Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Hepe01g1268 ATGCCATCGGCTCAAGATCCGTTCTATGTTGTAAAAGACGAGATTCAAGAATCTATTGATAAACTGCAATCCAGCTTTCACCAATGGGAAAGGATATCTTCTGATCCAGGAGAGAGAGTACAACTCACAAAAGAGTTGCTCGCTTCCTGTGAGAGCATTGAATGGCAGGTGGATGAATTGGACAAAGCTATTGCTGTGGCAGCTAGAGATCCTTCTTGGTATGGCATTGATAATGCAGAAATTGAAAAACGAAGGAGATGGACGAGTACAGCTAGGACACAGGTTGGAAAGGTTAAGAAAGTAGTGGGAGCTGGAAAGGAGCAAATTGGAACTGCTAGTGCGAATGGGATGCGTCGAGAATTGATGAGACTACCTAATGCACACGAAACAGACAGATCAAACTTATATACAGCCCACCAAGGAAATGATGACTTCATCACGTCCGAATCAGATAGACAGCTGCTTCTCATAAAGCAGCAGGACGAGGAGTTGGATGAGCTGAGTGCAAGCGTGGAGAGAATTGGCGGTGTTGGGCTTACAATACATGAAGAGCTCCTTGCACAGGATAAAATTATCGTGGACCTAGGAATGGAAATGGACAGTACATCAAATCGTCTTGATTTTGTTCAGAAAAAAGTGGCTGTGGTAATGAAGAAGGCCAGCGCCAAGGGCCAGTTAATGATGATATTGTTTTTGTTGGCTTTGTTCATCATCCTTTTTGTGTTGGTGTTCCTCACCTAG 741 43.86 MPSAQDPFYVVKDEIQESIDKLQSSFHQWERISSDPGERVQLTKELLASCESIEWQVDELDKAIAVAARDPSWYGIDNAEIEKRRRWTSTARTQVGKVKKVVGAGKEQIGTASANGMRRELMRLPNAHETDRSNLYTAHQGNDDFITSESDRQLLLIKQQDEELDELSASVERIGGVGLTIHEELLAQDKIIVDLGMEMDSTSNRLDFVQKKVAVVMKKASAKGQLMMILFLLALFIILFVLVFLT 246
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
1 77971899 77978347 + Hsped.01g12680.1 Hepe01g1268 560378

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Hepe01g1268 246 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 154 216 IPR000727 -
Hepe01g1268 246 FunFam Syntaxin 10 3 105 - -
Hepe01g1268 246 Gene3D - 2 104 - -
Hepe01g1268 246 PANTHER SYNTAXIN 11 232 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Hepe01g1268 246 SMART tSNARE_6 149 216 IPR000727 -
Hepe01g1268 246 CDD SNARE_NTD_AtSYP61-like 5 102 - -
Hepe01g1268 246 CDD SNARE_Qc 157 214 - -
Hepe01g1268 246 SUPERFAMILY t-snare proteins 5 100 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Hepe01g1268 246 SUPERFAMILY SNARE fusion complex 153 216 - -
Hepe01g1268 246 FunFam syntaxin-61 isoform X1 157 218 - -
Hepe01g1268 246 Pfam SNARE domain 194 242 IPR000727 -
Hepe01g1268 246 Pfam Syntaxin 6, N-terminal 6 99 IPR015260 GO:0016020(InterPro)|GO:0048193(InterPro)
Hepe01g1268 246 Gene3D - 161 225 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Hepe01g1268 K08500 - - csv:101212527 403.675
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Hepe10g0299 . 1 337 SNARE and Associated Proteins AT3G24350 62.8 1.6e-100 363.2
Hepe04g0635 . 1 309 SNARE and Associated Proteins AT1G08560 68.4 9.0e-100 360.5
Hepe04g1523 . 1 304 SNARE and Associated Proteins AT2G18260 54.2 2.3e-84 309.3
Hepe05g0449 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 1.2e-115 413.3
Hepe04g1076 . 26 281 SNARE and Associated Proteins AT3G11820 73.0 1.5e-102 369.8
Hepe07g1958 . 21 281 SNARE and Associated Proteins AT3G11820 64.8 2.8e-93 339.0
Hepe02g2765 . 24 284 SNARE and Associated Proteins AT3G11820 50.6 2.4e-68 256.1
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT3G52400 63.6 9.9e-92 334.0
Hepe04g1076 . 1 281 SNARE and Associated Proteins AT3G52400 60.1 4.8e-86 315.1
Hepe07g1958 . 1 281 SNARE and Associated Proteins AT3G52400 55.3 3.0e-80 295.8
Hepe07g1958 . 1 299 SNARE and Associated Proteins AT4G03330 66.6 4.8e-106 381.3
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT4G03330 57.9 2.9e-82 302.4
Hepe04g1076 . 1 299 SNARE and Associated Proteins AT4G03330 51.3 2.1e-77 286.2
Hepe02g2765 . 1 284 SNARE and Associated Proteins AT4G03330 52.8 6.6e-71 264.6
Hepe07g1958 . 1 299 SNARE and Associated Proteins AT1G61290 78.9 1.7e-127 452.6
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT1G61290 62.8 2.8e-90 328.9
Hepe04g1076 . 1 293 SNARE and Associated Proteins AT1G61290 56.3 1.0e-84 310.5
Hepe07g1958 . 1 299 SNARE and Associated Proteins AT1G11250 76.3 9.5e-123 436.8
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT1G11250 62.4 2.3e-92 335.9
Hepe04g1076 . 1 290 SNARE and Associated Proteins AT1G11250 57.9 3.4e-88 322.0
Hepe02g2765 . 1 284 SNARE and Associated Proteins AT1G11250 50.7 5.5e-70 261.5
Hepe02g2765 . 1 307 SNARE and Associated Proteins AT3G03800 74.9 4.5e-120 427.9
Hepe08g0474 . 1 270 SNARE and Associated Proteins AT3G03800 59.3 2.7e-80 295.8
Hepe02g2765 . 1 202 SNARE and Associated Proteins AT5G08080 80.2 1.2e-82 303.1
Hepe08g0474 . 2 169 SNARE and Associated Proteins AT5G08080 62.5 1.4e-49 193.4
Hepe06g1000 . 1 256 SNARE and Associated Proteins AT5G16830 59.2 3.1e-75 278.9
Hepe06g1000 . 1 256 SNARE and Associated Proteins AT5G46860 65.6 4.0e-80 295.0
Hepe06g1000 . 1 256 SNARE and Associated Proteins AT4G17730 60.5 2.7e-73 272.3
Hepe06g1000 . 65 256 SNARE and Associated Proteins AT1G32270 59.4 8.5e-51 198.0
Hepe01g0729 . 1 334 SNARE and Associated Proteins AT5G05760 65.7 6.1e-110 394.4
Hepe10g0299 . 1 337 SNARE and Associated Proteins AT3G24350 62.8 1.6e-100 363.2
Hepe08g2281 . 1 327 SNARE and Associated Proteins AT5G26980 75.2 1.1e-124 443.4
Hepe03g1868 . 90 409 SNARE and Associated Proteins AT5G26980 65.8 2.4e-103 372.5
Hepe08g2281 . 1 329 SNARE and Associated Proteins AT4G02195 63.7 3.1e-103 372.1
Hepe03g1868 . 90 409 SNARE and Associated Proteins AT4G02195 64.9 6.9e-103 370.9
Hepe08g2281 . 1 328 SNARE and Associated Proteins AT3G05710 74.2 1.7e-125 446.0
Hepe03g1868 . 90 409 SNARE and Associated Proteins AT3G05710 63.1 1.6e-99 359.8
Hepe01g1245 . 1 233 SNARE and Associated Proteins AT1G16240 70.0 2.2e-87 318.9
Hepe01g1245 . 1 233 SNARE and Associated Proteins AT1G79590 70.0 5.7e-87 317.8
Hepe01g1268 . 56 246 SNARE and Associated Proteins AT1G28490 70.5 2.3e-64 242.3
Hepe05g0250 . 1 264 SNARE and Associated Proteins AT3G09740 80.5 3.6e-113 404.8
Hepe08g0878 . 1 262 SNARE and Associated Proteins AT3G09740 65.5 6.5e-91 330.9
Hepe05g0250 . 1 264 SNARE and Associated Proteins AT3G45280 65.2 3.6e-89 325.1
Hepe08g0878 . 1 262 SNARE and Associated Proteins AT3G45280 64.9 2.0e-87 319.3
Hepe05g0250 . 1 261 SNARE and Associated Proteins AT3G61450 67.8 9.6e-95 343.6
Hepe08g0878 . 1 262 SNARE and Associated Proteins AT3G61450 58.0 5.1e-80 294.7
Hepe06g0203 . 439 683 SNARE and Associated Proteins AT1G51740 73.2 3.2e-92 335.1
Hepe02g3337 . 65 306 SNARE and Associated Proteins AT1G51740 72.8 3.0e-90 328.6
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003549 2 1 2 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 5 4 0 44