Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Lac10g2747 ATGAACGATTTGTTCTCCTCTCGCTCCTTCTCTCGCGACAGCCATGTCGTCGAGATGGGCAACGTCTCCTCCTCCCCTACTGCTGTTAATCTCGACAAGTTCTTTGAAGATGTCGAGTCCGTTAAAGACGAGCTCAAGGAGCTCGAGCGCCTCTACCAGAACCTCCATGACTCCCATGAGCAGAGCAAGACGCTTCACAATGCTAAGGCCGTCAAGGACCTCCGATCTCGCATGGATTCTGATGTTGCCCTTGCTCTCAAGAAGGCCAAGCTCATTAAGGTCCGATTGGAGGCCCTTGATCGCTCCAATGCCGCCAATCGGAGCCTCCCCGGTTGCGGCCCCGGCTCCTCCTCTGACCGGACTCGGACTTCTGTAGTCAACGGGTTGAGGAAGAAATTGCAGGATTCCATGGAGAGCTTCAACAATCTCAGGCAGCAGATCTCCTCTGAGTACAGGGAGACTGTGCAGCGAAGATATTTCACTGTTACTGGTGAAAATCCGGACGAGAAGACCATTGATATCTTGATTTCTACAGGTGAAAGTGAGACCTTCTTGCAGAAAGCCATTCAAGAGCAAGGTAGAGGCAGAATCTTAGACACCATTAAAGAGATCCAGGAGAGGCATGATGCAGTAAAAGACCTGGAAAGGAACCTCAAGGAGCTGCACCAGGTTTTCTTGGACATGGCAGTCTTAGTGCACGAGCAAGGCGAGAAACTCGACGACATCGAGAGCCAAGTGAACAGGGCTCATTCTTTTGTTCGAGGAGGCACACAGGAGTTGTCGACAGCCAGAGTATACCAGAAAAACACCCGGAAATGGACGATTATCGGCATCATCATTTTGCTGCTCATTGTCCTGGTGATTGTCCTCAGCCTGCAGCCTTGGAAGAAGAATAATAGTACCACTACCACCCCCTAA 918 50.87 MNDLFSSRSFSRDSHVVEMGNVSSSPTAVNLDKFFEDVESVKDELKELERLYQNLHDSHEQSKTLHNAKAVKDLRSRMDSDVALALKKAKLIKVRLEALDRSNAANRSLPGCGPGSSSDRTRTSVVNGLRKKLQDSMESFNNLRQQISSEYRETVQRRYFTVTGENPDEKTIDILISTGESETFLQKAIQEQGRGRILDTIKEIQERHDAVKDLERNLKELHQVFLDMAVLVHEQGEKLDDIESQVNRAHSFVRGGTQELSTARVYQKNTRKWTIIGIIILLLIVLVIVLSLQPWKKNNSTTTTP 305
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
10 41912534 41914237 - Lag0026792.1 Lac10g2747 585278

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Lac10g2747 305 PANTHER SYNTAXIN 33 280 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0005886(PANTHER)|GO:0006886(PANTHER)|GO:0006887(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Lac10g2747 305 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 201 263 IPR000727 -
Lac10g2747 305 ProSitePatterns Syntaxin / epimorphin family signature. 207 246 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Lac10g2747 305 Gene3D - 29 161 - -
Lac10g2747 305 Pfam Syntaxin 33 236 IPR006011 GO:0016020(InterPro)
Lac10g2747 305 Gene3D - 197 293 - -
Lac10g2747 305 Pfam SNARE domain 237 289 IPR000727 -
Lac10g2747 305 CDD SNARE_syntaxin1-like 200 260 - -
Lac10g2747 305 CDD SynN 31 188 IPR006011 GO:0016020(InterPro)
Lac10g2747 305 SMART SynN_4 26 152 IPR006011 GO:0016020(InterPro)
Lac10g2747 305 Coils Coil 126 150 - -
Lac10g2747 305 SMART tSNARE_6 196 263 IPR000727 -
Lac10g2747 305 Coils Coil 31 65 - -
Lac10g2747 305 Coils Coil 201 224 - -
Lac10g2747 305 FunFam Qa-SNARE, Sso1/Syntaxin1-type, SYP12A-group 28 158 - -
Lac10g2747 305 FunFam Syntaxin 132 194 293 - -
Lac10g2747 305 SUPERFAMILY t-snare proteins 30 256 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Lac10g2747 K08486 - - csv:101208931 526.554
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Lac10g0809 Lac-Chr10:6416691 Lac10g2747 Lac-Chr10:41912534 1.80E-90 dispersed
Lac10g2747 Lac-Chr10:41912534 Lac1g2321 Lac-Chr1:44563397 4.70E-110 dispersed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Lac6g1229 . 64 344 SNARE and Associated Proteins AT3G24350 63.7 7.1e-81 298.5
Lac1g1718 . 1 308 SNARE and Associated Proteins AT1G08560 69.6 8.7e-104 374.4
Lac1g2924 . 1 305 SNARE and Associated Proteins AT2G18260 55.6 1.6e-86 317.0
Lac10g2747 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.8e-115 412.1
Lac1g2321 . 30 283 SNARE and Associated Proteins AT3G11820 72.4 7.0e-101 364.8
Lac10g0809 . 31 281 SNARE and Associated Proteins AT3G11820 66.1 4.5e-92 335.5
Lac10g2747 . 1 279 SNARE and Associated Proteins AT3G52400 63.6 9.3e-91 331.3
Lac1g2321 . 35 283 SNARE and Associated Proteins AT3G52400 65.1 3.4e-85 312.8
Lac10g0809 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 5.1e-81 298.9
Lac10g0809 . 1 299 SNARE and Associated Proteins AT4G03330 68.5 1.7e-107 386.7
Lac10g2747 . 1 279 SNARE and Associated Proteins AT4G03330 57.5 8.3e-83 304.7
Lac1g2321 . 1 288 SNARE and Associated Proteins AT4G03330 54.2 3.3e-79 292.7
Lac10g0809 . 1 303 SNARE and Associated Proteins AT1G61290 78.9 3.8e-128 455.3
Lac10g2747 . 1 279 SNARE and Associated Proteins AT1G61290 62.3 4.8e-91 332.0
Lac1g2321 . 1 288 SNARE and Associated Proteins AT1G61290 55.9 5.4e-82 302.0
Lac10g0809 . 1 303 SNARE and Associated Proteins AT1G11250 77.2 1.1e-124 443.7
Lac10g2747 . 1 279 SNARE and Associated Proteins AT1G11250 63.1 1.3e-93 340.5
Lac1g2321 . 1 288 SNARE and Associated Proteins AT1G11250 56.9 5.1e-85 312.0
Lac7g1748 . 3 342 SNARE and Associated Proteins AT3G03800 57.2 6.2e-94 341.7
Lac9g2066 . 34 255 SNARE and Associated Proteins AT3G03800 59.9 4.0e-69 259.2
Lac7g1748 . 3 259 SNARE and Associated Proteins AT5G08080 60.7 2.8e-72 269.2
Lac9g2066 . 6 206 SNARE and Associated Proteins AT5G08080 59.7 1.0e-53 207.6
Lac5g0200 . 1 256 SNARE and Associated Proteins AT5G16830 59.2 5.8e-75 278.5
Lac5g0200 . 1 256 SNARE and Associated Proteins AT5G46860 66.8 1.5e-80 297.0
Lac5g0200 . 1 256 SNARE and Associated Proteins AT4G17730 61.3 2.3e-73 273.1
Lac5g0200 . 65 256 SNARE and Associated Proteins AT1G32270 60.4 3.8e-52 203.0
Lac13g1100 . 1 334 SNARE and Associated Proteins AT5G05760 66.3 1.1e-112 404.1
Lac6g1229 . 64 344 SNARE and Associated Proteins AT3G24350 63.7 7.1e-81 298.5
Lac6g2561 . 1 294 SNARE and Associated Proteins AT5G26980 75.5 9.0e-112 401.0
Lac4g2493 . 1 312 SNARE and Associated Proteins AT5G26980 66.6 1.4e-101 367.1
Lac4g2493 . 1 311 SNARE and Associated Proteins AT4G02195 65.9 5.0e-102 368.6
Lac6g2561 . 1 294 SNARE and Associated Proteins AT4G02195 65.2 3.2e-93 339.3
Lac6g2561 . 1 294 SNARE and Associated Proteins AT3G05710 73.2 1.6e-111 400.2
Lac4g2493 . 1 312 SNARE and Associated Proteins AT3G05710 62.8 4.2e-96 349.0
Lac2g1436 . 97 329 SNARE and Associated Proteins AT1G16240 71.7 3.5e-89 325.5
Lac5g1038 . 4 188 SNARE and Associated Proteins AT1G16240 69.2 1.4e-66 250.4
Lac2g1436 . 78 329 SNARE and Associated Proteins AT1G79590 66.7 3.0e-89 325.9
Lac5g1038 . 2 188 SNARE and Associated Proteins AT1G79590 69.5 5.4e-70 261.9
Lac2g1404 . 92 282 SNARE and Associated Proteins AT1G28490 71.2 7.9e-66 247.7
Lac10g3026 . 1 261 SNARE and Associated Proteins AT3G09740 79.1 1.4e-110 396.7
Lac9g2572 . 1 263 SNARE and Associated Proteins AT3G09740 67.5 4.1e-94 342.0
Lac9g2572 . 1 263 SNARE and Associated Proteins AT3G45280 65.3 1.7e-87 320.1
Lac10g3026 . 1 261 SNARE and Associated Proteins AT3G45280 64.4 6.4e-87 318.2
Lac10g3026 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 1.6e-95 346.7
Lac9g2572 . 1 263 SNARE and Associated Proteins AT3G61450 60.2 2.2e-84 309.7
Lac8g2909 . 249 469 SNARE and Associated Proteins AT1G51740 68.5 4.2e-77 285.4
Lac6g0895 . 319 458 SNARE and Associated Proteins AT1G51740 63.1 9.2e-40 161.4
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002313 5 3 2 3 3 1 2 1 1 2 1 2 2 2 2 2 2 2 3 1 3 2 2 2 3 1 2 3 2 0 62