Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Lsi02g01877 ATGGCGTATACTTTGGAATCATGGACGAAGGAATACAATGAAGCTTTGAAACTCTCTGAAGATATCAATGGCATGATTTCTGAGAGAAGTTCACTTGCTGCATCTGGACCAGAAGCTCAGCGTCATGCCTCAGCTATACGCAGGAAGATCACAATATTGGGTACCAGGCTTGATACCTTGCAGACTCAGTTACCCAAGCTTCAAGGAAAGCAACCAATACCAGAGAAAGAGATGAATCGCCGCAGGGATATGATTGCAAATTTGAGATCAAAAGCTAAGCAGATGGCTTCAACTTTGAACATGTCTAACTTTGCTAACCGGGATAGCTTACTTGGTCCAGAAATAAAGCCAGCTGATGTCATGAACAGAACAGAAGGCTTAGACAACCGAGGCCTCGTTGAGCAAGATGAAGGCCTTGAGAAACTGGAAGGGACTATAATTAGCACAAAACATATTGCATTAGCCGTCAATGAAGAACTTAACCTTCACACGAGACTTATTGATGATTTGGATGAACATGTCGATGTTACAGATTCCAGATTACGGCGAGTGCAGAAGAGGCTGGCAATATTGAACAAGCGGACTAAGGGTGGTTGCACTTGCATGTCAATGATTTTATCAGTTGTTGGGATTGTCGTTCTTATCGCTGTCATATGGCTACTCATCAAGTATTTGTAA 678 42.63 MAYTLESWTKEYNEALKLSEDINGMISERSSLAASGPEAQRHASAIRRKITILGTRLDTLQTQLPKLQGKQPIPEKEMNRRRDMIANLRSKAKQMASTLNMSNFANRDSLLGPEIKPADVMNRTEGLDNRGLVEQDEGLEKLEGTIISTKHIALAVNEELNLHTRLIDDLDEHVDVTDSRLRRVQKRLAILNKRTKGGCTCMSMILSVVGIVVLIAVIWLLIKYL 225
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
2 24587361 24589885 - Lsi02G018770.1 Lsi02g01877 656619

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Lsi02g01877 225 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 134 191 IPR000727 -
Lsi02g01877 225 PANTHER TARGET SNARE COILED-COIL DOMAIN-CONTAINING PROTEIN-RELATED 6 220 - -
Lsi02g01877 225 SMART tSNARE_6 123 191 IPR000727 -
Lsi02g01877 225 PANTHER SYNTAXIN 6 220 IPR045242 -
Lsi02g01877 225 SUPERFAMILY SNARE fusion complex 133 190 - -
Lsi02g01877 225 Gene3D - 131 193 - -
Lsi02g01877 225 Pfam SNARE domain 166 216 IPR000727 -
Lsi02g01877 225 CDD SNARE_Qc 134 189 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Lsi02g01877 K08503 SYP5; syntaxin of plants SYP5 - csv:101208669 398.667
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Lsi09g01890 Lsi-Chr9:27715983 Lsi02g01877 Lsi-Chr2:24587361 1.84E-08 transposed
Lsi02g01877 Lsi-Chr2:24587361 Lsi05g00543 Lsi-Chr5:6752568 1.08E-116 wgd
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi19g583 Blo03g00538 . Bda07g00381 Bda09g00411 . Bpe08g01109 . . Cmo16g00959 . Cma01g01111 Cma09g00975 Car01g00980 Car09g00889 Sed07g2705 Cpe06g00787 Cpe02g00792 Bhi09g01700 Tan01g3132 Cmetu01g0482 . Hepe01g1245 Mch11g1220 . . . . . . . . Cone6ag0041 Cone9ag0047 Cone14ag1185 Cone15ag1202 Lsi02g01877 . . . . . Bda05g00693 . . Bpe03g00767 Bma07g01281 Bma14g00320 . Cmo01g01156 Cmo09g00974 . Cma16g00924 . Car16g00895 Cpe14g00748 . . . . . . . . Cla09g01036 Cam09g1092 Cec09g1092 Cco09g1113 . . Cre09g1057 . . Chy01g01059 Cme01g00994
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Lsi08g01147 . 8 338 SNARE and Associated Proteins AT3G24350 65.1 4.7e-102 368.2
Lsi01g01659 . 1 309 SNARE and Associated Proteins AT1G08560 69.0 1.0e-100 363.6
Lsi01g00668 . 428 710 SNARE and Associated Proteins AT2G18260 55.2 2.3e-81 299.3
Lsi03g01810 . 19 254 SNARE and Associated Proteins AT3G11820 80.5 1.4e-102 369.8
Lsi01g01181 . 26 282 SNARE and Associated Proteins AT3G11820 73.2 2.4e-102 369.0
Lsi02g00706 . 31 281 SNARE and Associated Proteins AT3G11820 66.9 7.8e-93 337.4
Lsi03g01319 . 12 236 SNARE and Associated Proteins AT3G11820 55.6 1.7e-63 240.0
Lsi01g01181 . 33 282 SNARE and Associated Proteins AT3G52400 65.2 6.5e-85 311.2
Lsi03g01810 . 1 255 SNARE and Associated Proteins AT3G52400 63.7 3.0e-82 302.4
Lsi02g00706 . 1 281 SNARE and Associated Proteins AT3G52400 56.7 1.5e-81 300.1
Lsi03g01319 . 11 236 SNARE and Associated Proteins AT3G52400 52.7 3.7e-56 215.7
Lsi02g00706 . 1 299 SNARE and Associated Proteins AT4G03330 68.5 2.4e-107 385.6
Lsi01g01181 . 1 298 SNARE and Associated Proteins AT4G03330 51.5 9.0e-78 287.3
Lsi03g01810 . 1 253 SNARE and Associated Proteins AT4G03330 59.1 2.9e-76 282.3
Lsi03g01319 . 10 236 SNARE and Associated Proteins AT4G03330 57.3 3.3e-64 242.3
Lsi02g00706 . 1 299 SNARE and Associated Proteins AT1G61290 78.6 4.7e-127 451.1
Lsi01g01181 . 1 293 SNARE and Associated Proteins AT1G61290 56.3 7.5e-85 310.8
Lsi03g01810 . 1 254 SNARE and Associated Proteins AT1G61290 63.8 7.1e-83 304.3
Lsi03g01319 . 10 236 SNARE and Associated Proteins AT1G61290 52.9 2.9e-60 229.2
Lsi02g00706 . 1 299 SNARE and Associated Proteins AT1G11250 77.6 4.7e-124 441.0
Lsi01g01181 . 1 293 SNARE and Associated Proteins AT1G11250 57.0 6.1e-87 317.8
Lsi03g01810 . 1 254 SNARE and Associated Proteins AT1G11250 63.0 9.7e-85 310.5
Lsi03g01319 . 12 236 SNARE and Associated Proteins AT1G11250 54.7 2.3e-62 236.1
Lsi03g01319 . 12 259 SNARE and Associated Proteins AT3G03800 76.6 5.4e-99 357.8
Lsi03g01319 . 12 154 SNARE and Associated Proteins AT5G08080 83.2 1.2e-60 229.9
Lsi07g01177 . 1 272 SNARE and Associated Proteins AT5G16830 56.5 8.0e-73 270.8
Lsi07g01177 . 1 272 SNARE and Associated Proteins AT5G46860 62.5 1.3e-77 286.6
Lsi07g01177 . 1 190 SNARE and Associated Proteins AT4G17730 76.4 1.7e-72 269.6
Lsi07g01177 . 65 272 SNARE and Associated Proteins AT1G32270 55.3 1.4e-50 197.2
Lsi04g00969 . 1 286 SNARE and Associated Proteins AT5G05760 64.5 6.6e-90 327.8
Lsi08g01147 . 8 338 SNARE and Associated Proteins AT3G24350 65.1 4.7e-102 368.2
Lsi11g00612 . 1 327 SNARE and Associated Proteins AT5G26980 75.8 1.1e-126 449.9
Lsi02g02441 . 1 286 SNARE and Associated Proteins AT5G26980 64.8 2.7e-88 322.4
Lsi11g00612 . 1 329 SNARE and Associated Proteins AT4G02195 64.7 3.7e-106 381.7
Lsi02g02441 . 1 286 SNARE and Associated Proteins AT4G02195 66.9 3.6e-93 338.6
Lsi11g00612 . 1 328 SNARE and Associated Proteins AT3G05710 75.4 9.3e-129 456.8
Lsi02g02441 . 1 286 SNARE and Associated Proteins AT3G05710 62.5 2.8e-85 312.4
Lsi02g01877 . 1 225 SNARE and Associated Proteins AT1G16240 69.5 2.4e-83 305.4
Lsi05g00543 . 23 286 SNARE and Associated Proteins AT1G16240 57.6 7.1e-75 277.3
Lsi02g01877 . 1 225 SNARE and Associated Proteins AT1G79590 68.7 2.3e-82 302.4
Lsi05g00543 . 23 286 SNARE and Associated Proteins AT1G79590 58.3 4.3e-76 281.6
Lsi09g01890 . 38 229 SNARE and Associated Proteins AT1G28490 72.9 3.2e-68 255.0
Lsi03g02035 . 38 327 SNARE and Associated Proteins AT3G09740 72.6 5.0e-109 391.0
Lsi10g01278 . 1 254 SNARE and Associated Proteins AT3G09740 60.7 4.9e-80 294.7
Lsi03g02035 . 38 327 SNARE and Associated Proteins AT3G45280 58.7 1.6e-83 306.2
Lsi10g01278 . 1 254 SNARE and Associated Proteins AT3G45280 57.7 1.4e-74 276.6
Lsi03g02035 . 38 324 SNARE and Associated Proteins AT3G61450 62.1 1.4e-90 329.7
Lsi10g01278 . 1 251 SNARE and Associated Proteins AT3G61450 54.9 2.4e-71 265.8
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002063 3 5 2 3 2 1 3 1 2 1 1 1 3 2 2 3 1 4 3 1 2 2 1 2 2 2 1 5 3 1 65