Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Hepe06g1000 ATGAGCTTTCAAGATATCGAGGCTGGTCGCCCGTTTGCTTCTTCGAGGAGAGACCTCATCAATGGCAAACAAGATCCCACGCAAGCCGTTGCTTCCGGTATTTTTCAGATTAATACTGCCGTTGCTACGTTTCAGAGGCTTGTTAATACCTTAGGAACGCCCAAGGATACGCCTGAGTTACGCGAGAAGCTGCACAAGACCAGGTTACATATTGGACAGTTGGTTAAAGACACCTCTGCTAAACTTAAACAAGCGAGTGATATAGATCATCACGCTGCAGTTAATGCCAGCAAGAAAATTGCAGATGCTAAACTTGCAAAAGATTTTCAAGCAGTGTTGAAAGAATTTCAGAAGGCTCAACGACTTGCAGCTGAGAGGGAAACAGCATACACACCTTTTGTTCCCCAGGCTGTTCTACCCTCTAGCTACACAGCCGGTGAGTCAGATGCAAGCTCAGAAAAGTATCTTGAACAGCGTGCCCTCCTTGTGGATTCCAGGAGACAAGAGGTCTTGCTGTTGGACAATGAAATCGCCTTCAATGAGGCAATAATTGAGGAAAGAGAGCAAGGTATTCATGAAATCCAGCAGCAAATTGGAGAAGTGAATGAAATTTTTAAAGATCTTGCGGTTCTAGTCCATGAACAGGGAGCCATGATTGATGATATTGGATCCAACATAGAGGGGGCCCATGCTGCAACGTCACAAGGAACGACTCAGCTTGTAAAAGCTTCGAAGACACAAAGATCAAATTCATCTCTGGCTTGCTTACTTTTGGTGATATTTGGTATTATCCTTCTCATTGTGATCATAATAGTTGTTGCTTAA 825 43.88 MSFQDIEAGRPFASSRRDLINGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSAKLKQASDIDHHAAVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYTPFVPQAVLPSSYTAGESDASSEKYLEQRALLVDSRRQEVLLLDNEIAFNEAIIEEREQGIHEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIEGAHAATSQGTTQLVKASKTQRSNSSLACLLLVIFGIILLIVIIIVVA 274
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
6 57827301 57831321 + Hsped.06g10000.1 Hepe06g1000 572375

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Hepe06g1000 274 Gene3D - 21 134 - -
Hepe06g1000 274 Pfam SNARE domain 218 269 IPR000727 -
Hepe06g1000 274 SMART tSNARE_6 176 243 IPR000727 -
Hepe06g1000 274 FunFam Syntaxin-22 like 21 134 - -
Hepe06g1000 274 Gene3D - 175 274 - -
Hepe06g1000 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Hepe06g1000 274 SMART SynN_4 16 128 IPR006011 GO:0016020(InterPro)
Hepe06g1000 274 Pfam Syntaxin-like protein 30 130 IPR006011 GO:0016020(InterPro)
Hepe06g1000 274 CDD SNARE_Qa 184 242 - -
Hepe06g1000 274 CDD SynN 24 147 IPR006011 GO:0016020(InterPro)
Hepe06g1000 274 PANTHER SYNTAXIN 36 264 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Hepe06g1000 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
Hepe06g1000 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Hepe06g1000 274 FunFam Syntaxin-22 like 174 274 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Hepe06g1000 - - - - 0.0
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Hepe10g0299 . 1 337 SNARE and Associated Proteins AT3G24350 62.8 1.6e-100 363.2
Hepe04g0635 . 1 309 SNARE and Associated Proteins AT1G08560 68.4 9.0e-100 360.5
Hepe04g1523 . 1 304 SNARE and Associated Proteins AT2G18260 54.2 2.3e-84 309.3
Hepe05g0449 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 1.2e-115 413.3
Hepe04g1076 . 26 281 SNARE and Associated Proteins AT3G11820 73.0 1.5e-102 369.8
Hepe07g1958 . 21 281 SNARE and Associated Proteins AT3G11820 64.8 2.8e-93 339.0
Hepe02g2765 . 24 284 SNARE and Associated Proteins AT3G11820 50.6 2.4e-68 256.1
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT3G52400 63.6 9.9e-92 334.0
Hepe04g1076 . 1 281 SNARE and Associated Proteins AT3G52400 60.1 4.8e-86 315.1
Hepe07g1958 . 1 281 SNARE and Associated Proteins AT3G52400 55.3 3.0e-80 295.8
Hepe07g1958 . 1 299 SNARE and Associated Proteins AT4G03330 66.6 4.8e-106 381.3
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT4G03330 57.9 2.9e-82 302.4
Hepe04g1076 . 1 299 SNARE and Associated Proteins AT4G03330 51.3 2.1e-77 286.2
Hepe02g2765 . 1 284 SNARE and Associated Proteins AT4G03330 52.8 6.6e-71 264.6
Hepe07g1958 . 1 299 SNARE and Associated Proteins AT1G61290 78.9 1.7e-127 452.6
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT1G61290 62.8 2.8e-90 328.9
Hepe04g1076 . 1 293 SNARE and Associated Proteins AT1G61290 56.3 1.0e-84 310.5
Hepe07g1958 . 1 299 SNARE and Associated Proteins AT1G11250 76.3 9.5e-123 436.8
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT1G11250 62.4 2.3e-92 335.9
Hepe04g1076 . 1 290 SNARE and Associated Proteins AT1G11250 57.9 3.4e-88 322.0
Hepe02g2765 . 1 284 SNARE and Associated Proteins AT1G11250 50.7 5.5e-70 261.5
Hepe02g2765 . 1 307 SNARE and Associated Proteins AT3G03800 74.9 4.5e-120 427.9
Hepe08g0474 . 1 270 SNARE and Associated Proteins AT3G03800 59.3 2.7e-80 295.8
Hepe02g2765 . 1 202 SNARE and Associated Proteins AT5G08080 80.2 1.2e-82 303.1
Hepe08g0474 . 2 169 SNARE and Associated Proteins AT5G08080 62.5 1.4e-49 193.4
Hepe06g1000 . 1 256 SNARE and Associated Proteins AT5G16830 59.2 3.1e-75 278.9
Hepe06g1000 . 1 256 SNARE and Associated Proteins AT5G46860 65.6 4.0e-80 295.0
Hepe06g1000 . 1 256 SNARE and Associated Proteins AT4G17730 60.5 2.7e-73 272.3
Hepe06g1000 . 65 256 SNARE and Associated Proteins AT1G32270 59.4 8.5e-51 198.0
Hepe01g0729 . 1 334 SNARE and Associated Proteins AT5G05760 65.7 6.1e-110 394.4
Hepe10g0299 . 1 337 SNARE and Associated Proteins AT3G24350 62.8 1.6e-100 363.2
Hepe08g2281 . 1 327 SNARE and Associated Proteins AT5G26980 75.2 1.1e-124 443.4
Hepe03g1868 . 90 409 SNARE and Associated Proteins AT5G26980 65.8 2.4e-103 372.5
Hepe08g2281 . 1 329 SNARE and Associated Proteins AT4G02195 63.7 3.1e-103 372.1
Hepe03g1868 . 90 409 SNARE and Associated Proteins AT4G02195 64.9 6.9e-103 370.9
Hepe08g2281 . 1 328 SNARE and Associated Proteins AT3G05710 74.2 1.7e-125 446.0
Hepe03g1868 . 90 409 SNARE and Associated Proteins AT3G05710 63.1 1.6e-99 359.8
Hepe01g1245 . 1 233 SNARE and Associated Proteins AT1G16240 70.0 2.2e-87 318.9
Hepe01g1245 . 1 233 SNARE and Associated Proteins AT1G79590 70.0 5.7e-87 317.8
Hepe01g1268 . 56 246 SNARE and Associated Proteins AT1G28490 70.5 2.3e-64 242.3
Hepe05g0250 . 1 264 SNARE and Associated Proteins AT3G09740 80.5 3.6e-113 404.8
Hepe08g0878 . 1 262 SNARE and Associated Proteins AT3G09740 65.5 6.5e-91 330.9
Hepe05g0250 . 1 264 SNARE and Associated Proteins AT3G45280 65.2 3.6e-89 325.1
Hepe08g0878 . 1 262 SNARE and Associated Proteins AT3G45280 64.9 2.0e-87 319.3
Hepe05g0250 . 1 261 SNARE and Associated Proteins AT3G61450 67.8 9.6e-95 343.6
Hepe08g0878 . 1 262 SNARE and Associated Proteins AT3G61450 58.0 5.1e-80 294.7
Hepe06g0203 . 439 683 SNARE and Associated Proteins AT1G51740 73.2 3.2e-92 335.1
Hepe02g3337 . 65 306 SNARE and Associated Proteins AT1G51740 72.8 3.0e-90 328.6
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45