Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
HCH9g1403 ATGAACGATCTTCTTTCGGATTCCTTTGAGATCCCCCGGGGTCAGCCTTCTAGAGGAGGAGACATTGAGCTAGGAACACATGCTCCTATGAATGCAGGAGATATGGGCATGGAGGATTTTTTTAAAAAGGTTCAAGAGATTGACAAACAGAATGAGAAGCTAGATAAGCTACTGCGAAAGCTCCAGGATTCACATGAGGAGTCCAAAGCTGTCACTAAAGCTCCGGCCATGAAAGCAATCAAGCAGCGGATGGAAAAGGATGTCGATGAAGTTGGAAAGATTGCACGTGCTGTGAAGACCAAAGTCGAAGAACTTGACAGAGAGAATTTGGCCAATAGGCAGAAGCCGGGGTGTGGAAAAGGAACAGGTGTAGATAGATCAAGAACAGCAACTACTCTTGCCTTGAAAAAAAAGTTGAAAGACAAGATGACCGAATTTCAGATTTTACGTGAAAAAGTCCATCAAGAGTACCGGGAGGTTGTTGAGAGACGGATTTTCACAGTCACGGGCGCAAGAGCTGATGAAGAGACAATCGAGAAATTAATTGAAACTGGGGATAGTGAACAGATTTTTCAAAAGGCAATTCAAGAACAAGGGCGAGGACAGGTAATGGACACTCTAGCTGAAATTCAAGAGCGTCATAGTGCAGTTAGAGAATTAGAGAGGAAGCTACTTGAGCTACAGCAGGTATTTCTGGACATGGCTGTATTGGTCGATGCACAAGGGGATATGCTCGACAATATTGAATCACATGTTTCAAGTGCAGTAGATCATGTGCAACAAGGGAATACTGCTCTTCAAAAGGCAAAGAAGTTGCAAAAGAATTCTAGGAAATGGATGTGCATTGCCATCATAATCCTTCTTATCATTGTTGCGGTTATAGTATTGGGAGTCCTTAAGCCATGGAATAATGGTAAGGGTGCCTAA 927 43.15 MNDLLSDSFEIPRGQPSRGGDIELGTHAPMNAGDMGMEDFFKKVQEIDKQNEKLDKLLRKLQDSHEESKAVTKAPAMKAIKQRMEKDVDEVGKIARAVKTKVEELDRENLANRQKPGCGKGTGVDRSRTATTLALKKKLKDKMTEFQILREKVHQEYREVVERRIFTVTGARADEETIEKLIETGDSEQIFQKAIQEQGRGQVMDTLAEIQERHSAVRELERKLLELQQVFLDMAVLVDAQGDMLDNIESHVSSAVDHVQQGNTALQKAKKLQKNSRKWMCIAIIILLIIVAVIVLGVLKPWNNGKGA 308
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
9 46347448 46376330 + evm.model.ptg000007l.1403 HCH9g1403 552035

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
HCH9g1403 308 CDD SynN 37 194 IPR006011 GO:0016020(InterPro)
HCH9g1403 308 Gene3D - 197 300 - -
HCH9g1403 308 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 207 269 IPR000727 -
HCH9g1403 308 FunFam Syntaxin 132 200 300 - -
HCH9g1403 308 ProSitePatterns Syntaxin / epimorphin family signature. 213 252 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
HCH9g1403 308 Pfam SNARE domain 243 295 IPR000727 -
HCH9g1403 308 MobiDBLite consensus disorder prediction 1 27 - -
HCH9g1403 308 Gene3D - 33 161 - -
HCH9g1403 308 PANTHER SYNTAXIN 39 287 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0005886(PANTHER)|GO:0006886(PANTHER)|GO:0006887(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
HCH9g1403 308 Pfam Syntaxin 39 242 IPR006011 GO:0016020(InterPro)
HCH9g1403 308 Coils Coil 44 71 - -
HCH9g1403 308 SMART SynN_4 32 158 IPR006011 GO:0016020(InterPro)
HCH9g1403 308 SMART tSNARE_6 202 269 IPR000727 -
HCH9g1403 308 Coils Coil 210 230 - -
HCH9g1403 308 SUPERFAMILY t-snare proteins 34 262 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
HCH9g1403 308 CDD SNARE_syntaxin1-like 206 268 - -
HCH9g1403 308 FunFam Syntaxin 132 32 161 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
HCH9g1403 K08486 - - csv:101203075 519.235
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
HCH2g0746 HCH-Chr2:51142348 HCH9g1403 HCH-Chr9:46347448 1.70E-86 dispersed
HCH9g1199 HCH-Chr9:19151029 HCH9g1403 HCH-Chr9:46347448 1.70E-65 dispersed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
HCH4g0394 . 8 339 SNARE and Associated Proteins AT3G24350 66.5 1.1e-103 373.6
HCH9g0881 . 1 308 SNARE and Associated Proteins AT1G08560 66.6 7.6e-106 380.6
HCH14g0577 . 1 304 SNARE and Associated Proteins AT2G18260 54.9 3.3e-85 312.0
HCH11g0485 . 19 279 SNARE and Associated Proteins AT3G11820 81.6 5.7e-117 417.5
HCH9g1199 . 27 282 SNARE and Associated Proteins AT3G11820 73.0 1.0e-102 370.2
HCH3g0609 . 21 280 SNARE and Associated Proteins AT3G11820 65.8 1.8e-94 342.8
HCH9g1403 . 31 285 SNARE and Associated Proteins AT3G11820 51.0 1.9e-67 253.1
HCH11g0485 . 1 279 SNARE and Associated Proteins AT3G52400 64.3 4.8e-93 338.2
HCH9g1199 . 1 282 SNARE and Associated Proteins AT3G52400 60.5 1.9e-86 316.2
HCH3g0609 . 1 280 SNARE and Associated Proteins AT3G52400 59.0 9.0e-84 307.4
HCH3g0609 . 1 295 SNARE and Associated Proteins AT4G03330 69.1 1.4e-107 386.3
HCH11g0485 . 1 279 SNARE and Associated Proteins AT4G03330 59.3 3.9e-86 315.1
HCH9g1199 . 1 288 SNARE and Associated Proteins AT4G03330 53.8 9.2e-80 293.9
HCH9g1403 . 1 290 SNARE and Associated Proteins AT4G03330 50.3 1.5e-69 260.0
HCH3g0609 . 1 304 SNARE and Associated Proteins AT1G61290 78.3 3.2e-125 444.9
HCH11g0485 . 1 279 SNARE and Associated Proteins AT1G61290 63.5 2.1e-92 335.9
HCH9g1199 . 1 298 SNARE and Associated Proteins AT1G61290 57.5 1.1e-85 313.5
HCH3g0609 . 1 304 SNARE and Associated Proteins AT1G11250 76.3 6.2e-121 430.6
HCH11g0485 . 1 279 SNARE and Associated Proteins AT1G11250 63.1 6.4e-94 340.9
HCH9g1199 . 1 288 SNARE and Associated Proteins AT1G11250 56.4 3.2e-85 312.0
HCH9g1403 . 1 308 SNARE and Associated Proteins AT3G03800 72.4 3.5e-119 424.9
HCH2g0746 . 1 304 SNARE and Associated Proteins AT3G03800 55.3 9.2e-80 293.9
HCH9g1403 . 1 203 SNARE and Associated Proteins AT5G08080 77.8 4.7e-81 297.7
HCH2g0746 . 1 203 SNARE and Associated Proteins AT5G08080 58.1 7.0e-53 204.1
HCH6g1130 . 1 256 SNARE and Associated Proteins AT5G16830 58.4 5.3e-74 274.6
HCH6g1130 . 1 256 SNARE and Associated Proteins AT5G46860 65.6 2.8e-80 295.4
HCH6g1130 . 1 256 SNARE and Associated Proteins AT4G17730 59.1 2.7e-72 268.9
HCH6g1130 . 65 256 SNARE and Associated Proteins AT1G32270 61.5 1.1e-52 204.1
HCH1g0387 . 1 340 SNARE and Associated Proteins AT5G05760 64.8 6.5e-111 397.5
HCH4g0394 . 8 339 SNARE and Associated Proteins AT3G24350 66.5 1.1e-103 373.6
HCH10g0899 . 1 325 SNARE and Associated Proteins AT5G26980 77.8 2.1e-130 462.2
HCH4g1049 . 1 320 SNARE and Associated Proteins AT5G26980 66.5 3.0e-105 378.6
HCH4g1049 . 1 320 SNARE and Associated Proteins AT4G02195 67.7 9.0e-110 393.7
HCH10g0899 . 1 327 SNARE and Associated Proteins AT4G02195 65.3 6.1e-106 380.9
HCH10g0899 . 1 326 SNARE and Associated Proteins AT3G05710 76.3 3.3e-131 464.9
HCH4g1049 . 1 320 SNARE and Associated Proteins AT3G05710 64.3 3.8e-103 371.7
HCH12g1219 . 1 233 SNARE and Associated Proteins AT1G16240 72.1 1.1e-88 323.2
HCH6g0844 . 41 270 SNARE and Associated Proteins AT1G16240 64.3 4.5e-79 291.2
HCH12g1219 . 1 233 SNARE and Associated Proteins AT1G79590 71.2 3.9e-87 318.2
HCH6g0844 . 40 270 SNARE and Associated Proteins AT1G79590 64.5 4.7e-80 294.7
HCH12g1197 . 54 244 SNARE and Associated Proteins AT1G28490 69.3 1.2e-64 243.0
HCH11g0272 . 1 264 SNARE and Associated Proteins AT3G09740 78.9 5.2e-111 397.5
HCH2g1168 . 1 265 SNARE and Associated Proteins AT3G09740 68.2 1.4e-95 346.3
HCH2g1168 . 1 265 SNARE and Associated Proteins AT3G45280 68.5 1.2e-94 343.2
HCH11g0272 . 1 264 SNARE and Associated Proteins AT3G45280 64.4 1.8e-87 319.3
HCH11g0272 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 3.9e-95 344.7
HCH2g1168 . 1 262 SNARE and Associated Proteins AT3G61450 59.5 1.8e-84 309.3
HCH13g0530 . 65 309 SNARE and Associated Proteins AT1G51740 74.0 1.5e-93 339.3