Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Hepe08g0878 ATGACCGTAATCGACGTCATCTTCCGAGTCGATTCTATTTGCAAGAAATACGAGAAGTATGATGTCGAGAAACAGCGCGAGGACAATGCCTATGGTGACGATGCCTTTGCTCGCCTCTTCGCCGCCGTCGAATTCGAAATCGACGCCGCTCTCCAGAAATCTGAGGTTGCCTCATCCGAGAAGAATAGGGCTGCTGCAGTTGCGATGAACGCCGAGGTTCGCCGGAAGAAGGCTCGATTGATGGATGAAGTTCCCAAGCTGCGTAAATTGGCTCACAAGAAGGTTAAAGGGGTTCCGAAAGAAGAGCTTGAGGTCAGAGATGATCTTGTTATTGGGCTTGAAGAGAGGATTAAAGCGATACCAGATGGAAGTACCGCAGGAAACAAACAATCTGGAGGACGGGCGTCCTCTTCGTCATCTAACAAAATCGTGTTTGATTCATCAGATGAAAACTATGATGGCGGGTATTTCCAGAAAAGTGAAGAATCAAGTCAATTTCGAAACGAGTATGAAATGCGGAAGATGAAACAGGACCAAGGTCTCGATGTCATATCTGAGGGGTTGGATATGCTTAAAAATCTGGCCCATGATATGAGTGAGGAAATGGACAGGCAAGTTCCATTAATTGACGAGATCGACGCAAAGGTAGACAAGGTGACTAATGAGATTAAAAATACCAATGTTAGGCTCAAGCAAACGCTCAATGAGGTGAGATCCAGCCAAAACTTCTGCATCGATATCATTCTTCTCTGTGTAATTCTTGGAATCGCCTCTTACTTGTACAATCGCAGTCGAAACACGAGCAAATCTGGCTAA 816 45.47 MTVIDVIFRVDSICKKYEKYDVEKQREDNAYGDDAFARLFAAVEFEIDAALQKSEVASSEKNRAAAVAMNAEVRRKKARLMDEVPKLRKLAHKKVKGVPKEELEVRDDLVIGLEERIKAIPDGSTAGNKQSGGRASSSSSNKIVFDSSDENYDGGYFQKSEESSQFRNEYEMRKMKQDQGLDVISEGLDMLKNLAHDMSEEMDRQVPLIDEIDAKVDKVTNEIKNTNVRLKQTLNEVRSSQNFCIDIILLCVILGIASYLYNRSRNTSKSG 271
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
8 7978212 7980605 + Hsped.08g08780.1 Hepe08g0878 576850

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Hepe08g0878 271 Gene3D - 171 232 - -
Hepe08g0878 271 PANTHER SYNAPTOSOMAL ASSOCIATED PROTEIN 123 235 - GO:0005886(PANTHER)
Hepe08g0878 271 MobiDBLite consensus disorder prediction 124 144 - -
Hepe08g0878 271 MobiDBLite consensus disorder prediction 121 144 - -
Hepe08g0878 271 CDD SNARE_Qc 176 232 - -
Hepe08g0878 271 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 171 233 IPR000727 -
Hepe08g0878 271 SUPERFAMILY SNARE fusion complex 167 231 - -
Hepe08g0878 271 Coils Coil 209 236 - -
Hepe08g0878 271 Pfam SNARE domain 208 257 IPR000727 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Hepe08g0878 K08506 - - csv:101211289 441.81
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Hepe05g0250 Hepe-Chr5:2954767 Hepe08g0878 Hepe-Chr8:7978212 1.18e-115 wgd
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi6g289 . . Bda02g00767 . Bpe01g00179 . . . . . . . . . . Cpe05g00828 . . . . . . . . Cla02g02052 Cam02g2177 Cec02g2216 Cco02g2256 Clacu02g2162 Cmu02g2099 Cre02g2412 . Cone5ag1222 . . . . . Cme11g01789 . Blo14g00167 . . . . . Bma11g00164 Sed05g2859 Cmo02g00885 Cmo20g00513 Cma02g00885 . . Car20g00420 . . Bhi10g00561 Tan05g0265 Cmetu11g0284 . Hepe08g0878 . . . . . . . . . . . . .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Hepe10g0299 . 1 337 SNARE and Associated Proteins AT3G24350 62.8 1.6e-100 363.2
Hepe04g0635 . 1 309 SNARE and Associated Proteins AT1G08560 68.4 9.0e-100 360.5
Hepe04g1523 . 1 304 SNARE and Associated Proteins AT2G18260 54.2 2.3e-84 309.3
Hepe05g0449 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 1.2e-115 413.3
Hepe04g1076 . 26 281 SNARE and Associated Proteins AT3G11820 73.0 1.5e-102 369.8
Hepe07g1958 . 21 281 SNARE and Associated Proteins AT3G11820 64.8 2.8e-93 339.0
Hepe02g2765 . 24 284 SNARE and Associated Proteins AT3G11820 50.6 2.4e-68 256.1
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT3G52400 63.6 9.9e-92 334.0
Hepe04g1076 . 1 281 SNARE and Associated Proteins AT3G52400 60.1 4.8e-86 315.1
Hepe07g1958 . 1 281 SNARE and Associated Proteins AT3G52400 55.3 3.0e-80 295.8
Hepe07g1958 . 1 299 SNARE and Associated Proteins AT4G03330 66.6 4.8e-106 381.3
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT4G03330 57.9 2.9e-82 302.4
Hepe04g1076 . 1 299 SNARE and Associated Proteins AT4G03330 51.3 2.1e-77 286.2
Hepe02g2765 . 1 284 SNARE and Associated Proteins AT4G03330 52.8 6.6e-71 264.6
Hepe07g1958 . 1 299 SNARE and Associated Proteins AT1G61290 78.9 1.7e-127 452.6
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT1G61290 62.8 2.8e-90 328.9
Hepe04g1076 . 1 293 SNARE and Associated Proteins AT1G61290 56.3 1.0e-84 310.5
Hepe07g1958 . 1 299 SNARE and Associated Proteins AT1G11250 76.3 9.5e-123 436.8
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT1G11250 62.4 2.3e-92 335.9
Hepe04g1076 . 1 290 SNARE and Associated Proteins AT1G11250 57.9 3.4e-88 322.0
Hepe02g2765 . 1 284 SNARE and Associated Proteins AT1G11250 50.7 5.5e-70 261.5
Hepe02g2765 . 1 307 SNARE and Associated Proteins AT3G03800 74.9 4.5e-120 427.9
Hepe08g0474 . 1 270 SNARE and Associated Proteins AT3G03800 59.3 2.7e-80 295.8
Hepe02g2765 . 1 202 SNARE and Associated Proteins AT5G08080 80.2 1.2e-82 303.1
Hepe08g0474 . 2 169 SNARE and Associated Proteins AT5G08080 62.5 1.4e-49 193.4
Hepe06g1000 . 1 256 SNARE and Associated Proteins AT5G16830 59.2 3.1e-75 278.9
Hepe06g1000 . 1 256 SNARE and Associated Proteins AT5G46860 65.6 4.0e-80 295.0
Hepe06g1000 . 1 256 SNARE and Associated Proteins AT4G17730 60.5 2.7e-73 272.3
Hepe06g1000 . 65 256 SNARE and Associated Proteins AT1G32270 59.4 8.5e-51 198.0
Hepe01g0729 . 1 334 SNARE and Associated Proteins AT5G05760 65.7 6.1e-110 394.4
Hepe10g0299 . 1 337 SNARE and Associated Proteins AT3G24350 62.8 1.6e-100 363.2
Hepe08g2281 . 1 327 SNARE and Associated Proteins AT5G26980 75.2 1.1e-124 443.4
Hepe03g1868 . 90 409 SNARE and Associated Proteins AT5G26980 65.8 2.4e-103 372.5
Hepe08g2281 . 1 329 SNARE and Associated Proteins AT4G02195 63.7 3.1e-103 372.1
Hepe03g1868 . 90 409 SNARE and Associated Proteins AT4G02195 64.9 6.9e-103 370.9
Hepe08g2281 . 1 328 SNARE and Associated Proteins AT3G05710 74.2 1.7e-125 446.0
Hepe03g1868 . 90 409 SNARE and Associated Proteins AT3G05710 63.1 1.6e-99 359.8
Hepe01g1245 . 1 233 SNARE and Associated Proteins AT1G16240 70.0 2.2e-87 318.9
Hepe01g1245 . 1 233 SNARE and Associated Proteins AT1G79590 70.0 5.7e-87 317.8
Hepe01g1268 . 56 246 SNARE and Associated Proteins AT1G28490 70.5 2.3e-64 242.3
Hepe05g0250 . 1 264 SNARE and Associated Proteins AT3G09740 80.5 3.6e-113 404.8
Hepe08g0878 . 1 262 SNARE and Associated Proteins AT3G09740 65.5 6.5e-91 330.9
Hepe05g0250 . 1 264 SNARE and Associated Proteins AT3G45280 65.2 3.6e-89 325.1
Hepe08g0878 . 1 262 SNARE and Associated Proteins AT3G45280 64.9 2.0e-87 319.3
Hepe05g0250 . 1 261 SNARE and Associated Proteins AT3G61450 67.8 9.6e-95 343.6
Hepe08g0878 . 1 262 SNARE and Associated Proteins AT3G61450 58.0 5.1e-80 294.7
Hepe06g0203 . 439 683 SNARE and Associated Proteins AT1G51740 73.2 3.2e-92 335.1
Hepe02g3337 . 65 306 SNARE and Associated Proteins AT1G51740 72.8 3.0e-90 328.6
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002038 1 2 1 1 1 2 3 2 2 2 2 2 3 3 2 3 2 2 3 2 3 2 2 2 2 2 3 2 2 2 63