Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Lac1g2924 ATGAACGATTTGATGACGAAATCGTTCCTAAGTTATGTGGAATTAAAGAAACAGGCACAGAGCGACACCGCAGATTCCTTATCCGCCGGCGGCGACTTCGACATCGAATCCGGCGGCCAAGAACTCAATCCGACGGAAGAACAGAACCTGTCTCTGTTTTTCGAACAAGTCGAGGAAATCAAGACCCAAATGGAAGAGACAACCAATCTCTTAATCGACATTCAGAAACTAAATCAAGAAGCCAAATCAACCCACAACGCCAAGATCCTCCGCGGATTAAGAGACCGAATCGACTCTGACATGGTCTCGATCCTCCGCAGAGCGAAACTCCTCAAAGAGAAATTGGCCTCTCTCGACCAATCCAACGCCGCCAACCGCCTGATCTCCGTTGCGTTCGGCGAAGGAACCGCCGTCGACAGAACGAGAACCTCAATCACCAACGGACTGAGAGTGAAATTGAGAGAAATGATGAACGAATTCCAGTCTCTGAGAGAGAAAGTGGTGGCGGATCACAAGGAAGATCTGAGAAGAAGGTACTTCGGAGCAAATGGGGAACAACCCAGTGAAGAACAGATCGAGAAGATCATGTCTGGGAGTTTGAAACTCGAATCATTCGGAGGAAAACTGAGCGAGACCGAGTCGGGGGACCGAGTCAGGCACGAGTCAGTGATGGACATACAGAGGAGTTTGAACAAGCTTCATCAAGTATTTCTGGACATGGCGATTCTGGTCGAGAGCCAAGGGGAGAAGGTGGAAGACATTGAAGAGAATGTGGCGAAAGGTGGGAGGTTCATCAATGGCGGCACTCGAAGCCTTTACTATGCGAACCAGATGAAGAGGAAGAACAAGAAGTGGGTGTATTGGGTTTGGAGTTTGATTTTTGTTATATTGCTTGTTTGCATTGTTGCTATGTTGGTTTGTTAG 924 48.05 MNDLMTKSFLSYVELKKQAQSDTADSLSAGGDFDIESGGQELNPTEEQNLSLFFEQVEEIKTQMEETTNLLIDIQKLNQEAKSTHNAKILRGLRDRIDSDMVSILRRAKLLKEKLASLDQSNAANRLISVAFGEGTAVDRTRTSITNGLRVKLREMMNEFQSLREKVVADHKEDLRRRYFGANGEQPSEEQIEKIMSGSLKLESFGGKLSETESGDRVRHESVMDIQRSLNKLHQVFLDMAILVESQGEKVEDIEENVAKGGRFINGGTRSLYYANQMKRKNKKWVYWVWSLIFVILLVCIVAMLVC 307
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
1 50047686 50048609 - Lag0013416.1 Lac1g2924 596495

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Lac1g2924 307 SMART tSNARE_6 208 275 IPR000727 -
Lac1g2924 307 CDD SNARE_syntaxin1-like 219 272 - -
Lac1g2924 307 MobiDBLite consensus disorder prediction 23 42 - -
Lac1g2924 307 SUPERFAMILY t-snare proteins 49 268 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Lac1g2924 307 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 213 275 IPR000727 -
Lac1g2924 307 CDD SynN 53 200 IPR006011 GO:0016020(InterPro)
Lac1g2924 307 Pfam Syntaxin 53 248 IPR006011 GO:0016020(InterPro)
Lac1g2924 307 Gene3D - 209 306 - -
Lac1g2924 307 FunFam Syntaxin 132 206 306 - -
Lac1g2924 307 SMART SynN_4 45 172 IPR006011 GO:0016020(InterPro)
Lac1g2924 307 Gene3D - 45 177 - -
Lac1g2924 307 FunFam Qa-SNARE, Sso1/Syntaxin1-type, SYP12A-group 47 178 - -
Lac1g2924 307 PANTHER SYNTAXIN 53 296 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0005886(PANTHER)|GO:0006886(PANTHER)|GO:0006887(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Lac1g2924 K08486 - - csv:101217836 526.939
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Lac1g2924 Lac-Chr1:50047686 Lac9g2066 Lac-Chr9:40297547 4.30E-31 dispersed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Lac6g1229 . 64 344 SNARE and Associated Proteins AT3G24350 63.7 7.1e-81 298.5
Lac1g1718 . 1 308 SNARE and Associated Proteins AT1G08560 69.6 8.7e-104 374.4
Lac1g2924 . 1 305 SNARE and Associated Proteins AT2G18260 55.6 1.6e-86 317.0
Lac10g2747 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.8e-115 412.1
Lac1g2321 . 30 283 SNARE and Associated Proteins AT3G11820 72.4 7.0e-101 364.8
Lac10g0809 . 31 281 SNARE and Associated Proteins AT3G11820 66.1 4.5e-92 335.5
Lac10g2747 . 1 279 SNARE and Associated Proteins AT3G52400 63.6 9.3e-91 331.3
Lac1g2321 . 35 283 SNARE and Associated Proteins AT3G52400 65.1 3.4e-85 312.8
Lac10g0809 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 5.1e-81 298.9
Lac10g0809 . 1 299 SNARE and Associated Proteins AT4G03330 68.5 1.7e-107 386.7
Lac10g2747 . 1 279 SNARE and Associated Proteins AT4G03330 57.5 8.3e-83 304.7
Lac1g2321 . 1 288 SNARE and Associated Proteins AT4G03330 54.2 3.3e-79 292.7
Lac10g0809 . 1 303 SNARE and Associated Proteins AT1G61290 78.9 3.8e-128 455.3
Lac10g2747 . 1 279 SNARE and Associated Proteins AT1G61290 62.3 4.8e-91 332.0
Lac1g2321 . 1 288 SNARE and Associated Proteins AT1G61290 55.9 5.4e-82 302.0
Lac10g0809 . 1 303 SNARE and Associated Proteins AT1G11250 77.2 1.1e-124 443.7
Lac10g2747 . 1 279 SNARE and Associated Proteins AT1G11250 63.1 1.3e-93 340.5
Lac1g2321 . 1 288 SNARE and Associated Proteins AT1G11250 56.9 5.1e-85 312.0
Lac7g1748 . 3 342 SNARE and Associated Proteins AT3G03800 57.2 6.2e-94 341.7
Lac9g2066 . 34 255 SNARE and Associated Proteins AT3G03800 59.9 4.0e-69 259.2
Lac7g1748 . 3 259 SNARE and Associated Proteins AT5G08080 60.7 2.8e-72 269.2
Lac9g2066 . 6 206 SNARE and Associated Proteins AT5G08080 59.7 1.0e-53 207.6
Lac5g0200 . 1 256 SNARE and Associated Proteins AT5G16830 59.2 5.8e-75 278.5
Lac5g0200 . 1 256 SNARE and Associated Proteins AT5G46860 66.8 1.5e-80 297.0
Lac5g0200 . 1 256 SNARE and Associated Proteins AT4G17730 61.3 2.3e-73 273.1
Lac5g0200 . 65 256 SNARE and Associated Proteins AT1G32270 60.4 3.8e-52 203.0
Lac13g1100 . 1 334 SNARE and Associated Proteins AT5G05760 66.3 1.1e-112 404.1
Lac6g1229 . 64 344 SNARE and Associated Proteins AT3G24350 63.7 7.1e-81 298.5
Lac6g2561 . 1 294 SNARE and Associated Proteins AT5G26980 75.5 9.0e-112 401.0
Lac4g2493 . 1 312 SNARE and Associated Proteins AT5G26980 66.6 1.4e-101 367.1
Lac4g2493 . 1 311 SNARE and Associated Proteins AT4G02195 65.9 5.0e-102 368.6
Lac6g2561 . 1 294 SNARE and Associated Proteins AT4G02195 65.2 3.2e-93 339.3
Lac6g2561 . 1 294 SNARE and Associated Proteins AT3G05710 73.2 1.6e-111 400.2
Lac4g2493 . 1 312 SNARE and Associated Proteins AT3G05710 62.8 4.2e-96 349.0
Lac2g1436 . 97 329 SNARE and Associated Proteins AT1G16240 71.7 3.5e-89 325.5
Lac5g1038 . 4 188 SNARE and Associated Proteins AT1G16240 69.2 1.4e-66 250.4
Lac2g1436 . 78 329 SNARE and Associated Proteins AT1G79590 66.7 3.0e-89 325.9
Lac5g1038 . 2 188 SNARE and Associated Proteins AT1G79590 69.5 5.4e-70 261.9
Lac2g1404 . 92 282 SNARE and Associated Proteins AT1G28490 71.2 7.9e-66 247.7
Lac10g3026 . 1 261 SNARE and Associated Proteins AT3G09740 79.1 1.4e-110 396.7
Lac9g2572 . 1 263 SNARE and Associated Proteins AT3G09740 67.5 4.1e-94 342.0
Lac9g2572 . 1 263 SNARE and Associated Proteins AT3G45280 65.3 1.7e-87 320.1
Lac10g3026 . 1 261 SNARE and Associated Proteins AT3G45280 64.4 6.4e-87 318.2
Lac10g3026 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 1.6e-95 346.7
Lac9g2572 . 1 263 SNARE and Associated Proteins AT3G61450 60.2 2.2e-84 309.7
Lac8g2909 . 249 469 SNARE and Associated Proteins AT1G51740 68.5 4.2e-77 285.4
Lac6g0895 . 319 458 SNARE and Associated Proteins AT1G51740 63.1 9.2e-40 161.4
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002433 5 3 5 4 2 1 2 1 2 2 1 1 2 1 2 1 1 3 2 1 2 3 2 2 1 1 1 2 1 4 61