Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Lac5g0200 ATGAGCTTTCAAGATATCGAGGCTGGTCGCCCGTTTGCTTCTTCGAGGAGAGACCTCATCAATGGCAAACAAGATCCCACGCAAGCCGTTGCCTCCGGTATTTTTCAGATTAATACTGCCGTCGCTACGTTTCAGAGGCTTGTTAACACCTTAGGAACGCCCAAGGATACGCCTGAGCTACGCGAGAAGCTGCACAAGACCAGATTACATATCGGACAGTTGGTTAAAGACACCTCTGCTAAACTTAAACAAGCCAGTGAAATAGATCATCACGCTGAAGTTAATGCCAGCAAGAAAATTGCAGATGCTAAACTTGCGAAAGATTTTCAAGCAGTGTTGAAAGAATTTCAGAAGGCTCAGCGACTTGCAGCTGAGAGGGAAACAGCATATACACCTTTTGTTCCCCAGGCTGTTCTACCTTCTAGCTACACAGCTGGTGAGTCAGATGCGAGCTCAGAAAAGAATCTTGAACAGCGTGCCCTCCTTGTGGAATCTAGGAGACAAGAGGTCTTGCTGTTGGACAATGAAATAGCCTTCAACGAAGCAATCATTGAGGAAAGAGAACAAGGTATTCATGAAATCCAGCAGCAAATTGGAGAAGTGAATGAAATTTTTAAAGATCTTGCTGTTCTAGTCCATGAACAGGGAGCCATGATTGATGATATTGGATCCAACATAGAGGGCGCCCATGCTGCAACATCACAGGGAACGACCCAACTTGTAAAAGCTTCAAAGACACAAAAATCAAATTCATCTCTGGCTTGCTTACTTTTGGTGATATTTGGTATTATCCTTCTCATTGTGATCATAATAGTTGTTGCTTAA 825 43.64 MSFQDIEAGRPFASSRRDLINGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSAKLKQASEIDHHAEVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYTPFVPQAVLPSSYTAGESDASSEKNLEQRALLVESRRQEVLLLDNEIAFNEAIIEEREQGIHEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIEGAHAATSQGTTQLVKASKTQKSNSSLACLLLVIFGIILLIVIIIVVA 274
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
5 1730484 1734982 + Lag0017284.1 Lac5g0200 606842

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Lac5g0200 274 Gene3D - 174 274 - -
Lac5g0200 274 SMART tSNARE_6 176 243 IPR000727 -
Lac5g0200 274 Pfam SNARE domain 218 269 IPR000727 -
Lac5g0200 274 Pfam Syntaxin-like protein 30 130 IPR006011 GO:0016020(InterPro)
Lac5g0200 274 CDD SynN 24 158 IPR006011 GO:0016020(InterPro)
Lac5g0200 274 FunFam Syntaxin-22 like 174 274 - -
Lac5g0200 274 PANTHER SYNTAXIN 36 263 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Lac5g0200 274 SMART SynN_4 16 128 IPR006011 GO:0016020(InterPro)
Lac5g0200 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Lac5g0200 274 CDD SNARE_Qa 184 242 - -
Lac5g0200 274 FunFam Syntaxin-22 like 21 134 - -
Lac5g0200 274 Gene3D - 21 134 - -
Lac5g0200 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
Lac5g0200 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Lac5g0200 - - - - 0.0
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Lac6g1229 . 64 344 SNARE and Associated Proteins AT3G24350 63.7 7.1e-81 298.5
Lac1g1718 . 1 308 SNARE and Associated Proteins AT1G08560 69.6 8.7e-104 374.4
Lac1g2924 . 1 305 SNARE and Associated Proteins AT2G18260 55.6 1.6e-86 317.0
Lac10g2747 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.8e-115 412.1
Lac1g2321 . 30 283 SNARE and Associated Proteins AT3G11820 72.4 7.0e-101 364.8
Lac10g0809 . 31 281 SNARE and Associated Proteins AT3G11820 66.1 4.5e-92 335.5
Lac10g2747 . 1 279 SNARE and Associated Proteins AT3G52400 63.6 9.3e-91 331.3
Lac1g2321 . 35 283 SNARE and Associated Proteins AT3G52400 65.1 3.4e-85 312.8
Lac10g0809 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 5.1e-81 298.9
Lac10g0809 . 1 299 SNARE and Associated Proteins AT4G03330 68.5 1.7e-107 386.7
Lac10g2747 . 1 279 SNARE and Associated Proteins AT4G03330 57.5 8.3e-83 304.7
Lac1g2321 . 1 288 SNARE and Associated Proteins AT4G03330 54.2 3.3e-79 292.7
Lac10g0809 . 1 303 SNARE and Associated Proteins AT1G61290 78.9 3.8e-128 455.3
Lac10g2747 . 1 279 SNARE and Associated Proteins AT1G61290 62.3 4.8e-91 332.0
Lac1g2321 . 1 288 SNARE and Associated Proteins AT1G61290 55.9 5.4e-82 302.0
Lac10g0809 . 1 303 SNARE and Associated Proteins AT1G11250 77.2 1.1e-124 443.7
Lac10g2747 . 1 279 SNARE and Associated Proteins AT1G11250 63.1 1.3e-93 340.5
Lac1g2321 . 1 288 SNARE and Associated Proteins AT1G11250 56.9 5.1e-85 312.0
Lac7g1748 . 3 342 SNARE and Associated Proteins AT3G03800 57.2 6.2e-94 341.7
Lac9g2066 . 34 255 SNARE and Associated Proteins AT3G03800 59.9 4.0e-69 259.2
Lac7g1748 . 3 259 SNARE and Associated Proteins AT5G08080 60.7 2.8e-72 269.2
Lac9g2066 . 6 206 SNARE and Associated Proteins AT5G08080 59.7 1.0e-53 207.6
Lac5g0200 . 1 256 SNARE and Associated Proteins AT5G16830 59.2 5.8e-75 278.5
Lac5g0200 . 1 256 SNARE and Associated Proteins AT5G46860 66.8 1.5e-80 297.0
Lac5g0200 . 1 256 SNARE and Associated Proteins AT4G17730 61.3 2.3e-73 273.1
Lac5g0200 . 65 256 SNARE and Associated Proteins AT1G32270 60.4 3.8e-52 203.0
Lac13g1100 . 1 334 SNARE and Associated Proteins AT5G05760 66.3 1.1e-112 404.1
Lac6g1229 . 64 344 SNARE and Associated Proteins AT3G24350 63.7 7.1e-81 298.5
Lac6g2561 . 1 294 SNARE and Associated Proteins AT5G26980 75.5 9.0e-112 401.0
Lac4g2493 . 1 312 SNARE and Associated Proteins AT5G26980 66.6 1.4e-101 367.1
Lac4g2493 . 1 311 SNARE and Associated Proteins AT4G02195 65.9 5.0e-102 368.6
Lac6g2561 . 1 294 SNARE and Associated Proteins AT4G02195 65.2 3.2e-93 339.3
Lac6g2561 . 1 294 SNARE and Associated Proteins AT3G05710 73.2 1.6e-111 400.2
Lac4g2493 . 1 312 SNARE and Associated Proteins AT3G05710 62.8 4.2e-96 349.0
Lac2g1436 . 97 329 SNARE and Associated Proteins AT1G16240 71.7 3.5e-89 325.5
Lac5g1038 . 4 188 SNARE and Associated Proteins AT1G16240 69.2 1.4e-66 250.4
Lac2g1436 . 78 329 SNARE and Associated Proteins AT1G79590 66.7 3.0e-89 325.9
Lac5g1038 . 2 188 SNARE and Associated Proteins AT1G79590 69.5 5.4e-70 261.9
Lac2g1404 . 92 282 SNARE and Associated Proteins AT1G28490 71.2 7.9e-66 247.7
Lac10g3026 . 1 261 SNARE and Associated Proteins AT3G09740 79.1 1.4e-110 396.7
Lac9g2572 . 1 263 SNARE and Associated Proteins AT3G09740 67.5 4.1e-94 342.0
Lac9g2572 . 1 263 SNARE and Associated Proteins AT3G45280 65.3 1.7e-87 320.1
Lac10g3026 . 1 261 SNARE and Associated Proteins AT3G45280 64.4 6.4e-87 318.2
Lac10g3026 . 1 261 SNARE and Associated Proteins AT3G61450 68.2 1.6e-95 346.7
Lac9g2572 . 1 263 SNARE and Associated Proteins AT3G61450 60.2 2.2e-84 309.7
Lac8g2909 . 249 469 SNARE and Associated Proteins AT1G51740 68.5 4.2e-77 285.4
Lac6g0895 . 319 458 SNARE and Associated Proteins AT1G51740 63.1 9.2e-40 161.4
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45