Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Lsi06g01458 ATGGCGTTTCTTGGATTTCTCTTGGTGGGTCTTCTTCTTTCTTTGGGATGTGATTCTGCTCTTGGTAACAACAATGGAGGAGGTTGGATTGATGCGCACGCCACATTCTACGGTGGGGGCGACGCTGCTGGTACAATGGGAGGGGCTTGTGGATATGGAAATCTGTATAGCCAGGGATATGGAACGAACACAGCAGCTCTGAGTACAGCTTTATTCAACAATGGACTGAGCTGTGGCGCTTGCTTTGAAATCAAATGTGTAAATGATGCAAAATGGTGTCTTCCAAAGTCCATTGTCGTCACTGCTACAAACTTTTGTCCGCCGAACAATGCACTCCCCAACAACGCCGGCGGCTGGTGCAACCCTCCCCAACACCATTTTGATCTCTCCCAACCCGTTTTCCAGCAAATCGCTCATTACAAAGCCGGCATTGTCCCAGTGGCATACAGAAGGGTGTCTTGTGAGAAGAAAGGAGGCATTAGATTCACAATCAATGGCCATTCGTACTTCAATTTAGTGCTTATAACCAACGTCGGGGGAGGTGGAGATGTTCATGGCGTGTGGATCAAAGGGTCGAAAACAGGGTGGGAAGCAATGTCGAGGAACTGGGGACAGAATTGGCAGAGCAATTCATATCTGAATGGACAAAGCTTGTCGTTCAAAGTGACGACCGGCGATGGCCGGACGGTGATATCCAACGACGTAGCGCCAGCTGGGTGGAACTTTGGTCAGACGTTTAGTGGGGCGCAGTGTCAAAATTCAAAAGGCTGTATTGAGAGACGCAAAGTCGAGATTTCTTCTGATTGGAGGGCCAGTTGTCATAGTCCAATTGGCAATCCACGATTCCACGTGGATATATTTCCGCAACCGTATCTTTACCAGAAGAAGACCCGTCCACGTAAGACAGACGTGGCCCCACATCATCATCAATCAGCCAATGAAAACATATCCAAAACTCCCGACGAATTTCCAGCCGTTAGATCGTTAAAATCTCGTAAATCAACCCTCAGATCTGAAGGGAAAACAAGAACCACAAACTTAACTTTGAAGAAATCATTCAAGGGAGAGATGGCCACTGTCACTACTCAAGCTTCCGCCGCCGTTTTCCGGCCATGCGCCGCCCGATCAAGATTCCTTTCTGGTTCTTCCGGTAAACTCCACCGTGAGCTCTCGGTTAAACCAGTCTCTGCTTCGTCGTCTTCATCTTTCAAGGTTGAAGCCAAGAAGGGAGAATGGTTGCCTGGTCTGCCATCTCCGGTGTACTTAAATGGCAGTCTTCCGGGCGATAATGGATTTGACCCACTAGGTTTAGCGGAAGACCCAGAGAATTTGAGGTGGTACGTGCAAGCGGAGCTGGTGAATGGGCGGTGGGCGATGCTGGGTGTCGCCGGAATGCTTCTGCCGGAGGTTTTCACGAAGATCGGAATCATCAACGCTCCTCAGTGGTACGACGCCGGAAAGGCAGAGTACTTCGCCTCGTCGTCAACTCTGTTCGTGATCGAGTTTATCCTCTTCCATTACGTCGAAATCCGCAGATGGCAAGACATTAAAAACCCTGGCTGCGTTAACCAAGACCCCATTTTCAAGCAATACAGTTTGCCCCCAAATGAATGTGGTTACCCTGGTGGGATTTTCAATCCCCTGAATTTCGCCCCCACTCTTGAAGCCAAAGAGAAGGAAATAGCCAATGGGAGACTTGCGATGTTGGCGTTCTTGGGGTTCATTGTGCAACACAACGTGACAGGGAAGGGGCCATTTGACAACCTTTTGCAGCACATTTCTGACCCATGGCACAACACCATTGTTCAGACATTTGGTGGCAACTAA 1827 49.21 MAFLGFLLVGLLLSLGCDSALGNNNGGGWIDAHATFYGGGDAAGTMGGACGYGNLYSQGYGTNTAALSTALFNNGLSCGACFEIKCVNDAKWCLPKSIVVTATNFCPPNNALPNNAGGWCNPPQHHFDLSQPVFQQIAHYKAGIVPVAYRRVSCEKKGGIRFTINGHSYFNLVLITNVGGGGDVHGVWIKGSKTGWEAMSRNWGQNWQSNSYLNGQSLSFKVTTGDGRTVISNDVAPAGWNFGQTFSGAQCQNSKGCIERRKVEISSDWRASCHSPIGNPRFHVDIFPQPYLYQKKTRPRKTDVAPHHHQSANENISKTPDEFPAVRSLKSRKSTLRSEGKTRTTNLTLKKSFKGEMATVTTQASAAVFRPCAARSRFLSGSSGKLHRELSVKPVSASSSSSFKVEAKKGEWLPGLPSPVYLNGSLPGDNGFDPLGLAEDPENLRWYVQAELVNGRWAMLGVAGMLLPEVFTKIGIINAPQWYDAGKAEYFASSSTLFVIEFILFHYVEIRRWQDIKNPGCVNQDPIFKQYSLPPNECGYPGGIFNPLNFAPTLEAKEKEIANGRLAMLAFLGFIVQHNVTGKGPFDNLLQHISDPWHNTIVQTFGGN 608
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
6 25126453 25132632 + Lsi06G014580.1 Lsi06g01458 666188

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Lsi06g01458 608 SUPERFAMILY PHL pollen allergen 156 247 IPR036749 -
Lsi06g01458 608 Pfam Lytic transglycolase 64 149 IPR009009 -
Lsi06g01458 608 PRINTS Expansin signature 134 147 IPR002963 GO:0009664
Lsi06g01458 608 PRINTS Expansin signature 205 226 IPR002963 GO:0009664
Lsi06g01458 608 PRINTS Expansin signature 86 97 IPR002963 GO:0009664
Lsi06g01458 608 PRINTS Expansin signature 59 73 IPR002963 GO:0009664
Lsi06g01458 608 PRINTS Expansin signature 98 108 IPR002963 GO:0009664
Lsi06g01458 608 PRINTS Expansin signature 158 170 IPR002963 GO:0009664
Lsi06g01458 608 PRINTS Expansin signature 170 191 IPR002963 GO:0009664
Lsi06g01458 608 PRINTS Expansin signature 234 250 IPR002963 GO:0009664
Lsi06g01458 608 PRINTS Expansin signature 117 134 IPR002963 GO:0009664
Lsi06g01458 608 SUPERFAMILY Chlorophyll a-b binding protein 409 605 - -
Lsi06g01458 608 Pfam Expansin C-terminal domain 160 237 IPR007117 -
Lsi06g01458 608 Gene3D Chlorophyll a/b binding protein domain 419 598 - -
Lsi06g01458 608 SUPERFAMILY Barwin-like endoglucanases 28 177 IPR036908 -
Lsi06g01458 608 Pfam Chlorophyll A-B binding protein 419 578 IPR022796 -
Lsi06g01458 608 ProSiteProfiles Expansin, Cellulose-binding-like domain profile. 169 248 IPR007117 -
Lsi06g01458 608 ProSiteProfiles Expansin, family-45 endoglucanase-like domain profile. 47 159 IPR007112 -
Lsi06g01458 608 Gene3D - 157 251 IPR036749 -
Lsi06g01458 608 SMART dpbb_1 64 149 IPR007112 -
Lsi06g01458 608 Gene3D - 17 155 IPR036908 -
Lsi06g01458 608 PANTHER CHLOROPHYLL A/B BINDING PROTEIN 357 608 IPR001344 GO:0009765|GO:0016020
Lsi06g01458 608 MobiDBLite consensus disorder prediction 299 319 - -
Lsi06g01458 608 PRINTS Expansin/Lol pI family signature 142 158 IPR007118 GO:0005576
Lsi06g01458 608 PRINTS Expansin/Lol pI family signature 234 248 IPR007118 GO:0005576
Lsi06g01458 608 PRINTS Expansin/Lol pI family signature 28 43 IPR007118 GO:0005576
Lsi06g01458 608 PRINTS Expansin/Lol pI family signature 196 210 IPR007118 GO:0005576
Lsi06g01458 608 PRINTS Expansin/Lol pI family signature 46 64 IPR007118 GO:0005576
Lsi06g01458 608 PRINTS Expansin/Lol pI family signature 68 86 IPR007118 GO:0005576
Lsi06g01458 608 PANTHER CHLOROPHYLL A-B BINDING PROTEIN, CHLOROPLASTIC 357 608 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Lsi06g01458 K08910 LHCA4; light-harvesting complex I chlorophyll a/b binding protein 4 - csv:101222701 499.59
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Lsi06g00351 Lsi-Chr6:3836682 Lsi06g01458 Lsi-Chr6:25126453 9.63E-53 dispersed
Lsi06g01458 Lsi-Chr6:25126453 Lsi11g00969 Lsi-Chr11:15332481 8.57E-136 dispersed
Lsi02g01721 Lsi-Chr2:22918251 Lsi06g01458 Lsi-Chr6:25126453 6.22E-44 transposed
Lsi04g00683 Lsi-Chr4:6266236 Lsi06g01458 Lsi-Chr6:25126453 1.75E-68 transposed
Lsi06g00634 Lsi-Chr6:9269531 Lsi06g01458 Lsi-Chr6:25126453 2.47E-44 transposed
Lsi08g00548 Lsi-Chr8:13635761 Lsi06g01458 Lsi-Chr6:25126453 3.61E-28 transposed
Lsi08g01472 Lsi-Chr8:22846371 Lsi06g01458 Lsi-Chr6:25126453 9.15E-63 transposed
Lsi02g01475 Lsi-Chr2:20497709 Lsi06g01458 Lsi-Chr6:25126453 4.24E-121 wgd
Lsi02g00081 Lsi-Chr2:694390 Lsi06g01458 Lsi-Chr6:25126453 7.90E-62 wgd
Lsi04g00406 Lsi-Chr4:3973635 Lsi06g01458 Lsi-Chr6:25126453 1.58E-135 wgd
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi17g567 . . Bda06g00541 . . . . . . . Cma10g00197 Cma11g00138 Car10g00188 Car11g00157 . . Cpe04g01494 Bhi02g00307 . . . Hepe09g0111 . . . . . . . . . . . . . . . . . . Blo15g00315 . . Bpe07g00778 . . . . Cmo10g00214 Cmo11g00173 . . . . . . . . . . . . . . . . . . . . Lsi06g01458 Csa01g00242 . Cme02g01876
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Lsi02g01367 . 1 397 Chloroplast and Mitochondria Gene Families AT2G28800 63.7 6.6e-135 477.6
Lsi08g01627 . 63 427 Chloroplast and Mitochondria Gene Families AT2G28800 53.8 5.9e-99 358.2
Lsi08g00548 . 3 255 Chloroplast and Mitochondria Gene Families AT1G15820 81.2 2.6e-118 421.8
Lsi11g01355 . 46 314 Chloroplast and Mitochondria Gene Families AT3G27690 87.8 4.6e-143 504.2
Lsi10g01537 . 2 267 Chloroplast and Mitochondria Gene Families AT3G27690 78.8 2.4e-120 428.7
Lsi01g00172 . 2 265 Chloroplast and Mitochondria Gene Families AT3G27690 77.0 9.3e-120 426.8
Lsi01g00173 . 2 265 Chloroplast and Mitochondria Gene Families AT3G27690 77.0 9.3e-120 426.8
Lsi02g00880 . 43 307 Chloroplast and Mitochondria Gene Families AT3G27690 76.7 3.5e-119 424.9
Lsi03g01151 . 1 265 Chloroplast and Mitochondria Gene Families AT3G27690 77.2 7.8e-119 423.7
Lsi02g00879 . 2 246 Chloroplast and Mitochondria Gene Families AT3G27690 71.9 6.2e-108 387.5
Lsi05g00685 . 3 264 Chloroplast and Mitochondria Gene Families AT3G27690 67.6 7.6e-98 354.0
Lsi02g00878 . 5 166 Chloroplast and Mitochondria Gene Families AT3G27690 71.9 1.1e-64 243.8
Lsi04g00683 . 3 262 Chloroplast and Mitochondria Gene Families AT3G61470 80.5 4.1e-124 441.0
Lsi06g00351 . 56 247 Chloroplast and Mitochondria Gene Families AT3G61470 66.1 2.1e-80 295.8
Lsi06g01458 . 378 605 Chloroplast and Mitochondria Gene Families AT3G61470 51.3 4.8e-64 241.5
Lsi02g01721 . 1 198 Chloroplast and Mitochondria Gene Families AT3G54890 82.1 2.5e-90 328.6
Lsi03g02207 . 3 280 Chloroplast and Mitochondria Gene Families AT3G08940 85.3 1.3e-134 476.1
Lsi01g01533 . 3 284 Chloroplast and Mitochondria Gene Families AT3G08940 82.3 5.4e-133 470.7
Lsi06g00634 . 1 273 Chloroplast and Mitochondria Gene Families AT1G61520 85.3 1.9e-135 478.8
Lsi11g01355 . 50 314 Chloroplast and Mitochondria Gene Families AT2G05070 89.4 2.8e-144 508.1
Lsi10g01537 . 7 267 Chloroplast and Mitochondria Gene Families AT2G05070 79.7 2.2e-120 428.7
Lsi01g00172 . 5 265 Chloroplast and Mitochondria Gene Families AT2G05070 78.9 2.8e-120 428.3
Lsi01g00173 . 5 265 Chloroplast and Mitochondria Gene Families AT2G05070 78.9 2.8e-120 428.3
Lsi02g00880 . 46 307 Chloroplast and Mitochondria Gene Families AT2G05070 77.8 1.6e-118 422.5
Lsi03g01151 . 27 265 Chloroplast and Mitochondria Gene Families AT2G05070 84.1 2.7e-118 421.8
Lsi02g00879 . 5 246 Chloroplast and Mitochondria Gene Families AT2G05070 73.3 3.2e-108 388.3
Lsi05g00685 . 5 264 Chloroplast and Mitochondria Gene Families AT2G05070 68.8 4.0e-98 354.8
Lsi02g00878 . 6 166 Chloroplast and Mitochondria Gene Families AT2G05070 72.7 2.9e-64 242.3
Lsi11g01355 . 50 286 Chloroplast and Mitochondria Gene Families AT2G05100 89.5 1.6e-125 446.0
Lsi10g01537 . 7 239 Chloroplast and Mitochondria Gene Families AT2G05100 77.7 1.6e-101 366.3
Lsi01g00172 . 5 237 Chloroplast and Mitochondria Gene Families AT2G05100 76.5 1.6e-101 366.3
Lsi01g00173 . 5 237 Chloroplast and Mitochondria Gene Families AT2G05100 76.5 1.6e-101 366.3
Lsi02g00880 . 46 279 Chloroplast and Mitochondria Gene Families AT2G05100 76.1 1.7e-100 362.8
Lsi03g01151 . 8 237 Chloroplast and Mitochondria Gene Families AT2G05100 78.0 2.3e-100 362.5
Lsi02g00879 . 5 218 Chloroplast and Mitochondria Gene Families AT2G05100 71.1 1.4e-89 326.6
Lsi05g00685 . 5 236 Chloroplast and Mitochondria Gene Families AT2G05100 68.5 3.3e-83 305.4
Lsi02g00878 . 6 166 Chloroplast and Mitochondria Gene Families AT2G05100 72.7 1.2e-64 243.8
Lsi01g01533 . 3 167 Chloroplast and Mitochondria Gene Families AT2G40100 72.8 5.7e-67 250.8
Lsi03g02207 . 3 166 Chloroplast and Mitochondria Gene Families AT2G40100 69.2 6.5e-63 237.3
Lsi10g01537 . 1 267 Chloroplast and Mitochondria Gene Families AT1G29930 88.4 4.4e-137 484.2
Lsi01g00172 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29930 88.4 1.1e-135 479.6
Lsi01g00173 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29930 88.4 1.1e-135 479.6
Lsi02g00880 . 42 307 Chloroplast and Mitochondria Gene Families AT1G29930 85.8 2.1e-131 465.3
Lsi03g01151 . 4 265 Chloroplast and Mitochondria Gene Families AT1G29930 84.5 1.2e-126 449.5
Lsi02g00879 . 1 246 Chloroplast and Mitochondria Gene Families AT1G29930 82.0 1.6e-123 439.1
Lsi11g01355 . 52 314 Chloroplast and Mitochondria Gene Families AT1G29930 78.3 3.3e-116 414.8
Lsi05g00685 . 11 264 Chloroplast and Mitochondria Gene Families AT1G29930 67.5 3.5e-94 341.7
Lsi02g00878 . 4 167 Chloroplast and Mitochondria Gene Families AT1G29930 84.8 8.7e-77 283.9
Lsi10g01537 . 1 267 Chloroplast and Mitochondria Gene Families AT1G29920 88.1 1.7e-136 482.3
Lsi01g00172 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29920 88.0 4.1e-135 477.6
Lsi01g00173 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29920 88.0 4.1e-135 477.6
Lsi02g00880 . 42 307 Chloroplast and Mitochondria Gene Families AT1G29920 85.4 8.0e-131 463.4
Lsi03g01151 . 4 265 Chloroplast and Mitochondria Gene Families AT1G29920 84.5 1.6e-126 449.1
Lsi02g00879 . 1 246 Chloroplast and Mitochondria Gene Families AT1G29920 81.6 6.1e-123 437.2
Lsi11g01355 . 52 314 Chloroplast and Mitochondria Gene Families AT1G29920 77.9 1.9e-116 415.6
Lsi05g00685 . 34 264 Chloroplast and Mitochondria Gene Families AT1G29920 69.8 3.5e-94 341.7
Lsi02g00878 . 4 167 Chloroplast and Mitochondria Gene Families AT1G29920 84.2 3.3e-76 282.0
Lsi10g01537 . 1 267 Chloroplast and Mitochondria Gene Families AT1G29910 88.1 1.7e-136 482.3
Lsi01g00172 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29910 88.0 4.1e-135 477.6
Lsi01g00173 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29910 88.0 4.1e-135 477.6
Lsi02g00880 . 42 307 Chloroplast and Mitochondria Gene Families AT1G29910 85.4 8.0e-131 463.4
Lsi03g01151 . 4 265 Chloroplast and Mitochondria Gene Families AT1G29910 84.5 1.6e-126 449.1
Lsi02g00879 . 1 246 Chloroplast and Mitochondria Gene Families AT1G29910 81.6 6.1e-123 437.2
Lsi11g01355 . 52 314 Chloroplast and Mitochondria Gene Families AT1G29910 77.9 1.9e-116 415.6
Lsi05g00685 . 34 264 Chloroplast and Mitochondria Gene Families AT1G29910 69.8 3.5e-94 341.7
Lsi02g00878 . 4 167 Chloroplast and Mitochondria Gene Families AT1G29910 84.2 3.3e-76 282.0
Lsi08g00191 . 11 275 Chloroplast and Mitochondria Gene Families AT4G10340 80.1 1.5e-127 452.6
Lsi02g00880 . 82 295 Chloroplast and Mitochondria Gene Families AT4G10340 53.6 2.1e-57 219.5
Lsi01g00172 . 37 253 Chloroplast and Mitochondria Gene Families AT4G10340 52.5 6.1e-57 218.0
Lsi01g00173 . 37 253 Chloroplast and Mitochondria Gene Families AT4G10340 52.5 6.1e-57 218.0
Lsi10g01537 . 51 255 Chloroplast and Mitochondria Gene Families AT4G10340 54.1 8.0e-57 217.6
Lsi03g01151 . 49 253 Chloroplast and Mitochondria Gene Families AT4G10340 53.6 2.3e-56 216.1
Lsi11g01355 . 98 302 Chloroplast and Mitochondria Gene Families AT4G10340 52.6 2.9e-54 209.1
Lsi05g00685 . 46 252 Chloroplast and Mitochondria Gene Families AT4G10340 54.0 2.7e-52 202.6
Lsi10g01537 . 1 267 Chloroplast and Mitochondria Gene Families AT2G34420 88.4 2.8e-136 481.5
Lsi01g00172 . 1 265 Chloroplast and Mitochondria Gene Families AT2G34420 87.6 4.5e-134 474.2
Lsi01g00173 . 1 265 Chloroplast and Mitochondria Gene Families AT2G34420 87.6 4.5e-134 474.2
Lsi02g00880 . 42 307 Chloroplast and Mitochondria Gene Families AT2G34420 85.4 3.9e-130 461.1
Lsi03g01151 . 4 265 Chloroplast and Mitochondria Gene Families AT2G34420 84.9 2.4e-127 451.8
Lsi02g00879 . 1 246 Chloroplast and Mitochondria Gene Families AT2G34420 80.9 9.7e-121 429.9
Lsi11g01355 . 52 314 Chloroplast and Mitochondria Gene Families AT2G34420 77.2 6.5e-117 417.2
Lsi05g00685 . 34 264 Chloroplast and Mitochondria Gene Families AT2G34420 70.2 3.5e-94 341.7
Lsi02g00878 . 4 167 Chloroplast and Mitochondria Gene Families AT2G34420 84.2 2.1e-75 279.3
Lsi01g00172 . 1 265 Chloroplast and Mitochondria Gene Families AT2G34430 88.3 1.3e-136 482.6
Lsi01g00173 . 1 265 Chloroplast and Mitochondria Gene Families AT2G34430 88.3 1.3e-136 482.6
Lsi10g01537 . 1 267 Chloroplast and Mitochondria Gene Families AT2G34430 87.7 3.1e-135 478.0
Lsi02g00880 . 42 307 Chloroplast and Mitochondria Gene Families AT2G34430 86.1 1.7e-133 472.2
Lsi03g01151 . 4 265 Chloroplast and Mitochondria Gene Families AT2G34430 85.2 3.4e-129 458.0
Lsi02g00879 . 1 246 Chloroplast and Mitochondria Gene Families AT2G34430 81.2 1.6e-123 439.1
Lsi11g01355 . 80 314 Chloroplast and Mitochondria Gene Families AT2G34430 83.2 1.8e-114 409.1
Lsi05g00685 . 34 264 Chloroplast and Mitochondria Gene Families AT2G34430 71.0 3.5e-94 341.7
Lsi02g00878 . 4 167 Chloroplast and Mitochondria Gene Families AT2G34430 84.1 4.6e-78 288.1
Lsi03g02207 . 2 280 Chloroplast and Mitochondria Gene Families AT5G01530 86.8 1.6e-140 495.7
Lsi01g01533 . 2 284 Chloroplast and Mitochondria Gene Families AT5G01530 83.8 3.6e-137 484.6
Lsi05g00793 . 48 307 Chloroplast and Mitochondria Gene Families AT5G40810 94.2 2.8e-144 508.1
Lsi05g00793 . 1 307 Chloroplast and Mitochondria Gene Families AT3G27240 85.4 2.6e-149 525.0
Lsi10g01460 . 5 327 Chloroplast and Mitochondria Gene Families AT2G30160 75.6 3.5e-144 508.1
Lsi01g01574 . 9 311 Chloroplast and Mitochondria Gene Families AT2G30160 63.9 1.1e-110 396.7
Lsi10g01460 . 5 327 Chloroplast and Mitochondria Gene Families AT1G07030 76.1 2.2e-143 505.4
Lsi01g01574 . 5 311 Chloroplast and Mitochondria Gene Families AT1G07030 67.2 9.5e-118 420.2
Lsi02g02438 . 1 345 Chloroplast and Mitochondria Gene Families AT2G47490 68.2 3.9e-129 458.0
Lsi02g02438 . 11 332 Chloroplast and Mitochondria Gene Families AT1G25380 57.3 5.3e-101 364.8
Lsi02g00703 . 668 1218 Chloroplast and Mitochondria Gene Families AT4G21490 74.6 2.6e-243 838.2
Lsi10g00864 . 489 1044 Chloroplast and Mitochondria Gene Families AT4G21490 71.1 1.4e-233 805.8
Lsi11g01519 . 1 577 Chloroplast and Mitochondria Gene Families AT4G21490 64.7 7.1e-225 776.9
Lsi02g02919 . 5 186 Chloroplast and Mitochondria Gene Families AT1G17530 65.4 1.1e-62 236.5
Lsi06g00803 . 4 179 Chloroplast and Mitochondria Gene Families AT1G17530 59.0 1.9e-51 199.1
Lsi06g00803 . 12 183 Chloroplast and Mitochondria Gene Families AT3G04800 59.0 2.0e-51 199.1
Lsi02g02919 . 22 190 Chloroplast and Mitochondria Gene Families AT3G04800 55.0 8.9e-44 173.7
Lsi02g02919 . 15 190 Chloroplast and Mitochondria Gene Families AT1G72750 69.6 5.4e-65 244.2
Lsi06g00803 . 5 183 Chloroplast and Mitochondria Gene Families AT1G72750 58.8 3.6e-53 204.9
Lsi04g00298 CCT 615 854 Chloroplast and Mitochondria Gene Families AT1G26100 57.9 5.9e-69 257.7
Lsi03g00225 . 1 226 Chloroplast and Mitochondria Gene Families AT5G38630 70.5 1.0e-89 326.6
Lsi05g00005 . 23 218 Chloroplast and Mitochondria Gene Families AT4G25570 73.0 8.5e-83 303.9
Lsi09g00711 . 2 219 Chloroplast and Mitochondria Gene Families AT1G14730 52.8 4.9e-65 244.6
Lsi09g00822 . 9 370 Chloroplast and Mitochondria Gene Families AT5G14040 77.1 4.4e-159 557.8
Lsi06g01674 . 37 338 Chloroplast and Mitochondria Gene Families AT5G14040 86.1 2.5e-154 542.0
Lsi11g01295 . 31 312 Chloroplast and Mitochondria Gene Families AT5G14040 51.4 6.3e-81 298.1
Lsi05g00457 . 49 235 Chloroplast and Mitochondria Gene Families AT5G14040 64.2 1.5e-79 293.5
Lsi06g01674 . 32 338 Chloroplast and Mitochondria Gene Families AT3G48850 74.9 3.7e-139 491.5
Lsi09g00822 . 8 362 Chloroplast and Mitochondria Gene Families AT3G48850 68.1 4.7e-134 474.6
Lsi11g01295 . 31 312 Chloroplast and Mitochondria Gene Families AT3G48850 50.3 7.1e-82 301.2
Lsi05g00457 . 49 235 Chloroplast and Mitochondria Gene Families AT3G48850 62.1 5.0e-75 278.5
Lsi11g01295 . 34 311 Chloroplast and Mitochondria Gene Families AT2G17270 78.4 3.3e-128 454.9
Lsi03g00181 . 18 310 Chloroplast and Mitochondria Gene Families AT5G15640 77.0 1.3e-127 453.0
Lsi04g01400 . 12 345 Chloroplast and Mitochondria Gene Families AT5G26200 67.7 1.7e-125 446.0
Lsi02g02914 . 10 353 Chloroplast and Mitochondria Gene Families AT5G26200 58.7 1.0e-106 383.6
Lsi02g02914 . 10 357 Chloroplast and Mitochondria Gene Families AT1G72820 76.6 1.0e-149 526.6
Lsi04g01400 . 1 346 Chloroplast and Mitochondria Gene Families AT1G72820 68.2 1.5e-129 459.5
Lsi05g01196 . 1 223 Chloroplast and Mitochondria Gene Families AT4G25700 62.6 1.1e-69 260.0
Lsi09g00227 . 28 187 Chloroplast and Mitochondria Gene Families AT4G25700 53.5 6.7e-46 181.0
Lsi11g01501 . 123 301 Chloroplast and Mitochondria Gene Families AT4G03320 51.7 3.1e-56 215.7
Lsi05g00688 . 62 386 Chloroplast and Mitochondria Gene Families AT5G54290 70.6 4.8e-115 411.4
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0001994 2 2 3 3 2 2 3 2 2 2 2 2 3 2 2 3 2 2 3 2 2 2 2 2 2 2 2 3 2 1 66
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Lsi06g01458 Lsi_Chr06 FPKM 5.29558 5.22702 5.235922 6.944022 7.275965 7.606714 8.44774 5.840586 3.423798 1.912168