Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
HCH6g1130 ATGAGCTTTCAAGATATCGAAGCTGGTCGGCCTTTTGGTTCTTCGAGGAGAGACCTAATTAATGGAAAACAAGATCCAACTCAAGCCGTTGCTTCTGGAATTTTTCAGATCAATACTGCTGTCGCCACTTTTCAGAGGCTCGTTAATACCTTAGGGACTCCGAAAGATACCCCTGAGCTACGTGAGAAGCTGCACAAGACCAGGTTGCATATTGGACAGTTGGTCAAGGACACCTCTTCTAAACTTAAACAAGCCAGTGAAATAGATCATCATGTTGAAGTTAATGCTAGCAAGAAGATTGCAGATGCTAAACTTGCAAAAGATTTTCAAGCAGTGTTGAAAGAATTTCAGAAGGCTCAACGACTTGCAGCTGAGAGGGAAACAGCGTATACACCTTTTATTCCCCAAGCTGCTCTTCCTTCTAGCTACACAACCAATGAGTTAGATGGCAACCCAGAGAGGAGTTTTGAACAGCGTGCCCTCCTTGTGGAATCCAGGAGACAAGAGGTCTTGCTTTTGGACAATGAAATATCCTTCAATGAAGCAATAATTGAGGAAAGAGAGCAAGGAATTCATGAAATTCAGCAGCAAATTGGAGAAGTGAATGAAATTTTTAAAGATCTTGCAGTTCTGGTTCATGAACAGGGAGCCATGATCGATGATATCGGGTCGAACATAGAGGGTGCTCATGCTGCAACATCACAGGGGACAACTCAGCTTGTAAAAGCTTCGAAGACACAGAAATCAAATTCATCTCTGGCCTGCTTACTTTTGGTGATATTTGGCATCATCCTTCTCATTGTGGTTATAATCGTTGTTGCGTAA 825 42.55 MSFQDIEAGRPFGSSRRDLINGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSSKLKQASEIDHHVEVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYTPFIPQAALPSSYTTNELDGNPERSFEQRALLVESRRQEVLLLDNEISFNEAIIEEREQGIHEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIEGAHAATSQGTTQLVKASKTQKSNSSLACLLLVIFGIILLIVVIIVVA 274
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
6 45882945 45886139 - evm.model.ptg000003l.662 HCH6g1130 546624

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
HCH6g1130 274 Gene3D - 174 274 - -
HCH6g1130 274 Pfam Syntaxin-like protein 30 130 IPR006011 GO:0016020(InterPro)
HCH6g1130 274 MobiDBLite consensus disorder prediction 1 23 - -
HCH6g1130 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
HCH6g1130 274 Pfam SNARE domain 218 269 IPR000727 -
HCH6g1130 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
HCH6g1130 274 FunFam Syntaxin-22 like 174 274 - -
HCH6g1130 274 SMART SynN_4 16 128 IPR006011 GO:0016020(InterPro)
HCH6g1130 274 Gene3D - 21 133 - -
HCH6g1130 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
HCH6g1130 274 CDD SynN 24 159 IPR006011 GO:0016020(InterPro)
HCH6g1130 274 PANTHER SYNTAXIN 36 263 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
HCH6g1130 274 SMART tSNARE_6 176 243 IPR000727 -
HCH6g1130 274 FunFam Syntaxin-22 like 21 134 - -
HCH6g1130 274 CDD SNARE_Qa 184 242 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
HCH6g1130 - - - - 0.0
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
HCH4g0394 . 8 339 SNARE and Associated Proteins AT3G24350 66.5 1.1e-103 373.6
HCH9g0881 . 1 308 SNARE and Associated Proteins AT1G08560 66.6 7.6e-106 380.6
HCH14g0577 . 1 304 SNARE and Associated Proteins AT2G18260 54.9 3.3e-85 312.0
HCH11g0485 . 19 279 SNARE and Associated Proteins AT3G11820 81.6 5.7e-117 417.5
HCH9g1199 . 27 282 SNARE and Associated Proteins AT3G11820 73.0 1.0e-102 370.2
HCH3g0609 . 21 280 SNARE and Associated Proteins AT3G11820 65.8 1.8e-94 342.8
HCH9g1403 . 31 285 SNARE and Associated Proteins AT3G11820 51.0 1.9e-67 253.1
HCH11g0485 . 1 279 SNARE and Associated Proteins AT3G52400 64.3 4.8e-93 338.2
HCH9g1199 . 1 282 SNARE and Associated Proteins AT3G52400 60.5 1.9e-86 316.2
HCH3g0609 . 1 280 SNARE and Associated Proteins AT3G52400 59.0 9.0e-84 307.4
HCH3g0609 . 1 295 SNARE and Associated Proteins AT4G03330 69.1 1.4e-107 386.3
HCH11g0485 . 1 279 SNARE and Associated Proteins AT4G03330 59.3 3.9e-86 315.1
HCH9g1199 . 1 288 SNARE and Associated Proteins AT4G03330 53.8 9.2e-80 293.9
HCH9g1403 . 1 290 SNARE and Associated Proteins AT4G03330 50.3 1.5e-69 260.0
HCH3g0609 . 1 304 SNARE and Associated Proteins AT1G61290 78.3 3.2e-125 444.9
HCH11g0485 . 1 279 SNARE and Associated Proteins AT1G61290 63.5 2.1e-92 335.9
HCH9g1199 . 1 298 SNARE and Associated Proteins AT1G61290 57.5 1.1e-85 313.5
HCH3g0609 . 1 304 SNARE and Associated Proteins AT1G11250 76.3 6.2e-121 430.6
HCH11g0485 . 1 279 SNARE and Associated Proteins AT1G11250 63.1 6.4e-94 340.9
HCH9g1199 . 1 288 SNARE and Associated Proteins AT1G11250 56.4 3.2e-85 312.0
HCH9g1403 . 1 308 SNARE and Associated Proteins AT3G03800 72.4 3.5e-119 424.9
HCH2g0746 . 1 304 SNARE and Associated Proteins AT3G03800 55.3 9.2e-80 293.9
HCH9g1403 . 1 203 SNARE and Associated Proteins AT5G08080 77.8 4.7e-81 297.7
HCH2g0746 . 1 203 SNARE and Associated Proteins AT5G08080 58.1 7.0e-53 204.1
HCH6g1130 . 1 256 SNARE and Associated Proteins AT5G16830 58.4 5.3e-74 274.6
HCH6g1130 . 1 256 SNARE and Associated Proteins AT5G46860 65.6 2.8e-80 295.4
HCH6g1130 . 1 256 SNARE and Associated Proteins AT4G17730 59.1 2.7e-72 268.9
HCH6g1130 . 65 256 SNARE and Associated Proteins AT1G32270 61.5 1.1e-52 204.1
HCH1g0387 . 1 340 SNARE and Associated Proteins AT5G05760 64.8 6.5e-111 397.5
HCH4g0394 . 8 339 SNARE and Associated Proteins AT3G24350 66.5 1.1e-103 373.6
HCH10g0899 . 1 325 SNARE and Associated Proteins AT5G26980 77.8 2.1e-130 462.2
HCH4g1049 . 1 320 SNARE and Associated Proteins AT5G26980 66.5 3.0e-105 378.6
HCH4g1049 . 1 320 SNARE and Associated Proteins AT4G02195 67.7 9.0e-110 393.7
HCH10g0899 . 1 327 SNARE and Associated Proteins AT4G02195 65.3 6.1e-106 380.9
HCH10g0899 . 1 326 SNARE and Associated Proteins AT3G05710 76.3 3.3e-131 464.9
HCH4g1049 . 1 320 SNARE and Associated Proteins AT3G05710 64.3 3.8e-103 371.7
HCH12g1219 . 1 233 SNARE and Associated Proteins AT1G16240 72.1 1.1e-88 323.2
HCH6g0844 . 41 270 SNARE and Associated Proteins AT1G16240 64.3 4.5e-79 291.2
HCH12g1219 . 1 233 SNARE and Associated Proteins AT1G79590 71.2 3.9e-87 318.2
HCH6g0844 . 40 270 SNARE and Associated Proteins AT1G79590 64.5 4.7e-80 294.7
HCH12g1197 . 54 244 SNARE and Associated Proteins AT1G28490 69.3 1.2e-64 243.0
HCH11g0272 . 1 264 SNARE and Associated Proteins AT3G09740 78.9 5.2e-111 397.5
HCH2g1168 . 1 265 SNARE and Associated Proteins AT3G09740 68.2 1.4e-95 346.3
HCH2g1168 . 1 265 SNARE and Associated Proteins AT3G45280 68.5 1.2e-94 343.2
HCH11g0272 . 1 264 SNARE and Associated Proteins AT3G45280 64.4 1.8e-87 319.3
HCH11g0272 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 3.9e-95 344.7
HCH2g1168 . 1 262 SNARE and Associated Proteins AT3G61450 59.5 1.8e-84 309.3
HCH13g0530 . 65 309 SNARE and Associated Proteins AT1G51740 74.0 1.5e-93 339.3
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45