Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Lcy11g0201	ATGGCGAAAATTCTAATTTCATCTTCACCCTTCGTCGGTTCTTCTCTCCCATCTCTCTCTCGCCATGGCCGTCTCCACACTCTTCCTCTCCGGAGACACGTCGCCACCAGAGTCAATTCCAGCTTCCATGAACTTCCCCCCATCCATACCTTTGATTACCCCATCAATTTTGAAGCAATTGTTAGCAGAGCCGAAGGCCTGCTCTATACACTTGCTGACGCAGCGGTTGCAGTGGATTCGACTGTTTCAGGTGGCGGGGCATCGAGTTCCGCAGATACTGCGGTGCAGAAGAATGGTGGATGGTTTGGATTTATCTCCGAGGCCATGGAAGTCGTTCTTAAAGTATTGAAGGATGGACTGGCGGCTGTGCATGTGCCATATGCATATGGATTTGCAATTATTTTACTTACTGTTATTGTTAAAGTTGCAACTTTTCCTCTTACCAAACAACAGGTTGAGTCAACATTGGCTATGCAAAATCTTCAACCAAAGATTAAAGCCATCCAACAAAGATATGCAGGCAATCAGGAAAGAATACAACTTGAGACATCACGGCTTTATAGACAAGCTGGAGTGAATCCTTTGGCAGGGTGCTTACCAACTTTGGCCACCATACCAGTTTGGATTGGACTATATCAAGCCCTTTCTAACGTGGCAAATGAGGGATTATTCACTGAAGGTTTCTTTTGGATTCCCTCCCTTGGTGGACCGACTACTATTGCTGCTCGACAAAGTGGAGCTGGAATCTCTTGGTTGTTTCCTTTTGTGAATCTACCCTTGGCCTTGGCTTTAACTGTAGTTGTACATAGCTCTATCAAACTTGGCCCATTTCCCATATTTCCTCTGCCTCTAATATTTTGCCTCACCCTTTTGAGCAGCTCTCAGTTTGTGGGGCTGATTTCACTTTCATCCGTCCAAGGACTGGGGACATTTGGTTTGGGATTTTTCCATGGGTTGTGTTAG	963	45.69	MAKILISSSPFVGSSLPSLSRHGRLHTLPLRRHVATRVNSSFHELPPIHTFDYPINFEAIVSRAEGLLYTLADAAVAVDSTVSGGGASSSADTAVQKNGGWFGFISEAMEVVLKVLKDGLAAVHVPYAYGFAIILLTVIVKVATFPLTKQQVESTLAMQNLQPKIKAIQQRYAGNQERIQLETSRLYRQAGVNPLAGCLPTLATIPVWIGLYQALSNVANEGLFTEGFFWIPSLGGPTTIAARQSGAGISWLFPFVNLPLALALTVVVHSSIKLGPFPIFPLPLIFCLTLLSSSQFVGLISLSSVQGLGTFGLGFFHGLC	320

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
11	2407301	2416786	+	Maker00005987	Lcy11g0201	646102

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Lcy11g0201	320	Pfam	60Kd inner membrane protein	129	274	IPR028055	-
Lcy11g0201	320	CDD	5TM_YidC_Alb3	130	240	IPR047196	-
Lcy11g0201	320	PANTHER	OXA1	35	293	IPR001708	GO:0009535(PANTHER)\|GO:0010027(PANTHER)\|GO:0016020(InterPro)\|GO:0032977(InterPro)\|GO:0032977(PANTHER)\|GO:0051205(PANTHER)\|GO:0072598(PANTHER)
Lcy11g0201	320	NCBIfam	membrane protein insertase YidC	129	272	IPR028055	-

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Lcy11g0201	K03217	-	-	csv:101217620	419.083

Dupl-types

Select	Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
	Lcy11g0201	Lcy-Chr11:2407301	Lcy13g1727	Lcy-Chr13:36240089	6.57E-58	dispersed

Deco-Alignment

Select	Vvi1	Blo1	Blo2	Bda1	Bda2	Bpe1	Bpe2	Bma1	Bma2	Cmo1	Cmo2	Cma1	Cma2	Car1	Car2	Sed1	Cpe1	Cpe2	Bhi1	Tan1	Cmetu1	Lac1	Hepe1	Mch1	Lcy1	Cla1	Cam1	Cec1	Cco1	Clacu1	Cmu1	Cre1	Cone1	Cone2	Cone3	Cone4	Lsi1	Csa1	Chy1	Cme1	Blo3	Blo4	Bda3	Bda4	Bpe3	Bpe4	Bma3	Bma4	Sed2	Cmo3	Cmo4	Cma3	Cma4	Car3	Car4	Cpe3	Cpe4	Bhi2	Tan2	Cmetu2	Lac2	Hepe2	Mch2	Lcy2	Cla2	Cam2	Cec2	Cco2	Clacu2	Cmu2	Cre2	Lsi2	Csa2	Chy2	Cme2
	Vvi6g422	.	Blo03g01240	.	.	.	.	.	Bma07g01536	Cmo01g00616	.	Cma01g00591	.	Car01g00538	.	Sed13g1378	.	.	Bhi08g00625	Tan01g2469	Cmetu12g1488	.	Hepe10g1213	.	Lcy11g0201	.	.	.	.	.	.	.	.	.	Cone18ag0342	Cone11ag1248	Lsi02g01367	.	.	.	.	.	.	Bda09g00155	.	Bpe11g00765	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Cla03g00157	Cam03g0164	Cec03g0162	Cco03g0170	Clacu03g0166	Cmu03g0783	Cre03g0477	.	Csa01g02395	Chy12g00180	Cme12g00204

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Lcy13g1727	.	73	410	Chloroplast and Mitochondria Gene Families	AT2G28800	51.9	4.9e-83	305.8
Lcy11g0201	.	1	313	Chloroplast and Mitochondria Gene Families	AT2G28800	52.2	9.3e-74	275.0
Lcy10g1345	.	3	264	Chloroplast and Mitochondria Gene Families	AT1G15820	78.0	7.6e-116	414.1
Lcy9g0892	.	22	204	Chloroplast and Mitochondria Gene Families	AT1G15820	79.8	1.1e-85	313.9
Lcy4g0371	.	1	266	Chloroplast and Mitochondria Gene Families	AT3G27690	89.9	1.5e-144	509.6
Lcy1g0204	.	2	266	Chloroplast and Mitochondria Gene Families	AT3G27690	77.5	7.0e-121	431.0
Lcy1g0203	.	2	266	Chloroplast and Mitochondria Gene Families	AT3G27690	77.1	1.6e-120	429.9
Lcy12g0389	.	179	447	Chloroplast and Mitochondria Gene Families	AT3G27690	76.5	5.9e-120	427.9
Lcy5g1745	.	111	378	Chloroplast and Mitochondria Gene Families	AT3G27690	77.0	1.0e-119	427.2
Lcy5g1744	.	2	266	Chloroplast and Mitochondria Gene Families	AT3G27690	77.5	1.7e-119	426.4
Lcy5g1746	.	2	266	Chloroplast and Mitochondria Gene Families	AT3G27690	77.5	1.7e-119	426.4
Lcy8g1625	.	2	263	Chloroplast and Mitochondria Gene Families	AT3G27690	78.1	1.5e-118	423.3
Lcy6g1248	.	131	351	Chloroplast and Mitochondria Gene Families	AT3G27690	76.6	1.3e-95	347.1
Lcy7g1305	.	2	160	Chloroplast and Mitochondria Gene Families	AT3G27690	65.7	2.7e-56	216.5
Lcy2g0986	.	54	259	Chloroplast and Mitochondria Gene Families	AT3G61470	65.5	1.1e-85	313.9
Lcy7g0042	.	1	151	Chloroplast and Mitochondria Gene Families	AT3G61470	92.7	1.2e-84	310.5
Lcy2g0568	.	22	249	Chloroplast and Mitochondria Gene Families	AT3G61470	51.7	8.0e-65	244.6
Lcy5g2537	.	22	245	Chloroplast and Mitochondria Gene Families	AT3G61470	51.1	1.7e-62	236.9
Lcy13g2071	.	42	252	Chloroplast and Mitochondria Gene Families	AT3G61470	50.5	1.4e-53	207.2
Lcy10g1770	.	1	198	Chloroplast and Mitochondria Gene Families	AT3G54890	82.1	1.6e-90	329.7
Lcy10g1511	.	1	161	Chloroplast and Mitochondria Gene Families	AT3G54890	77.0	3.9e-65	245.4
Lcy1g1546	.	1	287	Chloroplast and Mitochondria Gene Families	AT3G08940	82.4	1.8e-134	476.1
Lcy5g0115	.	5	286	Chloroplast and Mitochondria Gene Families	AT3G08940	83.7	2.6e-133	472.2
Lcy9g2374	.	3	177	Chloroplast and Mitochondria Gene Families	AT1G76570	81.7	1.1e-87	320.9
Lcy2g1328	.	1	293	Chloroplast and Mitochondria Gene Families	AT1G61520	80.2	1.4e-131	466.5
Lcy4g0371	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G05070	89.8	2.3e-144	508.8
Lcy1g0204	.	4	266	Chloroplast and Mitochondria Gene Families	AT2G05070	78.7	2.4e-120	429.1
Lcy1g0203	.	5	266	Chloroplast and Mitochondria Gene Families	AT2G05070	78.7	5.3e-120	427.9
Lcy5g1744	.	5	266	Chloroplast and Mitochondria Gene Families	AT2G05070	79.0	9.0e-120	427.2
Lcy5g1746	.	5	266	Chloroplast and Mitochondria Gene Families	AT2G05070	79.0	9.0e-120	427.2
Lcy5g1745	.	117	378	Chloroplast and Mitochondria Gene Families	AT2G05070	79.0	9.0e-120	427.2
Lcy12g0389	.	208	447	Chloroplast and Mitochondria Gene Families	AT2G05070	83.8	1.4e-117	419.9
Lcy8g1625	.	7	263	Chloroplast and Mitochondria Gene Families	AT2G05070	79.0	3.2e-117	418.7
Lcy6g1248	.	131	351	Chloroplast and Mitochondria Gene Families	AT2G05070	77.0	1.2e-95	347.1
Lcy7g1305	.	7	160	Chloroplast and Mitochondria Gene Families	AT2G05070	67.9	8.3e-57	218.0
Lcy4g0371	.	1	237	Chloroplast and Mitochondria Gene Families	AT2G05100	89.9	1.7e-125	446.4
Lcy1g0204	.	4	237	Chloroplast and Mitochondria Gene Families	AT2G05100	76.1	2.2e-101	366.3
Lcy1g0203	.	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	75.9	5.0e-101	365.2
Lcy5g1744	.	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	77.4	5.0e-101	365.2
Lcy5g1746	.	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	77.4	5.0e-101	365.2
Lcy5g1745	.	117	349	Chloroplast and Mitochondria Gene Families	AT2G05100	77.4	5.0e-101	365.2
Lcy8g1625	.	7	239	Chloroplast and Mitochondria Gene Families	AT2G05100	77.4	5.0e-101	365.2
Lcy12g0389	.	189	418	Chloroplast and Mitochondria Gene Families	AT2G05100	77.6	1.6e-99	360.1
Lcy6g1248	.	131	322	Chloroplast and Mitochondria Gene Families	AT2G05100	76.7	8.3e-80	294.7
Lcy7g1305	.	7	160	Chloroplast and Mitochondria Gene Families	AT2G05100	68.1	4.9e-56	215.7
Lcy1g1546	.	4	168	Chloroplast and Mitochondria Gene Families	AT2G40100	73.4	2.8e-67	252.3
Lcy5g0115	.	1	171	Chloroplast and Mitochondria Gene Families	AT2G40100	68.0	4.1e-63	238.4
Lcy1g0203	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29930	89.2	2.4e-136	482.3
Lcy5g1744	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29930	88.1	4.0e-136	481.5
Lcy5g1746	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29930	88.1	4.0e-136	481.5
Lcy1g0204	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29930	88.8	5.3e-136	481.1
Lcy5g1745	.	113	378	Chloroplast and Mitochondria Gene Families	AT1G29930	87.7	9.0e-136	480.3
Lcy8g1625	.	1	263	Chloroplast and Mitochondria Gene Families	AT1G29930	89.0	4.9e-134	474.6
Lcy12g0389	.	185	447	Chloroplast and Mitochondria Gene Families	AT1G29930	85.3	3.8e-126	448.4
Lcy4g0371	.	3	266	Chloroplast and Mitochondria Gene Families	AT1G29930	78.4	2.7e-116	415.6
Lcy6g1248	.	132	351	Chloroplast and Mitochondria Gene Families	AT1G29930	75.1	5.0e-94	341.7
Lcy7g1305	.	1	160	Chloroplast and Mitochondria Gene Families	AT1G29930	83.1	4.1e-72	268.9
Lcy2g1692	.	1	119	Chloroplast and Mitochondria Gene Families	AT1G29930	75.6	5.8e-42	168.7
Lcy1g0203	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29920	88.8	9.0e-136	480.3
Lcy5g1744	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29920	87.7	1.5e-135	479.6
Lcy5g1746	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29920	87.7	1.5e-135	479.6
Lcy1g0204	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29920	88.4	2.0e-135	479.2
Lcy5g1745	.	113	378	Chloroplast and Mitochondria Gene Families	AT1G29920	87.3	3.4e-135	478.4
Lcy8g1625	.	1	263	Chloroplast and Mitochondria Gene Families	AT1G29920	89.0	3.8e-134	474.9
Lcy12g0389	.	185	447	Chloroplast and Mitochondria Gene Families	AT1G29920	85.3	4.9e-126	448.0
Lcy4g0371	.	3	266	Chloroplast and Mitochondria Gene Families	AT1G29920	78.0	1.6e-116	416.4
Lcy6g1248	.	132	351	Chloroplast and Mitochondria Gene Families	AT1G29920	75.1	5.0e-94	341.7
Lcy7g1305	.	1	160	Chloroplast and Mitochondria Gene Families	AT1G29920	82.5	1.6e-71	266.9
Lcy2g1692	.	1	119	Chloroplast and Mitochondria Gene Families	AT1G29920	74.8	2.2e-41	166.8
Lcy1g0203	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29910	88.8	9.0e-136	480.3
Lcy5g1744	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29910	87.7	1.5e-135	479.6
Lcy5g1746	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29910	87.7	1.5e-135	479.6
Lcy1g0204	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29910	88.4	2.0e-135	479.2
Lcy5g1745	.	113	378	Chloroplast and Mitochondria Gene Families	AT1G29910	87.3	3.4e-135	478.4
Lcy8g1625	.	1	263	Chloroplast and Mitochondria Gene Families	AT1G29910	89.0	3.8e-134	474.9
Lcy12g0389	.	185	447	Chloroplast and Mitochondria Gene Families	AT1G29910	85.3	4.9e-126	448.0
Lcy4g0371	.	3	266	Chloroplast and Mitochondria Gene Families	AT1G29910	78.0	1.6e-116	416.4
Lcy6g1248	.	132	351	Chloroplast and Mitochondria Gene Families	AT1G29910	75.1	5.0e-94	341.7
Lcy7g1305	.	1	160	Chloroplast and Mitochondria Gene Families	AT1G29910	82.5	1.6e-71	266.9
Lcy2g1692	.	1	119	Chloroplast and Mitochondria Gene Families	AT1G29910	74.8	2.2e-41	166.8
Lcy9g0400	.	11	304	Chloroplast and Mitochondria Gene Families	AT4G10340	80.6	2.6e-133	472.2
Lcy5g1744	.	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.0	6.7e-57	218.4
Lcy5g1746	.	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.0	6.7e-57	218.4
Lcy1g0204	.	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.0	1.1e-56	217.6
Lcy1g0203	.	37	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.0	1.1e-56	217.6
Lcy5g1745	.	149	365	Chloroplast and Mitochondria Gene Families	AT4G10340	51.6	1.5e-56	217.2
Lcy8g1625	.	51	255	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	1.5e-56	217.2
Lcy12g0389	.	230	434	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	1.5e-56	217.2
Lcy4g0371	.	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.6	4.0e-54	209.1
Lcy6g1248	.	132	338	Chloroplast and Mitochondria Gene Families	AT4G10340	54.0	3.8e-52	202.6
Lcy5g1744	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34420	87.7	7.5e-135	477.2
Lcy5g1746	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34420	87.7	7.5e-135	477.2
Lcy1g0203	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34420	88.4	9.9e-135	476.9
Lcy5g1745	.	113	378	Chloroplast and Mitochondria Gene Families	AT2G34420	87.3	1.7e-134	476.1
Lcy1g0204	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34420	88.1	2.2e-134	475.7
Lcy8g1625	.	1	263	Chloroplast and Mitochondria Gene Families	AT2G34420	89.0	2.4e-133	472.2
Lcy12g0389	.	185	447	Chloroplast and Mitochondria Gene Families	AT2G34420	85.7	7.6e-127	450.7
Lcy4g0371	.	3	266	Chloroplast and Mitochondria Gene Families	AT2G34420	77.2	5.4e-117	417.9
Lcy6g1248	.	132	351	Chloroplast and Mitochondria Gene Families	AT2G34420	75.6	6.5e-94	341.3
Lcy7g1305	.	1	160	Chloroplast and Mitochondria Gene Families	AT2G34420	82.5	4.5e-71	265.4
Lcy2g1692	.	1	119	Chloroplast and Mitochondria Gene Families	AT2G34420	73.9	2.4e-40	163.3
Lcy1g0203	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34430	89.9	1.4e-136	483.0
Lcy5g1744	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34430	87.6	1.8e-136	482.6
Lcy5g1746	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34430	87.6	1.8e-136	482.6
Lcy1g0204	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34430	89.6	3.1e-136	481.9
Lcy5g1745	.	113	378	Chloroplast and Mitochondria Gene Families	AT2G34430	87.3	4.0e-136	481.5
Lcy8g1625	.	1	263	Chloroplast and Mitochondria Gene Families	AT2G34430	87.9	9.3e-133	470.3
Lcy12g0389	.	185	447	Chloroplast and Mitochondria Gene Families	AT2G34430	86.0	1.1e-128	456.8
Lcy4g0371	.	31	266	Chloroplast and Mitochondria Gene Families	AT2G34430	83.3	1.5e-114	409.8
Lcy6g1248	.	132	351	Chloroplast and Mitochondria Gene Families	AT2G34430	75.6	8.5e-94	340.9
Lcy7g1305	.	1	160	Chloroplast and Mitochondria Gene Families	AT2G34430	80.6	1.5e-69	260.4
Lcy2g1692	.	1	119	Chloroplast and Mitochondria Gene Families	AT2G34430	74.8	4.4e-42	169.1
Lcy5g0115	.	1	286	Chloroplast and Mitochondria Gene Families	AT5G01530	85.5	3.2e-139	491.9
Lcy1g1546	.	1	287	Chloroplast and Mitochondria Gene Families	AT5G01530	82.8	1.0e-137	486.9
Lcy6g1094	.	48	308	Chloroplast and Mitochondria Gene Families	AT5G40810	93.9	6.7e-144	507.3
Lcy6g1094	.	1	308	Chloroplast and Mitochondria Gene Families	AT3G27240	85.9	5.6e-150	527.7
Lcy8g1714	.	5	334	Chloroplast and Mitochondria Gene Families	AT2G30160	74.3	2.1e-142	502.7
Lcy1g1585	.	18	319	Chloroplast and Mitochondria Gene Families	AT2G30160	68.1	2.6e-116	416.0
Lcy8g1714	.	5	336	Chloroplast and Mitochondria Gene Families	AT1G07030	74.3	1.1e-140	496.9
Lcy1g1585	.	14	319	Chloroplast and Mitochondria Gene Families	AT1G07030	70.7	1.4e-122	436.8
Lcy3g1776	.	1	341	Chloroplast and Mitochondria Gene Families	AT2G47490	68.7	1.2e-128	456.8
Lcy10g1474	.	11	364	Chloroplast and Mitochondria Gene Families	AT2G47490	53.2	8.4e-101	364.4
Lcy10g1474	.	10	414	Chloroplast and Mitochondria Gene Families	AT1G25380	56.4	5.1e-118	421.8
Lcy3g1776	.	11	333	Chloroplast and Mitochondria Gene Families	AT1G25380	56.8	3.1e-99	359.4
Lcy4g0618	.	4	584	Chloroplast and Mitochondria Gene Families	AT4G21490	63.6	8.8e-221	763.8
Lcy8g1504	.	1	544	Chloroplast and Mitochondria Gene Families	AT4G21490	64.6	1.7e-216	749.6
Lcy5g1939	.	5	520	Chloroplast and Mitochondria Gene Families	AT4G21490	72.0	1.5e-215	746.5
Lcy2g1698	.	4	179	Chloroplast and Mitochondria Gene Families	AT1G17530	58.4	6.1e-51	198.0
Lcy2g1698	.	12	184	Chloroplast and Mitochondria Gene Families	AT3G04800	59.2	1.3e-51	200.3
Lcy2g1698	.	5	184	Chloroplast and Mitochondria Gene Families	AT1G72750	58.5	1.1e-52	203.8
Lcy7g0409	.	1	240	Chloroplast and Mitochondria Gene Families	AT1G26100	59.2	6.6e-74	274.6
Lcy10g2110	.	1	226	Chloroplast and Mitochondria Gene Families	AT5G38630	70.5	8.4e-90	327.4
Lcy12g0015	.	23	261	Chloroplast and Mitochondria Gene Families	AT4G25570	58.5	1.9e-75	280.0
Lcy10g1034	.	9	417	Chloroplast and Mitochondria Gene Families	AT5G14040	71.7	1.9e-163	572.8
Lcy10g0054	.	9	365	Chloroplast and Mitochondria Gene Families	AT5G14040	75.8	1.1e-155	547.0
Lcy2g0022	.	39	329	Chloroplast and Mitochondria Gene Families	AT5G14040	86.6	9.0e-150	527.3
Lcy4g0439	.	11	292	Chloroplast and Mitochondria Gene Families	AT5G14040	51.0	1.8e-81	300.4
Lcy10g0054	.	6	365	Chloroplast and Mitochondria Gene Families	AT3G48850	70.5	2.3e-142	502.7
Lcy2g0022	.	6	329	Chloroplast and Mitochondria Gene Families	AT3G48850	69.4	1.4e-136	483.4
Lcy10g1034	.	8	405	Chloroplast and Mitochondria Gene Families	AT3G48850	62.3	3.2e-136	482.3
Lcy4g0439	.	8	298	Chloroplast and Mitochondria Gene Families	AT2G17270	73.8	1.7e-125	446.4
Lcy10g0054	.	67	365	Chloroplast and Mitochondria Gene Families	AT2G17270	52.3	7.6e-86	314.7
Lcy2g0022	.	44	328	Chloroplast and Mitochondria Gene Families	AT2G17270	50.2	2.1e-80	296.6
Lcy10g2070	.	16	312	Chloroplast and Mitochondria Gene Families	AT5G15640	77.3	1.6e-128	456.4
Lcy11g1313	.	17	317	Chloroplast and Mitochondria Gene Families	AT5G15640	50.2	2.4e-79	293.1
Lcy6g0134	.	176	257	Chloroplast and Mitochondria Gene Families	AT5G52570	91.5	1.4e-39	160.6
Lcy12g1621	.	23	213	Chloroplast and Mitochondria Gene Families	AT4G25700	60.6	1.4e-60	230.3
Lcy4g0619	.	130	305	Chloroplast and Mitochondria Gene Families	AT4G03320	52.5	2.0e-56	216.9
Lcy6g1237	.	52	359	Chloroplast and Mitochondria Gene Families	AT5G54290	75.5	1.8e-120	429.9
Lcy2g0229	.	100	583	Chloroplast and Mitochondria Gene Families	AT2G18710	85.5	2.7e-235	812.0

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0009477	1	1	1	1	2	1	1	1	1	1	1	1	1	1	1	1	1	2	1	1	1	1	1	1	1	1	0	1	1	1	31