Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Lcy10g2218 ATGGCGAAGTTCAGGGATAGGACTGAAGATTTTAAAGATGTTGTGCGGCATTGTGCAGTTTCTTTAGGATATAACGAGCTTGAAAGCATTGGTGCTCTTGAAGAGTTTATGTTGAAACATCAAAAGGACTATGTAGATATGTATCGCACAACAGATCAAGAGAGAGACAATATTGAACATGAGGTAACTGCCTTCATCAAAGCATGCCAAGAACAAATCGATATACTAAAGAACTCAATTAATGAGGATGAAGCACACTCAAAGGGCTGGCTTGGTGCTAGGACTGATGATGCTAATGCCGATACTATTGCACACAAACATGGGGTGGTTCTAATTTTGAGTGAGAAACTCCATTCAGTAACATCACAATTTGATAAGCTAAGGGCCATTCGGTTTCAAGATATCATAAACAAAGCAGTACCAAGAAGAAAACCAAACCAAGTTAATAAACCACGTTCTGCAAATGCCCCTGAATATAATAATACGGAGCTGAGGGAACCTGATAATTTTGAGCATCAACCTGTCCGAGCCCAACAGCAACTGTTGGATGACGAAACTCGTGCACTTCAGGTTGAATTGACTAGTCTACTTGACGCAGTCCAGGAAACAGAAACTAAGATGGTAGAGATGTCTGCTTTGAATCACCTAATGTCTACGCACGTTTTGCAGCAAGCACAACAAATTGAACTTCTTTATGAACAGAAGCAAGAAAAAGATGAAGTTACCAATGGAAATTTGGATCACATTTTTGTTGCTGTAAGAGTGAACTCATTTGCTACTTCAATTTCTCAAAGTGCCCTGCATTCATTTGTAGCTGCTGAAGCATGA 828 39.73 MAKFRDRTEDFKDVVRHCAVSLGYNELESIGALEEFMLKHQKDYVDMYRTTDQERDNIEHEVTAFIKACQEQIDILKNSINEDEAHSKGWLGARTDDANADTIAHKHGVVLILSEKLHSVTSQFDKLRAIRFQDIINKAVPRRKPNQVNKPRSANAPEYNNTELREPDNFEHQPVRAQQQLLDDETRALQVELTSLLDAVQETETKMVEMSALNHLMSTHVLQQAQQIELLYEQKQEKDEVTNGNLDHIFVAVRVNSFATSISQSALHSFVAAEA 275
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
10 46048930 46051916 - Maker00039225 Lcy10g2218 645729

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Lcy10g2218 275 Coils Coil 66 86 - -
Lcy10g2218 275 PANTHER SYNTAXIN-18 1 245 - GO:0005783(PANTHER)|GO:0006890(PANTHER)|GO:0031201(PANTHER)
Lcy10g2218 275 MobiDBLite consensus disorder prediction 148 162 - -
Lcy10g2218 275 SUPERFAMILY t-snare proteins 39 229 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Lcy10g2218 275 MobiDBLite consensus disorder prediction 141 170 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Lcy10g2218 K08492 - - csv:101207161 429.098
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Lcy10g2218 Lcy-Chr10:46048930 Lcy4g1484 Lcy-Chr4:37149197 2.51E-128 dispersed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi13g422 . . . . . . . . . . . . . . Sed03g0404 Cpe13g01079 . Bhi04g02346 Tan11g0243 Cmetu03g1342 . Hepe02g3337 . Lcy10g2218 . . . . . . . . . . Cone18ag0421 Lsi03g00333 Csa06g00159 . . . . . . . . . . . Cmo04g03046 Cmo15g00129 Cma04g02924 Cma15g00119 Car04g02811 Car15g00129 . Cpe01g02531 . . . . . . . Cla11g00615 Cam11g0668 Cec11g0667 Cco11g0653 Clacu11g0790 Cmu11g0646 Cre11g1122 . . Chy03g00164 Cme03g00216
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Lcy13g1316 . 8 286 SNARE and Associated Proteins AT3G24350 63.0 1.1e-80 297.7
Lcy1g1665 . 1 309 SNARE and Associated Proteins AT1G08560 69.7 4.7e-104 375.2
Lcy11g0712 . 106 296 SNARE and Associated Proteins AT1G08560 50.5 1.1e-44 177.9
Lcy1g0704 . 405 709 SNARE and Associated Proteins AT2G18260 55.6 6.7e-87 318.2
Lcy5g0507 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.5e-115 412.1
Lcy5g2615 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.5e-115 412.1
Lcy1g1206 . 23 281 SNARE and Associated Proteins AT3G11820 72.6 1.7e-101 366.7
Lcy5g1935 . 31 281 SNARE and Associated Proteins AT3G11820 66.9 6.5e-93 338.2
Lcy11g0712 . 91 296 SNARE and Associated Proteins AT3G11820 57.3 4.3e-60 229.2
Lcy5g0507 . 1 279 SNARE and Associated Proteins AT3G52400 63.6 8.6e-91 331.3
Lcy5g2615 . 1 279 SNARE and Associated Proteins AT3G52400 63.6 8.6e-91 331.3
Lcy1g1206 . 1 281 SNARE and Associated Proteins AT3G52400 60.1 4.9e-86 315.5
Lcy5g1935 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 2.1e-81 300.1
Lcy11g0712 . 88 296 SNARE and Associated Proteins AT3G52400 53.6 9.3e-53 204.9
Lcy5g1935 . 1 299 SNARE and Associated Proteins AT4G03330 69.2 2.4e-108 389.4
Lcy5g0507 . 1 279 SNARE and Associated Proteins AT4G03330 57.5 1.0e-82 304.3
Lcy5g2615 . 1 279 SNARE and Associated Proteins AT4G03330 57.5 1.0e-82 304.3
Lcy1g1206 . 1 287 SNARE and Associated Proteins AT4G03330 54.3 6.8e-79 291.6
Lcy11g0712 . 91 296 SNARE and Associated Proteins AT4G03330 59.2 2.4e-60 229.9
Lcy5g1935 . 1 303 SNARE and Associated Proteins AT1G61290 78.9 1.6e-128 456.4
Lcy5g0507 . 1 279 SNARE and Associated Proteins AT1G61290 62.3 5.9e-91 331.6
Lcy5g2615 . 1 279 SNARE and Associated Proteins AT1G61290 62.3 5.9e-91 331.6
Lcy1g1206 . 1 287 SNARE and Associated Proteins AT1G61290 56.4 5.9e-83 305.1
Lcy11g0712 . 88 296 SNARE and Associated Proteins AT1G61290 54.1 4.2e-57 219.2
Lcy5g1935 . 1 303 SNARE and Associated Proteins AT1G11250 77.9 1.6e-125 446.4
Lcy5g0507 . 1 279 SNARE and Associated Proteins AT1G11250 63.1 1.6e-93 340.1
Lcy5g2615 . 1 279 SNARE and Associated Proteins AT1G11250 63.1 1.6e-93 340.1
Lcy1g1206 . 1 287 SNARE and Associated Proteins AT1G11250 57.8 5.6e-86 315.1
Lcy11g0712 . 88 296 SNARE and Associated Proteins AT1G11250 55.5 2.0e-59 226.9
Lcy11g0712 . 90 320 SNARE and Associated Proteins AT3G03800 77.5 5.3e-92 335.1
Lcy11g0712 . 90 214 SNARE and Associated Proteins AT5G08080 82.4 2.3e-52 203.0
Lcy6g2242 . 5 158 SNARE and Associated Proteins AT5G16830 59.7 7.4e-40 161.8
Lcy6g2242 . 4 129 SNARE and Associated Proteins AT5G46860 80.2 1.3e-46 184.1
Lcy6g2242 . 4 129 SNARE and Associated Proteins AT4G17730 77.0 5.9e-47 185.3
Lcy6g2242 . 2 157 SNARE and Associated Proteins AT1G32270 60.9 2.5e-42 170.2
Lcy7g0975 . 1 334 SNARE and Associated Proteins AT5G05760 66.9 4.2e-114 408.7
Lcy13g1316 . 8 286 SNARE and Associated Proteins AT3G24350 63.0 1.1e-80 297.7
Lcy4g1808 . 1 311 SNARE and Associated Proteins AT5G26980 70.4 3.3e-116 415.6
Lcy3g1779 . 1 320 SNARE and Associated Proteins AT5G26980 67.1 2.2e-104 376.3
Lcy10g0262 . 79 263 SNARE and Associated Proteins AT5G26980 58.9 2.3e-45 180.3
Lcy3g1779 . 1 320 SNARE and Associated Proteins AT4G02195 66.3 2.2e-104 376.3
Lcy4g1808 . 1 314 SNARE and Associated Proteins AT4G02195 59.1 3.9e-93 339.0
Lcy10g0262 . 79 263 SNARE and Associated Proteins AT4G02195 58.3 6.5e-48 188.7
Lcy4g1808 . 1 312 SNARE and Associated Proteins AT3G05710 68.6 1.6e-113 406.8
Lcy3g1779 . 1 323 SNARE and Associated Proteins AT3G05710 63.7 5.8e-100 361.7
Lcy10g0262 . 71 263 SNARE and Associated Proteins AT3G05710 58.0 4.1e-45 179.5
Lcy9g1162 . 137 318 SNARE and Associated Proteins AT1G16240 70.5 5.9e-67 251.5
Lcy6g1648 . 12 188 SNARE and Associated Proteins AT1G16240 68.1 7.5e-62 234.6
Lcy9g1162 . 137 318 SNARE and Associated Proteins AT1G79590 68.9 5.1e-67 251.9
Lcy6g1648 . 6 188 SNARE and Associated Proteins AT1G79590 67.5 8.8e-67 251.1
Lcy9g1185 . 56 247 SNARE and Associated Proteins AT1G28490 71.9 2.5e-66 249.2
Lcy5g0279 . 44 304 SNARE and Associated Proteins AT3G09740 79.5 2.6e-111 399.1
Lcy1g2796 . 1 286 SNARE and Associated Proteins AT3G09740 61.8 4.4e-90 328.6
Lcy1g2792 . 1 286 SNARE and Associated Proteins AT3G09740 61.5 2.2e-89 326.2
Lcy8g1893 . 1 283 SNARE and Associated Proteins AT3G09740 58.6 2.0e-82 303.1
Lcy5g0279 . 44 307 SNARE and Associated Proteins AT3G45280 64.0 9.1e-88 320.9
Lcy1g2796 . 1 286 SNARE and Associated Proteins AT3G45280 59.7 3.0e-83 305.8
Lcy1g2792 . 1 286 SNARE and Associated Proteins AT3G45280 59.4 1.5e-82 303.5
Lcy8g1893 . 1 283 SNARE and Associated Proteins AT3G45280 56.5 1.8e-75 280.0
Lcy5g0279 . 44 304 SNARE and Associated Proteins AT3G61450 67.8 5.8e-95 344.7
Lcy1g2792 . 1 287 SNARE and Associated Proteins AT3G61450 55.9 3.6e-81 298.9
Lcy1g2796 . 1 287 SNARE and Associated Proteins AT3G61450 55.9 4.7e-81 298.5
Lcy8g1893 . 1 284 SNARE and Associated Proteins AT3G61450 53.7 1.1e-74 277.3
Lcy4g1484 . 48 260 SNARE and Associated Proteins AT1G51740 69.0 2.6e-81 299.3
Lcy10g2218 . 37 237 SNARE and Associated Proteins AT1G51740 70.3 5.5e-71 265.0
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0011407 0 1 0 1 0 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 1 2 1 1 1 30