Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Hepe08g2281 ATGGCGTCGAGGAATCGGACTTTGATTTTTAAGAAATATAGGGACGCGTTGAGGAGTGTGAGGGTTCCTACCAGCTCTTCGCCTACTTATGCATCGCCATCGACTAGCTCTGGCGCTGGTGGCCCGGTGATTGAATTGGTTAGCTCGTCGTTGTTGCATCCGAATCGGTCGTACGCTCCCTTAAGTACTGAGGATCCGGGTAATTCAAGTAAGGGTGCTCTTACCGTGGGTCTACCTCCAGCTTGGGTGGATGTATCAGAAGAAATAGCTGCAAATGTGCAGCGTGCACGAGTGAAGATGGTGGAGTTAGCTAAAGCTCATGCAAAAGCTCTAATGCCTTCATTTGGAGATGGTAAAGAAGATCAACGATTAATTGAATCTCTCACGCAAGACATAACTAATTTAATCAAGAAATCAGAGAAGGGACTCAAGAGACTCTCTGTAGCTGGACCTTCAGAAGATTCCAATATCAGAAAAAATGTTCAGAGATCTCTTGCCACTGACCTTCAGAACCTTTCCGTGGAGCTTCGCAAGAAACAATCAGCTTATTTAAAGCGCCTACAGCAGCAAAAAGAGGAAGTTCAAGATGGGATTGACATAGAGATGAATCTAAACGGAAATAGATCGAGAATGGAGGACGATGATTTAGAACACATGGTATTTAACGAGCATCAGATGGCTAAGTTGCGAAAGAGTGAAGCATTCACAGCCGAAAGAGAGAGAGAGATCCAACAAGTTGTAGAATCCGTGAATGAGCTTGCTCAGATCATGAAGGATCTATCAGTACTTGTCATAGACCAGGGCACCATTGTTGATAGAATAGATCACAATATTCAAAATGTTGCGACAACGGTTGAGGAGGGCCTTAAGCAACTGCAAAAGGCGGAGAGAACACAAAAACAAGGTGGGATGGTAATGTGCGCGTCCGTGCTCATTATCATGTGTTGCGTCATGTTGGTTCTCTTGATCCTTAAAACCATACTATTTTGA 990 44.24 MASRNRTLIFKKYRDALRSVRVPTSSSPTYASPSTSSGAGGPVIELVSSSLLHPNRSYAPLSTEDPGNSSKGALTVGLPPAWVDVSEEIAANVQRARVKMVELAKAHAKALMPSFGDGKEDQRLIESLTQDITNLIKKSEKGLKRLSVAGPSEDSNIRKNVQRSLATDLQNLSVELRKKQSAYLKRLQQQKEEVQDGIDIEMNLNGNRSRMEDDDLEHMVFNEHQMAKLRKSEAFTAEREREIQQVVESVNELAQIMKDLSVLVIDQGTIVDRIDHNIQNVATTVEEGLKQLQKAERTQKQGGMVMCASVLIIMCCVMLVLLILKTILF 329
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
8 62520491 62524832 - Hsped.08g22810.1 Hepe08g2281 578253

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Hepe08g2281 329 SMART SynN_4 73 188 IPR006011 GO:0016020(InterPro)
Hepe08g2281 329 ProSitePatterns Syntaxin / epimorphin family signature. 239 278 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Hepe08g2281 329 FunFam Syntaxin-43 79 287 - -
Hepe08g2281 329 Gene3D - 79 287 - -
Hepe08g2281 329 CDD SNARE_syntaxin16 237 294 - -
Hepe08g2281 329 MobiDBLite consensus disorder prediction 21 41 - -
Hepe08g2281 329 PANTHER SYNTAXIN 91 316 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Hepe08g2281 329 Pfam SNARE domain 269 321 IPR000727 -
Hepe08g2281 329 SUPERFAMILY t-snare proteins 78 288 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Hepe08g2281 329 Coils Coil 184 204 - -
Hepe08g2281 329 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 233 295 IPR000727 -
Hepe08g2281 329 SMART tSNARE_6 228 295 IPR000727 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Hepe08g2281 K08489 - - csv:101207998 578.941
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Hepe03g1868 Hepe-Chr3:75673683 Hepe08g2281 Hepe-Chr8:62520491 2.00e-126 dispersed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi14g133 . . . . . . . . . . Cma05g01087 Cma12g01045 Car05g00958 Car12g01004 . Cpe07g00878 Cpe11g00890 . . . . . . . Cla02g01497 Cam02g1577 Cec02g1601 Cco02g1642 Clacu02g1560 Cmu02g1513 Cre02g1836 Cone10ag0804 Cone3ag0826 . . . Csa02g00478 . Cme05g01576 . . Bda01g01638 . . . . Bma05g00265 Sed11g0396 Cmo05g01102 Cmo12g01056 . . . . . . Bhi06g01461 Tan08g0631 Cmetu05g1168 . Hepe08g2281 . . . . . . . . . Lsi11g00612 . Chy05g01060 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Hepe10g0299 . 1 337 SNARE and Associated Proteins AT3G24350 62.8 1.6e-100 363.2
Hepe04g0635 . 1 309 SNARE and Associated Proteins AT1G08560 68.4 9.0e-100 360.5
Hepe04g1523 . 1 304 SNARE and Associated Proteins AT2G18260 54.2 2.3e-84 309.3
Hepe05g0449 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 1.2e-115 413.3
Hepe04g1076 . 26 281 SNARE and Associated Proteins AT3G11820 73.0 1.5e-102 369.8
Hepe07g1958 . 21 281 SNARE and Associated Proteins AT3G11820 64.8 2.8e-93 339.0
Hepe02g2765 . 24 284 SNARE and Associated Proteins AT3G11820 50.6 2.4e-68 256.1
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT3G52400 63.6 9.9e-92 334.0
Hepe04g1076 . 1 281 SNARE and Associated Proteins AT3G52400 60.1 4.8e-86 315.1
Hepe07g1958 . 1 281 SNARE and Associated Proteins AT3G52400 55.3 3.0e-80 295.8
Hepe07g1958 . 1 299 SNARE and Associated Proteins AT4G03330 66.6 4.8e-106 381.3
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT4G03330 57.9 2.9e-82 302.4
Hepe04g1076 . 1 299 SNARE and Associated Proteins AT4G03330 51.3 2.1e-77 286.2
Hepe02g2765 . 1 284 SNARE and Associated Proteins AT4G03330 52.8 6.6e-71 264.6
Hepe07g1958 . 1 299 SNARE and Associated Proteins AT1G61290 78.9 1.7e-127 452.6
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT1G61290 62.8 2.8e-90 328.9
Hepe04g1076 . 1 293 SNARE and Associated Proteins AT1G61290 56.3 1.0e-84 310.5
Hepe07g1958 . 1 299 SNARE and Associated Proteins AT1G11250 76.3 9.5e-123 436.8
Hepe05g0449 . 1 279 SNARE and Associated Proteins AT1G11250 62.4 2.3e-92 335.9
Hepe04g1076 . 1 290 SNARE and Associated Proteins AT1G11250 57.9 3.4e-88 322.0
Hepe02g2765 . 1 284 SNARE and Associated Proteins AT1G11250 50.7 5.5e-70 261.5
Hepe02g2765 . 1 307 SNARE and Associated Proteins AT3G03800 74.9 4.5e-120 427.9
Hepe08g0474 . 1 270 SNARE and Associated Proteins AT3G03800 59.3 2.7e-80 295.8
Hepe02g2765 . 1 202 SNARE and Associated Proteins AT5G08080 80.2 1.2e-82 303.1
Hepe08g0474 . 2 169 SNARE and Associated Proteins AT5G08080 62.5 1.4e-49 193.4
Hepe06g1000 . 1 256 SNARE and Associated Proteins AT5G16830 59.2 3.1e-75 278.9
Hepe06g1000 . 1 256 SNARE and Associated Proteins AT5G46860 65.6 4.0e-80 295.0
Hepe06g1000 . 1 256 SNARE and Associated Proteins AT4G17730 60.5 2.7e-73 272.3
Hepe06g1000 . 65 256 SNARE and Associated Proteins AT1G32270 59.4 8.5e-51 198.0
Hepe01g0729 . 1 334 SNARE and Associated Proteins AT5G05760 65.7 6.1e-110 394.4
Hepe10g0299 . 1 337 SNARE and Associated Proteins AT3G24350 62.8 1.6e-100 363.2
Hepe08g2281 . 1 327 SNARE and Associated Proteins AT5G26980 75.2 1.1e-124 443.4
Hepe03g1868 . 90 409 SNARE and Associated Proteins AT5G26980 65.8 2.4e-103 372.5
Hepe08g2281 . 1 329 SNARE and Associated Proteins AT4G02195 63.7 3.1e-103 372.1
Hepe03g1868 . 90 409 SNARE and Associated Proteins AT4G02195 64.9 6.9e-103 370.9
Hepe08g2281 . 1 328 SNARE and Associated Proteins AT3G05710 74.2 1.7e-125 446.0
Hepe03g1868 . 90 409 SNARE and Associated Proteins AT3G05710 63.1 1.6e-99 359.8
Hepe01g1245 . 1 233 SNARE and Associated Proteins AT1G16240 70.0 2.2e-87 318.9
Hepe01g1245 . 1 233 SNARE and Associated Proteins AT1G79590 70.0 5.7e-87 317.8
Hepe01g1268 . 56 246 SNARE and Associated Proteins AT1G28490 70.5 2.3e-64 242.3
Hepe05g0250 . 1 264 SNARE and Associated Proteins AT3G09740 80.5 3.6e-113 404.8
Hepe08g0878 . 1 262 SNARE and Associated Proteins AT3G09740 65.5 6.5e-91 330.9
Hepe05g0250 . 1 264 SNARE and Associated Proteins AT3G45280 65.2 3.6e-89 325.1
Hepe08g0878 . 1 262 SNARE and Associated Proteins AT3G45280 64.9 2.0e-87 319.3
Hepe05g0250 . 1 261 SNARE and Associated Proteins AT3G61450 67.8 9.6e-95 343.6
Hepe08g0878 . 1 262 SNARE and Associated Proteins AT3G61450 58.0 5.1e-80 294.7
Hepe06g0203 . 439 683 SNARE and Associated Proteins AT1G51740 73.2 3.2e-92 335.1
Hepe02g3337 . 65 306 SNARE and Associated Proteins AT1G51740 72.8 3.0e-90 328.6
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003497 3 1 2 2 1 1 2 1 1 1 1 1 2 1 1 2 1 2 2 1 1 1 1 1 1 1 1 4 4 2 46