Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Lcy9g1185 ATGCCATCGGCTCAGGATCCGTTCTATGTTGTAAAAGACGAGATTCAAGAATCTATTGATAAACTGCAATCCAGCTTTCACCAATGGGAAAGGATATCTTCTGATCCAGGAGAGAGAGTACAACTCACAAAAGAGTTGCTCGCTTCCTGTGAGAGCATTGAGTGGCAGGTGGACGAATTGGACAAAGCTATTGCTGTGGCAGCTAGAGATCCTTCTTGGTATGGCATTGATGAAGCAGAACTTGAAAAACGTAGGAGATGGACGAGTACAGCTAGGACACAGGTTGGAAATGTTAAGAAAGTAGTGGGAGCTGGAATGGAGCAAACTGGAACTGCCAGTGCAAATGGGATGCGTCGAGAATTGATGAGACTACCTAATGCACATGAAACAGAGAGATCAAACTTATATACAGCCCACCAAGCAAATGATGACTTCATCACATCCGAATCAGATAGGCAGCTGCTTCTCATAAAGCAGCAGGACGAAGAGTTGGATGAGCTGAGTGCAAGCGTGGAGAGAATTGGAGGTGTTGGGCTTACAATACATGAAGAACTCCTCGCACAGGATAAAATTATTGACGAGCTAGGAATGGAAATGGACAGTACATCAAATCGTCTCGATTTCGTTCAGAAAAAAGTGGCTGTGGTAATGAAGAAGGCCAGCGCCAAGGGCCAGATAATGATGATATTGTTCTTGGTGGCTTTGTTCATCATCCTTTTTGTGTTGGTGTTCCTCACCTAG 741 44.53 MPSAQDPFYVVKDEIQESIDKLQSSFHQWERISSDPGERVQLTKELLASCESIEWQVDELDKAIAVAARDPSWYGIDEAELEKRRRWTSTARTQVGNVKKVVGAGMEQTGTASANGMRRELMRLPNAHETERSNLYTAHQANDDFITSESDRQLLLIKQQDEELDELSASVERIGGVGLTIHEELLAQDKIIDELGMEMDSTSNRLDFVQKKVAVVMKKASAKGQIMMILFLVALFIILFVLVFLT 246
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
9 36239067 36245105 + Maker00017905 Lcy9g1185 642301

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Lcy9g1185 246 FunFam Syntaxin 10 3 105 - -
Lcy9g1185 246 SMART tSNARE_6 149 216 IPR000727 -
Lcy9g1185 246 Pfam Syntaxin 6, N-terminal 6 99 IPR015260 GO:0016020(InterPro)|GO:0048193(InterPro)
Lcy9g1185 246 SUPERFAMILY SNARE fusion complex 153 216 - -
Lcy9g1185 246 SUPERFAMILY t-snare proteins 5 100 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Lcy9g1185 246 CDD SNARE_NTD_AtSYP61-like 5 102 - -
Lcy9g1185 246 CDD SNARE_Qc 157 214 - -
Lcy9g1185 246 Pfam SNARE domain 191 242 IPR000727 -
Lcy9g1185 246 Gene3D - 2 104 - -
Lcy9g1185 246 PANTHER SYNTAXIN 11 235 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Lcy9g1185 246 Gene3D - 161 225 - -
Lcy9g1185 246 ProSitePatterns Syntaxin / epimorphin family signature. 160 199 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Lcy9g1185 246 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 154 216 IPR000727 -
Lcy9g1185 246 Coils Coil 192 212 - -
Lcy9g1185 246 FunFam syntaxin-61 isoform X1 157 218 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Lcy9g1185 K08500 - - csv:101212527 419.083
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Lcy13g1316 . 8 286 SNARE and Associated Proteins AT3G24350 63.0 1.1e-80 297.7
Lcy1g1665 . 1 309 SNARE and Associated Proteins AT1G08560 69.7 4.7e-104 375.2
Lcy11g0712 . 106 296 SNARE and Associated Proteins AT1G08560 50.5 1.1e-44 177.9
Lcy1g0704 . 405 709 SNARE and Associated Proteins AT2G18260 55.6 6.7e-87 318.2
Lcy5g0507 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.5e-115 412.1
Lcy5g2615 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 3.5e-115 412.1
Lcy1g1206 . 23 281 SNARE and Associated Proteins AT3G11820 72.6 1.7e-101 366.7
Lcy5g1935 . 31 281 SNARE and Associated Proteins AT3G11820 66.9 6.5e-93 338.2
Lcy11g0712 . 91 296 SNARE and Associated Proteins AT3G11820 57.3 4.3e-60 229.2
Lcy5g0507 . 1 279 SNARE and Associated Proteins AT3G52400 63.6 8.6e-91 331.3
Lcy5g2615 . 1 279 SNARE and Associated Proteins AT3G52400 63.6 8.6e-91 331.3
Lcy1g1206 . 1 281 SNARE and Associated Proteins AT3G52400 60.1 4.9e-86 315.5
Lcy5g1935 . 1 281 SNARE and Associated Proteins AT3G52400 56.4 2.1e-81 300.1
Lcy11g0712 . 88 296 SNARE and Associated Proteins AT3G52400 53.6 9.3e-53 204.9
Lcy5g1935 . 1 299 SNARE and Associated Proteins AT4G03330 69.2 2.4e-108 389.4
Lcy5g0507 . 1 279 SNARE and Associated Proteins AT4G03330 57.5 1.0e-82 304.3
Lcy5g2615 . 1 279 SNARE and Associated Proteins AT4G03330 57.5 1.0e-82 304.3
Lcy1g1206 . 1 287 SNARE and Associated Proteins AT4G03330 54.3 6.8e-79 291.6
Lcy11g0712 . 91 296 SNARE and Associated Proteins AT4G03330 59.2 2.4e-60 229.9
Lcy5g1935 . 1 303 SNARE and Associated Proteins AT1G61290 78.9 1.6e-128 456.4
Lcy5g0507 . 1 279 SNARE and Associated Proteins AT1G61290 62.3 5.9e-91 331.6
Lcy5g2615 . 1 279 SNARE and Associated Proteins AT1G61290 62.3 5.9e-91 331.6
Lcy1g1206 . 1 287 SNARE and Associated Proteins AT1G61290 56.4 5.9e-83 305.1
Lcy11g0712 . 88 296 SNARE and Associated Proteins AT1G61290 54.1 4.2e-57 219.2
Lcy5g1935 . 1 303 SNARE and Associated Proteins AT1G11250 77.9 1.6e-125 446.4
Lcy5g0507 . 1 279 SNARE and Associated Proteins AT1G11250 63.1 1.6e-93 340.1
Lcy5g2615 . 1 279 SNARE and Associated Proteins AT1G11250 63.1 1.6e-93 340.1
Lcy1g1206 . 1 287 SNARE and Associated Proteins AT1G11250 57.8 5.6e-86 315.1
Lcy11g0712 . 88 296 SNARE and Associated Proteins AT1G11250 55.5 2.0e-59 226.9
Lcy11g0712 . 90 320 SNARE and Associated Proteins AT3G03800 77.5 5.3e-92 335.1
Lcy11g0712 . 90 214 SNARE and Associated Proteins AT5G08080 82.4 2.3e-52 203.0
Lcy6g2242 . 5 158 SNARE and Associated Proteins AT5G16830 59.7 7.4e-40 161.8
Lcy6g2242 . 4 129 SNARE and Associated Proteins AT5G46860 80.2 1.3e-46 184.1
Lcy6g2242 . 4 129 SNARE and Associated Proteins AT4G17730 77.0 5.9e-47 185.3
Lcy6g2242 . 2 157 SNARE and Associated Proteins AT1G32270 60.9 2.5e-42 170.2
Lcy7g0975 . 1 334 SNARE and Associated Proteins AT5G05760 66.9 4.2e-114 408.7
Lcy13g1316 . 8 286 SNARE and Associated Proteins AT3G24350 63.0 1.1e-80 297.7
Lcy4g1808 . 1 311 SNARE and Associated Proteins AT5G26980 70.4 3.3e-116 415.6
Lcy3g1779 . 1 320 SNARE and Associated Proteins AT5G26980 67.1 2.2e-104 376.3
Lcy10g0262 . 79 263 SNARE and Associated Proteins AT5G26980 58.9 2.3e-45 180.3
Lcy3g1779 . 1 320 SNARE and Associated Proteins AT4G02195 66.3 2.2e-104 376.3
Lcy4g1808 . 1 314 SNARE and Associated Proteins AT4G02195 59.1 3.9e-93 339.0
Lcy10g0262 . 79 263 SNARE and Associated Proteins AT4G02195 58.3 6.5e-48 188.7
Lcy4g1808 . 1 312 SNARE and Associated Proteins AT3G05710 68.6 1.6e-113 406.8
Lcy3g1779 . 1 323 SNARE and Associated Proteins AT3G05710 63.7 5.8e-100 361.7
Lcy10g0262 . 71 263 SNARE and Associated Proteins AT3G05710 58.0 4.1e-45 179.5
Lcy9g1162 . 137 318 SNARE and Associated Proteins AT1G16240 70.5 5.9e-67 251.5
Lcy6g1648 . 12 188 SNARE and Associated Proteins AT1G16240 68.1 7.5e-62 234.6
Lcy9g1162 . 137 318 SNARE and Associated Proteins AT1G79590 68.9 5.1e-67 251.9
Lcy6g1648 . 6 188 SNARE and Associated Proteins AT1G79590 67.5 8.8e-67 251.1
Lcy9g1185 . 56 247 SNARE and Associated Proteins AT1G28490 71.9 2.5e-66 249.2
Lcy5g0279 . 44 304 SNARE and Associated Proteins AT3G09740 79.5 2.6e-111 399.1
Lcy1g2796 . 1 286 SNARE and Associated Proteins AT3G09740 61.8 4.4e-90 328.6
Lcy1g2792 . 1 286 SNARE and Associated Proteins AT3G09740 61.5 2.2e-89 326.2
Lcy8g1893 . 1 283 SNARE and Associated Proteins AT3G09740 58.6 2.0e-82 303.1
Lcy5g0279 . 44 307 SNARE and Associated Proteins AT3G45280 64.0 9.1e-88 320.9
Lcy1g2796 . 1 286 SNARE and Associated Proteins AT3G45280 59.7 3.0e-83 305.8
Lcy1g2792 . 1 286 SNARE and Associated Proteins AT3G45280 59.4 1.5e-82 303.5
Lcy8g1893 . 1 283 SNARE and Associated Proteins AT3G45280 56.5 1.8e-75 280.0
Lcy5g0279 . 44 304 SNARE and Associated Proteins AT3G61450 67.8 5.8e-95 344.7
Lcy1g2792 . 1 287 SNARE and Associated Proteins AT3G61450 55.9 3.6e-81 298.9
Lcy1g2796 . 1 287 SNARE and Associated Proteins AT3G61450 55.9 4.7e-81 298.5
Lcy8g1893 . 1 284 SNARE and Associated Proteins AT3G61450 53.7 1.1e-74 277.3
Lcy4g1484 . 48 260 SNARE and Associated Proteins AT1G51740 69.0 2.6e-81 299.3
Lcy10g2218 . 37 237 SNARE and Associated Proteins AT1G51740 70.3 5.5e-71 265.0
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003549 2 1 2 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 5 4 0 44