HCH4g0393 464 PANTHER - 30 453 IPR031563 GO:0015098(InterPro)|GO:0015689(InterPro)
HCH4g0393 464 MobiDBLite consensus disorder prediction 1 22 - -
HCH4g0393 464 Pfam Molybdate transporter of MFS superfamily 51 166 IPR031563 GO:0015098(InterPro)|GO:0015689(InterPro)
HCH4g0393 464 Pfam Molybdate transporter of MFS superfamily 282 400 IPR031563 GO:0015098(InterPro)|GO:0015689(InterPro)
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
HCH4g0393 - - - - 0.0
       

Dupl-types


Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
HCH4g0393 HCH-Chr4:2575487 HCH4g1342 HCH-Chr4:9471576 1.50E-121 dispersed
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
HCH12g1259 . 24 340 Inorganic Solute Cotransporters AT5G59520 53.8 6.4e-93 337.8
HCH3g1378 . 1 214 Inorganic Solute Cotransporters AT5G59520 52.3 2.5e-57 219.5
HCH4g1677 . 23 649 Inorganic Solute Cotransporters AT4G02700 71.5 1.7e-264 908.7
HCH7g1247 . 10 638 Inorganic Solute Cotransporters AT4G02700 66.1 5.0e-245 844.0
HCH4g1371 . 32 648 Inorganic Solute Cotransporters AT4G02700 54.8 5.9e-193 671.0
HCH8g0768 . 1 627 Inorganic Solute Cotransporters AT4G02700 50.5 1.3e-187 653.3
HCH13g0077 . 24 656 Inorganic Solute Cotransporters AT4G02700 51.1 3.1e-186 648.7
HCH12g0771 . 36 653 Inorganic Solute Cotransporters AT4G02700 51.4 1.2e-185 646.7
HCH1g0037 . 16 638 Inorganic Solute Cotransporters AT4G02700 51.4 1.2e-182 636.7
HCH4g1880 . 29 641 Inorganic Solute Cotransporters AT4G02700 51.5 2.1e-174 609.4
HCH1g0037 . 147 636 Inorganic Solute Cotransporters AT1G23090 77.3 1.2e-214 742.7
HCH4g1371 . 164 652 Inorganic Solute Cotransporters AT1G23090 63.1 3.4e-172 601.7
HCH7g1247 . 139 625 Inorganic Solute Cotransporters AT1G23090 56.1 1.4e-154 543.1
HCH4g1677 . 152 638 Inorganic Solute Cotransporters AT1G23090 55.3 1.9e-151 532.7
HCH13g0077 . 162 655 Inorganic Solute Cotransporters AT1G23090 51.5 3.9e-136 481.9
HCH12g0771 . 165 656 Inorganic Solute Cotransporters AT1G23090 51.1 1.1e-135 480.3
HCH4g1371 . 1 656 Inorganic Solute Cotransporters AT3G15990 75.8 6.4e-280 959.9
HCH1g0037 . 15 640 Inorganic Solute Cotransporters AT3G15990 66.6 4.0e-234 807.7
HCH4g1677 . 23 637 Inorganic Solute Cotransporters AT3G15990 59.2 4.2e-207 718.0
HCH7g1247 . 10 634 Inorganic Solute Cotransporters AT3G15990 56.2 1.2e-201 699.9
HCH13g0077 . 19 654 Inorganic Solute Cotransporters AT3G15990 51.6 1.2e-185 646.7
HCH12g0771 . 16 654 Inorganic Solute Cotransporters AT3G15990 50.5 2.9e-184 642.1
HCH4g1880 . 26 645 Inorganic Solute Cotransporters AT3G15990 52.0 5.7e-180 627.9
HCH8g0768 . 2 624 Inorganic Solute Cotransporters AT5G19600 65.2 5.9e-238 820.5
HCH7g1247 . 20 636 Inorganic Solute Cotransporters AT5G19600 54.4 2.3e-194 675.6
HCH4g1677 . 30 649 Inorganic Solute Cotransporters AT5G19600 53.6 9.8e-193 670.2
HCH13g0445 . 7 655 Inorganic Solute Cotransporters AT5G13550 74.0 1.1e-277 952.6
HCH4g1371 . 1 656 Inorganic Solute Cotransporters AT3G15990 75.8 6.4e-280 959.9
HCH1g0037 . 15 640 Inorganic Solute Cotransporters AT3G15990 66.6 4.0e-234 807.7
HCH4g1677 . 23 637 Inorganic Solute Cotransporters AT3G15990 59.2 4.2e-207 718.0
HCH7g1247 . 10 634 Inorganic Solute Cotransporters AT3G15990 56.2 1.2e-201 699.9
HCH13g0077 . 19 654 Inorganic Solute Cotransporters AT3G15990 51.6 1.2e-185 646.7
HCH12g0771 . 16 654 Inorganic Solute Cotransporters AT3G15990 50.5 2.9e-184 642.1
HCH4g1880 . 26 645 Inorganic Solute Cotransporters AT3G15990 52.0 5.7e-180 627.9
HCH13g0077 . 34 659 Inorganic Solute Cotransporters AT4G08620 73.3 5.8e-265 910.2
HCH12g0771 . 29 657 Inorganic Solute Cotransporters AT4G08620 71.4 8.6e-261 896.3
HCH4g1880 . 29 645 Inorganic Solute Cotransporters AT4G08620 69.7 3.9e-245 844.3
HCH4g1677 . 24 640 Inorganic Solute Cotransporters AT4G08620 54.9 1.7e-200 696.0
HCH7g1247 . 11 627 Inorganic Solute Cotransporters AT4G08620 53.1 4.5e-193 671.4
HCH13g1260 . 41 660 Inorganic Solute Cotransporters AT4G08620 55.1 2.4e-186 649.0
HCH1g0037 . 19 642 Inorganic Solute Cotransporters AT4G08620 52.3 1.6e-185 646.4
HCH13g0076 . 87 681 Inorganic Solute Cotransporters AT4G08620 55.5 5.0e-184 641.3
HCH4g1371 . 35 653 Inorganic Solute Cotransporters AT4G08620 51.1 4.0e-181 631.7
HCH14g0099 . 25 639 Inorganic Solute Cotransporters AT4G08620 50.1 3.5e-161 565.5
HCH13g0076 . 29 670 Inorganic Solute Cotransporters AT1G77990 64.9 7.4e-231 797.0
HCH13g1260 . 31 658 Inorganic Solute Cotransporters AT1G77990 62.2 5.0e-219 757.7
HCH14g0099 . 21 635 Inorganic Solute Cotransporters AT1G77990 54.2 4.1e-181 631.7
HCH4g1880 . 30 644 Inorganic Solute Cotransporters AT1G77990 50.4 1.6e-169 593.2
HCH12g0771 . 80 650 Inorganic Solute Cotransporters AT1G77990 52.2 1.3e-166 583.6
HCH13g0077 . 141 587 Inorganic Solute Cotransporters AT1G78000 80.5 1.5e-198 689.1
HCH12g0771 . 144 588 Inorganic Solute Cotransporters AT1G78000 77.5 3.8e-194 674.5
HCH4g1880 . 136 579 Inorganic Solute Cotransporters AT1G78000 73.3 5.8e-179 624.0
HCH4g1677 . 131 578 Inorganic Solute Cotransporters AT1G78000 55.7 2.3e-143 505.8
HCH4g1371 . 143 586 Inorganic Solute Cotransporters AT1G78000 55.5 1.2e-139 493.4
HCH13g1260 . 148 600 Inorganic Solute Cotransporters AT1G78000 57.0 4.5e-139 491.5
HCH7g1247 . 118 561 Inorganic Solute Cotransporters AT1G78000 52.4 7.7e-139 490.7
HCH13g0076 . 161 612 Inorganic Solute Cotransporters AT1G78000 54.4 3.8e-138 488.4
HCH1g0037 . 126 569 Inorganic Solute Cotransporters AT1G78000 54.6 5.5e-137 484.6
HCH13g0445 . 13 539 Inorganic Solute Cotransporters AT3G12520 74.1 5.3e-224 773.9
HCH13g0077 . 28 659 Inorganic Solute Cotransporters AT1G22150 78.2 7.1e-287 983.0
HCH12g0771 . 18 660 Inorganic Solute Cotransporters AT1G22150 76.0 1.6e-286 981.9
HCH4g1880 . 1 647 Inorganic Solute Cotransporters AT1G22150 67.6 2.2e-248 855.1
HCH4g1677 . 17 643 Inorganic Solute Cotransporters AT1G22150 52.5 1.2e-196 683.3
HCH7g1247 . 10 627 Inorganic Solute Cotransporters AT1G22150 51.5 5.9e-193 671.0
HCH1g0037 . 7 642 Inorganic Solute Cotransporters AT1G22150 53.1 5.0e-192 667.9
HCH4g1371 . 33 652 Inorganic Solute Cotransporters AT1G22150 52.6 1.2e-188 656.8
HCH13g1260 . 41 660 Inorganic Solute Cotransporters AT1G22150 53.5 4.7e-182 634.8
HCH13g0076 . 91 677 Inorganic Solute Cotransporters AT1G22150 53.2 6.4e-179 624.4
HCH13g1260 . 12 665 Inorganic Solute Cotransporters AT5G10180 65.1 6.2e-246 847.0
HCH13g0076 . 4 672 Inorganic Solute Cotransporters AT5G10180 61.6 5.1e-232 800.8
HCH14g0099 . 21 637 Inorganic Solute Cotransporters AT5G10180 58.7 2.0e-204 709.1
HCH13g0077 . 46 652 Inorganic Solute Cotransporters AT5G10180 55.5 2.7e-180 629.0
HCH12g0771 . 49 653 Inorganic Solute Cotransporters AT5G10180 53.9 6.2e-177 617.8
HCH4g1677 . 29 639 Inorganic Solute Cotransporters AT5G10180 51.3 6.2e-169 591.3
HCH4g1880 . 39 641 Inorganic Solute Cotransporters AT5G10180 52.5 2.3e-168 589.3
HCH4g1342 . 24 435 Inorganic Solute Cotransporters AT1G80310 71.5 2.3e-162 568.9
HCH4g0393 . 51 446 Inorganic Solute Cotransporters AT1G80310 55.5 3.3e-121 432.2
HCH4g0393 . 36 457 Inorganic Solute Cotransporters AT2G25680 66.5 2.0e-155 545.8
HCH4g1342 . 29 429 Inorganic Solute Cotransporters AT2G25680 58.2 1.5e-121 433.3
HCH6g0290 . 7 546 Inorganic Solute Cotransporters AT1G80830 75.8 4.3e-226 780.8
HCH13g0148 . 49 508 Inorganic Solute Cotransporters AT1G80830 64.1 5.0e-166 581.3
HCH11g0756 . 6 462 Inorganic Solute Cotransporters AT1G80830 55.8 2.9e-145 512.3
HCH6g0290 . 5 541 Inorganic Solute Cotransporters AT1G15960 75.0 7.1e-221 763.5
HCH13g0148 . 49 505 Inorganic Solute Cotransporters AT1G15960 64.6 5.5e-165 577.8
HCH11g0756 . 4 494 Inorganic Solute Cotransporters AT1G15960 54.2 2.8e-145 512.3
HCH2g0004 . 20 495 Inorganic Solute Cotransporters AT2G23150 74.8 6.2e-206 713.8
HCH2g0004 . 21 489 Inorganic Solute Cotransporters AT1G47240 73.2 2.9e-198 688.3
HCH2g0004 . 20 495 Inorganic Solute Cotransporters AT5G67330 76.4 7.1e-210 726.9
HCH2g0004 . 45 498 Inorganic Solute Cotransporters AT4G18790 66.2 3.0e-171 598.6
HCH3g1217 . 7 532 Inorganic Solute Cotransporters AT3G45060 71.9 1.1e-224 776.2
HCH3g1219 . 7 532 Inorganic Solute Cotransporters AT3G45060 71.5 2.7e-223 771.5
HCH1g1052 . 11 491 Inorganic Solute Cotransporters AT3G45060 59.3 3.2e-168 588.6
HCH4g0040 . 10 499 Inorganic Solute Cotransporters AT3G45060 58.0 4.8e-164 574.7
HCH3g1217 . 5 532 Inorganic Solute Cotransporters AT1G08090 78.8 2.1e-249 858.2
HCH3g1219 . 5 532 Inorganic Solute Cotransporters AT1G08090 78.2 6.8e-248 853.2
HCH1g1052 . 14 497 Inorganic Solute Cotransporters AT1G08090 57.4 2.8e-169 592.0
HCH4g0040 . 16 499 Inorganic Solute Cotransporters AT1G08090 57.8 5.9e-167 584.3
HCH3g1217 . 10 518 Inorganic Solute Cotransporters AT1G08100 75.2 1.3e-230 795.8
HCH3g1219 . 10 518 Inorganic Solute Cotransporters AT1G08100 75.2 1.1e-229 792.7
HCH1g1052 . 1 501 Inorganic Solute Cotransporters AT1G08100 56.3 3.9e-171 598.2
HCH4g0040 . 2 490 Inorganic Solute Cotransporters AT1G08100 56.6 8.1e-169 590.5
HCH4g0040 . 18 473 Inorganic Solute Cotransporters AT5G14570 53.5 4.4e-140 495.0
HCH1g1052 . 16 472 Inorganic Solute Cotransporters AT5G14570 51.9 3.3e-135 478.8
HCH4g0040 . 3 494 Inorganic Solute Cotransporters AT1G12940 71.7 2.9e-208 721.5
HCH1g1052 . 1 489 Inorganic Solute Cotransporters AT1G12940 72.1 3.8e-208 721.1
HCH3g1219 . 35 522 Inorganic Solute Cotransporters AT1G12940 58.4 4.0e-165 578.2
HCH3g1217 . 35 522 Inorganic Solute Cotransporters AT1G12940 58.2 1.5e-164 576.2
HCH3g1217 . 4 532 Inorganic Solute Cotransporters AT5G60770 79.6 1.5e-250 862.1
HCH3g1219 . 4 532 Inorganic Solute Cotransporters AT5G60770 79.2 3.6e-249 857.4
HCH1g1052 . 14 491 Inorganic Solute Cotransporters AT5G60770 57.4 2.0e-167 585.9
HCH4g0040 . 9 499 Inorganic Solute Cotransporters AT5G60770 56.7 1.3e-166 583.2
HCH3g1219 . 7 532 Inorganic Solute Cotransporters AT5G60780 72.7 7.2e-229 790.0
HCH3g1217 . 7 532 Inorganic Solute Cotransporters AT5G60780 72.7 9.4e-229 789.6
HCH1g1052 . 9 505 Inorganic Solute Cotransporters AT5G60780 56.9 2.4e-168 589.0
HCH4g0040 . 10 499 Inorganic Solute Cotransporters AT5G60780 57.0 1.2e-162 570.1
HCH3g0923 . 9 349 Inorganic Solute Cotransporters AT4G19680 61.7 1.1e-108 390.2
HCH10g1208 . 43 347 Inorganic Solute Cotransporters AT4G19680 53.2 7.1e-84 307.8
HCH10g1216 . 45 349 Inorganic Solute Cotransporters AT4G19680 53.5 1.6e-83 306.6
HCH3g0923 . 2 349 Inorganic Solute Cotransporters AT4G19690 66.7 2.3e-119 425.6
HCH10g1216 . 45 349 Inorganic Solute Cotransporters AT4G19690 57.2 5.0e-90 328.2
HCH10g1208 . 43 347 Inorganic Solute Cotransporters AT4G19690 56.5 6.5e-90 327.8
HCH7g0020 . 2 259 Inorganic Solute Cotransporters AT1G05300 52.7 1.3e-58 223.4
HCH12g0935 . 24 259 Inorganic Solute Cotransporters AT1G05300 55.9 8.1e-56 214.2
HCH12g0935 . 1 360 Inorganic Solute Cotransporters AT5G62160 51.4 1.2e-83 307.0
HCH2g1008 . 1 338 Inorganic Solute Cotransporters AT2G30080 68.6 5.2e-124 441.0
HCH4g0535 . 25 392 Inorganic Solute Cotransporters AT1G60960 66.8 3.7e-132 468.4
HCH12g0935 . 10 360 Inorganic Solute Cotransporters AT2G32270 53.2 4.7e-93 338.2
HCH7g0020 . 24 360 Inorganic Solute Cotransporters AT2G32270 53.1 4.4e-91 331.6
HCH10g1208 . 45 347 Inorganic Solute Cotransporters AT2G32270 51.8 4.6e-80 295.0
HCH10g1216 . 47 349 Inorganic Solute Cotransporters AT2G32270 51.8 7.8e-80 294.3
HCH4g0535 . 27 392 Inorganic Solute Cotransporters AT1G10970 66.8 2.3e-125 445.7
HCH4g0535 . 13 392 Inorganic Solute Cotransporters AT4G33020 60.2 7.1e-109 391.0
HCH7g0020 . 8 360 Inorganic Solute Cotransporters AT3G12750 61.6 5.4e-108 387.9
HCH12g0935 . 11 360 Inorganic Solute Cotransporters AT3G12750 50.3 8.2e-88 320.9
HCH10g1208 . 45 347 Inorganic Solute Cotransporters AT3G12750 51.9 1.1e-81 300.4
HCH10g1216 . 47 349 Inorganic Solute Cotransporters AT3G12750 51.3 4.8e-80 295.0
HCH3g0923 . 14 349 Inorganic Solute Cotransporters AT1G31260 67.5 7.0e-119 424.1
HCH10g1216 . 45 349 Inorganic Solute Cotransporters AT1G31260 55.2 8.1e-91 330.9
HCH10g1208 . 43 347 Inorganic Solute Cotransporters AT1G31260 54.5 2.0e-89 326.2
HCH3g0502 . 215 792 Inorganic Solute Cotransporters AT4G19960 68.4 7.6e-232 800.0
HCH3g0501 . 230 830 Inorganic Solute Cotransporters AT4G19960 59.4 5.9e-200 694.1
HCH5g1145 . 15 813 Inorganic Solute Cotransporters AT4G13420 64.5 9.0e-281 963.0
HCH4g0999 . 2 766 Inorganic Solute Cotransporters AT4G13420 54.0 1.9e-225 779.2
HCH4g0998 . 29 756 Inorganic Solute Cotransporters AT4G13420 53.8 2.7e-224 775.4
HCH3g1457 . 123 761 Inorganic Solute Cotransporters AT2G30070 66.5 1.2e-240 829.3
HCH9g0012 . 120 783 Inorganic Solute Cotransporters AT2G30070 51.4 2.0e-195 679.1
HCH9g0158 . 117 779 Inorganic Solute Cotransporters AT2G30070 50.6 4.1e-185 644.8
HCH13g0807 . 116 779 Inorganic Solute Cotransporters AT2G30070 51.2 5.4e-185 644.4
HCH4g0006 . 124 776 Inorganic Solute Cotransporters AT2G30070 50.5 1.0e-183 640.2
HCH4g0007 . 6 839 Inorganic Solute Cotransporters AT1G60160 75.5 0.0e+00 1207.6
HCH11g0989 . 4 840 Inorganic Solute Cotransporters AT1G60160 56.2 2.5e-257 885.2
HCH9g0012 . 2 783 Inorganic Solute Cotransporters AT3G02050 78.2 0.0e+00 1215.7
HCH9g0158 . 21 779 Inorganic Solute Cotransporters AT3G02050 55.9 2.7e-240 828.6
HCH13g0807 . 22 779 Inorganic Solute Cotransporters AT3G02050 55.8 1.4e-236 816.2
HCH3g1457 . 25 761 Inorganic Solute Cotransporters AT3G02050 53.1 6.4e-234 807.4
HCH1g1017 . 4 786 Inorganic Solute Cotransporters AT3G02050 52.9 1.9e-233 805.8
HCH4g0006 . 4 776 Inorganic Solute Cotransporters AT3G02050 53.4 1.1e-230 796.6
HCH13g0589 . 10 793 Inorganic Solute Cotransporters AT3G02050 52.8 9.5e-230 793.5
HCH1g0295 . 16 791 Inorganic Solute Cotransporters AT3G02050 52.7 6.2e-229 790.8
HCH9g0158 . 1 779 Inorganic Solute Cotransporters AT5G14880 75.6 0.0e+00 1186.4
HCH13g0807 . 9 779 Inorganic Solute Cotransporters AT5G14880 73.8 0.0e+00 1139.8
HCH4g0006 . 1 776 Inorganic Solute Cotransporters AT5G14880 70.2 0.0e+00 1101.3
HCH1g1017 . 1 786 Inorganic Solute Cotransporters AT5G14880 69.5 0.0e+00 1093.2
HCH1g0295 . 1 791 Inorganic Solute Cotransporters AT5G14880 64.5 8.1e-290 993.0
HCH13g0589 . 10 793 Inorganic Solute Cotransporters AT5G14880 62.2 2.5e-283 971.5
HCH9g0012 . 24 783 Inorganic Solute Cotransporters AT5G14880 57.2 4.7e-245 844.3
HCH3g1457 . 18 761 Inorganic Solute Cotransporters AT5G14880 52.1 4.7e-221 764.6
HCH9g0012 . 24 782 Inorganic Solute Cotransporters AT4G23640 60.2 2.4e-262 901.7
HCH1g0295 . 1 791 Inorganic Solute Cotransporters AT2G40540 80.2 0.0e+00 1268.4
HCH13g0589 . 12 793 Inorganic Solute Cotransporters AT2G40540 75.4 0.0e+00 1191.0
HCH9g0158 . 1 777 Inorganic Solute Cotransporters AT2G40540 63.1 1.0e-292 1002.7
HCH4g0006 . 1 776 Inorganic Solute Cotransporters AT2G40540 62.1 2.3e-284 974.9
HCH13g0807 . 11 779 Inorganic Solute Cotransporters AT2G40540 62.7 9.8e-283 969.5
HCH1g1017 . 1 786 Inorganic Solute Cotransporters AT2G40540 59.7 7.3e-278 953.4
HCH9g0012 . 24 783 Inorganic Solute Cotransporters AT2G40540 56.1 4.4e-243 837.8
HCH3g1457 . 19 761 Inorganic Solute Cotransporters AT2G40540 52.6 1.5e-230 796.2
HCH9g0158 . 13 779 Inorganic Solute Cotransporters AT1G70300 75.0 0.0e+00 1156.7
HCH4g0006 . 1 776 Inorganic Solute Cotransporters AT1G70300 73.6 0.0e+00 1144.8
HCH1g1017 . 1 786 Inorganic Solute Cotransporters AT1G70300 71.1 0.0e+00 1114.8
HCH13g0807 . 12 779 Inorganic Solute Cotransporters AT1G70300 72.2 0.0e+00 1113.2
HCH13g0589 . 1 793 Inorganic Solute Cotransporters AT1G70300 61.8 2.5e-278 954.9
HCH1g0295 . 1 791 Inorganic Solute Cotransporters AT1G70300 61.4 4.6e-277 950.7
HCH9g0012 . 24 783 Inorganic Solute Cotransporters AT1G70300 55.6 5.9e-240 827.4
HCH3g1457 . 8 761 Inorganic Solute Cotransporters AT1G70300 52.6 9.5e-230 793.5
HCH11g0989 . 14 840 Inorganic Solute Cotransporters AT5G09400 79.0 0.0e+00 1263.4
HCH4g0007 . 55 839 Inorganic Solute Cotransporters AT5G09400 57.1 2.1e-251 865.5
HCH3g0502 . 6 792 Inorganic Solute Cotransporters AT1G31120 77.4 0.0e+00 1210.7
HCH3g0501 . 6 830 Inorganic Solute Cotransporters AT1G31120 67.0 7.7e-312 1066.2
HCH3g0502 . 6 792 Inorganic Solute Cotransporters AT2G35060 79.4 0.0e+00 1223.0
HCH3g0501 . 9 830 Inorganic Solute Cotransporters AT2G35060 66.4 7.7e-312 1066.2
HCH11g0989 . 217 840 Inorganic Solute Cotransporters AT4G33530 75.6 1.7e-261 898.7
HCH4g0007 . 214 839 Inorganic Solute Cotransporters AT4G33530 56.7 1.3e-197 686.4
HCH12g1259 . 24 341 Inorganic Solute Cotransporters AT1G55910 61.5 5.4e-102 367.9
HCH3g1378 . 1 215 Inorganic Solute Cotransporters AT1G55910 58.6 6.9e-57 218.0
HCH12g1259 . 24 340 Inorganic Solute Cotransporters AT5G59520 53.8 6.4e-93 337.8
HCH3g1378 . 1 214 Inorganic Solute Cotransporters AT5G59520 52.3 2.5e-57 219.5
HCH3g0848 . 138 982 Inorganic Solute Cotransporters AT1G30450 84.9 0.0e+00 1457.6
HCH3g1401 . 33 382 Inorganic Solute Cotransporters AT2G29410 57.7 2.0e-92 336.3
HCH5g0615 . 2 414 Inorganic Solute Cotransporters AT2G46800 76.5 1.1e-141 500.0
HCH3g1401 . 9 382 Inorganic Solute Cotransporters AT2G46800 50.9 3.7e-81 298.9
HCH5g0615 . 29 414 Inorganic Solute Cotransporters AT3G61940 58.9 4.0e-113 404.8
HCH5g0615 . 7 415 Inorganic Solute Cotransporters AT3G58810 72.2 2.1e-140 495.7
HCH3g1401 . 26 382 Inorganic Solute Cotransporters AT3G58810 52.4 5.7e-82 301.6
HCH6g1444 . 6 497 Inorganic Solute Cotransporters AT4G13510 79.3 2.6e-220 761.5
HCH10g0668 . 4 505 Inorganic Solute Cotransporters AT4G13510 74.5 1.2e-206 716.1
HCH5g0137 . 4 482 Inorganic Solute Cotransporters AT4G13510 75.2 6.3e-203 703.7
HCH5g0137 . 3 480 Inorganic Solute Cotransporters AT4G28700 77.5 1.2e-212 736.1
HCH10g0668 . 4 482 Inorganic Solute Cotransporters AT4G28700 76.7 6.6e-208 720.3
HCH6g1444 . 6 493 Inorganic Solute Cotransporters AT4G28700 74.1 2.7e-201 698.4
HCH6g1444 . 3 482 Inorganic Solute Cotransporters AT3G24290 76.7 8.4e-208 719.9
HCH5g0137 . 3 480 Inorganic Solute Cotransporters AT3G24290 75.5 1.7e-200 695.7
HCH10g0668 . 4 481 Inorganic Solute Cotransporters AT3G24290 75.0 7.2e-199 690.3
HCH6g1444 . 3 497 Inorganic Solute Cotransporters AT3G24300 75.4 2.2e-211 731.9
HCH10g0668 . 4 506 Inorganic Solute Cotransporters AT3G24300 71.5 1.6e-198 689.1
HCH5g0137 . 3 480 Inorganic Solute Cotransporters AT3G24300 73.3 1.5e-196 682.6
HCH10g0668 . 3 494 Inorganic Solute Cotransporters AT1G64780 79.3 4.6e-217 750.7
HCH6g1444 . 2 494 Inorganic Solute Cotransporters AT1G64780 76.0 4.1e-205 711.1
HCH5g0137 . 6 480 Inorganic Solute Cotransporters AT1G64780 76.3 7.4e-199 690.3
HCH7g1608 . 246 1289 Inorganic Solute Cotransporters AT1G01790 71.0 0.0e+00 1268.1
HCH7g0787 . 1 721 Inorganic Solute Cotransporters AT4G04850 73.5 1.5e-283 972.2
HCH7g1608 . 196 1293 Inorganic Solute Cotransporters AT4G00630 71.5 0.0e+00 1334.3
HCH9g0720 . 36 191 Inorganic Solute Cotransporters AT2G37920 75.6 1.1e-65 246.9
HCH5g0093 . 1 518 Inorganic Solute Cotransporters AT3G54700 83.6 2.4e-256 881.3
HCH5g0092 . 1 518 Inorganic Solute Cotransporters AT3G54700 83.2 1.3e-254 875.5
HCH7g1330 . 1 506 Inorganic Solute Cotransporters AT3G54700 79.0 1.1e-242 835.9
HCH6g1501 . 4 519 Inorganic Solute Cotransporters AT3G54700 78.7 2.1e-241 831.6
HCH7g1329 . 4 519 Inorganic Solute Cotransporters AT3G54700 77.1 2.0e-239 825.1
HCH13g0115 . 1 519 Inorganic Solute Cotransporters AT3G54700 76.5 1.3e-238 822.4
HCH11g1286 . 3 501 Inorganic Solute Cotransporters AT3G54700 62.0 7.3e-181 630.6
HCH12g0032 . 3 503 Inorganic Solute Cotransporters AT3G54700 53.1 2.9e-145 512.3
HCH5g0093 . 1 519 Inorganic Solute Cotransporters AT2G38940 84.6 4.2e-261 897.1
HCH5g0092 . 1 519 Inorganic Solute Cotransporters AT2G38940 84.2 3.0e-259 891.0
HCH6g1501 . 4 519 Inorganic Solute Cotransporters AT2G38940 78.3 2.1e-244 841.6
HCH7g1329 . 3 532 Inorganic Solute Cotransporters AT2G38940 74.2 4.8e-241 830.5
HCH7g1330 . 1 529 Inorganic Solute Cotransporters AT2G38940 75.7 6.2e-241 830.1
HCH13g0115 . 1 531 Inorganic Solute Cotransporters AT2G38940 73.8 7.1e-237 816.6
HCH11g1286 . 3 500 Inorganic Solute Cotransporters AT2G38940 61.5 2.8e-180 628.6
HCH12g0032 . 3 503 Inorganic Solute Cotransporters AT2G38940 52.5 1.4e-144 510.0
HCH12g0032 . 3 501 Inorganic Solute Cotransporters AT1G76430 65.7 7.2e-189 657.1
HCH7g1330 . 4 507 Inorganic Solute Cotransporters AT5G43340 71.4 5.7e-215 743.8
HCH5g0093 . 3 518 Inorganic Solute Cotransporters AT5G43340 68.8 5.7e-207 717.2
HCH5g0092 . 3 518 Inorganic Solute Cotransporters AT5G43340 68.0 1.2e-204 709.5
HCH6g1501 . 4 520 Inorganic Solute Cotransporters AT5G43340 66.3 3.9e-200 694.5
HCH7g1329 . 3 518 Inorganic Solute Cotransporters AT5G43340 66.7 7.4e-199 690.3
HCH13g0115 . 1 518 Inorganic Solute Cotransporters AT5G43340 65.3 9.1e-197 683.3
HCH11g1286 . 4 500 Inorganic Solute Cotransporters AT5G43340 58.8 8.6e-171 597.0
HCH12g0032 . 5 503 Inorganic Solute Cotransporters AT5G43340 51.7 1.8e-136 483.0
HCH7g1329 . 3 522 Inorganic Solute Cotransporters AT5G43350 78.3 9.1e-245 842.8
HCH6g1501 . 4 518 Inorganic Solute Cotransporters AT5G43350 78.1 2.3e-240 828.2
HCH5g0092 . 1 518 Inorganic Solute Cotransporters AT5G43350 78.8 4.0e-240 827.4
HCH5g0093 . 1 518 Inorganic Solute Cotransporters AT5G43350 78.6 2.0e-239 825.1
HCH7g1330 . 1 505 Inorganic Solute Cotransporters AT5G43350 77.8 4.7e-233 803.9
HCH13g0115 . 1 520 Inorganic Solute Cotransporters AT5G43350 73.0 3.8e-227 784.3
HCH11g1286 . 3 500 Inorganic Solute Cotransporters AT5G43350 63.0 4.0e-184 641.3
HCH12g0032 . 3 503 Inorganic Solute Cotransporters AT5G43350 52.7 3.1e-144 508.8
HCH7g1329 . 3 518 Inorganic Solute Cotransporters AT5G43360 78.7 3.4e-244 840.9
HCH6g1501 . 4 518 Inorganic Solute Cotransporters AT5G43360 78.3 1.8e-240 828.6
HCH5g0092 . 1 518 Inorganic Solute Cotransporters AT5G43360 79.0 1.5e-239 825.5
HCH5g0093 . 1 518 Inorganic Solute Cotransporters AT5G43360 78.8 7.4e-239 823.2
HCH7g1330 . 1 505 Inorganic Solute Cotransporters AT5G43360 77.4 1.2e-233 805.8
HCH13g0115 . 1 518 Inorganic Solute Cotransporters AT5G43360 73.7 3.5e-228 787.7
HCH11g1286 . 3 500 Inorganic Solute Cotransporters AT5G43360 62.8 6.8e-184 640.6
HCH12g0032 . 3 503 Inorganic Solute Cotransporters AT5G43360 52.6 1.8e-144 509.6
HCH7g1329 . 3 522 Inorganic Solute Cotransporters AT5G43370 77.7 7.0e-245 843.2
HCH6g1501 . 4 518 Inorganic Solute Cotransporters AT5G43370 77.7 4.7e-241 830.5
HCH5g0092 . 1 518 Inorganic Solute Cotransporters AT5G43370 78.6 1.4e-240 828.9
HCH5g0093 . 1 518 Inorganic Solute Cotransporters AT5G43370 78.4 6.8e-240 826.6
HCH7g1330 . 1 505 Inorganic Solute Cotransporters AT5G43370 77.4 2.8e-233 804.7
HCH13g0115 . 1 520 Inorganic Solute Cotransporters AT5G43370 72.4 1.3e-227 785.8
HCH11g1286 . 3 500 Inorganic Solute Cotransporters AT5G43370 63.2 1.3e-185 646.4
HCH12g0032 . 3 503 Inorganic Solute Cotransporters AT5G43370 52.9 3.7e-145 511.9
HCH6g1501 . 7 523 Inorganic Solute Cotransporters AT2G32830 78.8 4.4e-242 833.9
HCH5g0093 . 1 537 Inorganic Solute Cotransporters AT2G32830 75.2 2.0e-239 825.1
HCH7g1329 . 6 519 Inorganic Solute Cotransporters AT2G32830 77.9 2.7e-239 824.7
HCH5g0092 . 1 524 Inorganic Solute Cotransporters AT2G32830 75.5 2.1e-236 815.1
HCH13g0115 . 1 516 Inorganic Solute Cotransporters AT2G32830 74.0 1.0e-230 796.2
HCH7g1330 . 1 529 Inorganic Solute Cotransporters AT2G32830 73.2 3.3e-229 791.2
HCH11g1286 . 5 501 Inorganic Solute Cotransporters AT2G32830 62.5 1.6e-180 629.4
HCH12g0032 . 4 503 Inorganic Solute Cotransporters AT2G32830 54.0 1.8e-147 519.6
HCH12g0032 . 1 501 Inorganic Solute Cotransporters AT1G20860 63.7 8.2e-178 620.5
HCH5g0093 . 6 512 Inorganic Solute Cotransporters AT1G20860 51.6 2.3e-135 479.6
HCH5g0092 . 6 512 Inorganic Solute Cotransporters AT1G20860 51.2 8.6e-135 477.6
HCH11g0064 . 132 491 Inorganic Solute Cotransporters AT2G38290 76.7 1.6e-160 562.4
HCH2g0316 . 131 464 Inorganic Solute Cotransporters AT2G38290 71.6 3.6e-144 508.1
HCH4g0415 . 119 458 Inorganic Solute Cotransporters AT2G38290 60.0 3.0e-114 408.7
HCH14g0689 . 112 456 Inorganic Solute Cotransporters AT2G38290 57.2 4.8e-112 401.4
HCH8g1086 . 38 489 Inorganic Solute Cotransporters AT4G10310 51.4 6.1e-121 431.4
HCH8g1087 . 38 489 Inorganic Solute Cotransporters AT4G10310 50.4 2.2e-118 422.9
HCH1g1072 . 34 581 Inorganic Solute Cotransporters AT3G26570 74.2 6.5e-215 743.8
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002045 4 2 3 3 2 2 2 3 2 2 2 2 1 2 2 2 2 3 2 2 2 2 2 2 2 2 2 2 2 2 65