Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Lsi07g01177 ATGAGCTTTCAAGATATCGAGGCTGGTCGCCCCTTTGCTTCTTCGAGGAGAGACCTCATCAATGGCAAACAAGATCCCACGCAAGCTGTTGCTTCGGGTATATTTCAGATTAATACTGCCGTCGCTACGTTTCAGAGGCTTGTTAATACCTTAGGAACACCGAAGGATACGCCTGAGCTACGCGAGAAGCTGCACAAGACCAGGTTACATATTGGACAGTTGGTTAAAGACACCTCTGCTAAACTTAAACAAGCCAGCGAAATAGATCATCACGCTGAAGTTAATGCCAGCAAGAAAATTGCAGATGCTAAACTCGCGAAAGATTTTCAAGCAGTGTTGAAAGAATTTCAGAAGGCTCAACGACTTGCCGCTGAGAGGGAAACAGCATATACACCTTTTGTTCCTCAAACTGTTCTACCTTCTAGCTACACAGCTGGCGAGGCAGATGCAAGCTCAGAAAAGAATCTTGAACAGCGTGCCCTCCTTGTAGAATCCAGGAGACAAGAGGTCTTGCTGTTGGACAATGAAATAGCCTTCAACGAGGCAATAATTGAGGAAAGAGAGCAAGGCATTCATGAAATCCAGCAGCAAATTGGAGAAGTAAATGAAATTTTTAAAGATCTTGCGGTTCTAGTCCATGAACAGGGAGCCATGATTGATTTGTGTGTAGCTCAAGTTATTCATGTATATATCACCATGGTTGTAGATGATATTGGATCCAACATAGAGGGTGCCCATGCTGCAACGTCACAGGGAACAACTCAGCTTGTAAAAGCTTCAAAAACACAAAGATCGAATTCATCTCTGGCTTGCTTACTTTTGGTGATATTTGGTATTATCCTTCTCATTGTGATCATAATAGTTGTTGCTTAA 873 42.84 MSFQDIEAGRPFASSRRDLINGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSAKLKQASEIDHHAEVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYTPFVPQTVLPSSYTAGEADASSEKNLEQRALLVESRRQEVLLLDNEIAFNEAIIEEREQGIHEIQQQIGEVNEIFKDLAVLVHEQGAMIDLCVAQVIHVYITMVVDDIGSNIEGAHAATSQGTTQLVKASKTQRSNSSLACLLLVIFGIILLIVIIIVVA 290
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
7 17275748 17281274 + Lsi07G011770.1 Lsi07g01177 667599

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Lsi07g01177 290 PANTHER SYNTAXIN OF PLANTS PROTEIN 5 224 - -
Lsi07g01177 290 PANTHER SYNTAXIN OF PLANTS PROTEIN 224 288 - -
Lsi07g01177 290 SUPERFAMILY t-snare proteins 24 216 IPR010989 GO:0016020|GO:0016192
Lsi07g01177 290 Gene3D - 21 134 - -
Lsi07g01177 290 Pfam Syntaxin-like protein 31 130 IPR006011 GO:0016020
Lsi07g01177 290 PANTHER SYNTAXIN 5 224 IPR045242 -
Lsi07g01177 290 PANTHER SYNTAXIN 224 288 IPR045242 -
Lsi07g01177 290 SMART tSNARE_6 176 259 IPR000727 -
Lsi07g01177 290 CDD SynN 24 147 IPR006011 GO:0016020
Lsi07g01177 290 Gene3D - 174 290 - -
Lsi07g01177 290 Pfam SNARE domain 234 285 IPR000727 -
Lsi07g01177 290 CDD SNARE_Qa 184 258 - -
Lsi07g01177 290 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 220 IPR000727 -
Lsi07g01177 290 SMART SynN_4 16 128 IPR006011 GO:0016020
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Lsi07g01177 - - K08488 bhj:120089793 450.669
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Lsi07g01177 Lsi-Chr7:17275748 Lsi11g00612 Lsi-Chr11:6525802 4.20E-10 dispersed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Lsi08g01147 . 8 338 SNARE and Associated Proteins AT3G24350 65.1 4.7e-102 368.2
Lsi01g01659 . 1 309 SNARE and Associated Proteins AT1G08560 69.0 1.0e-100 363.6
Lsi01g00668 . 428 710 SNARE and Associated Proteins AT2G18260 55.2 2.3e-81 299.3
Lsi03g01810 . 19 254 SNARE and Associated Proteins AT3G11820 80.5 1.4e-102 369.8
Lsi01g01181 . 26 282 SNARE and Associated Proteins AT3G11820 73.2 2.4e-102 369.0
Lsi02g00706 . 31 281 SNARE and Associated Proteins AT3G11820 66.9 7.8e-93 337.4
Lsi03g01319 . 12 236 SNARE and Associated Proteins AT3G11820 55.6 1.7e-63 240.0
Lsi01g01181 . 33 282 SNARE and Associated Proteins AT3G52400 65.2 6.5e-85 311.2
Lsi03g01810 . 1 255 SNARE and Associated Proteins AT3G52400 63.7 3.0e-82 302.4
Lsi02g00706 . 1 281 SNARE and Associated Proteins AT3G52400 56.7 1.5e-81 300.1
Lsi03g01319 . 11 236 SNARE and Associated Proteins AT3G52400 52.7 3.7e-56 215.7
Lsi02g00706 . 1 299 SNARE and Associated Proteins AT4G03330 68.5 2.4e-107 385.6
Lsi01g01181 . 1 298 SNARE and Associated Proteins AT4G03330 51.5 9.0e-78 287.3
Lsi03g01810 . 1 253 SNARE and Associated Proteins AT4G03330 59.1 2.9e-76 282.3
Lsi03g01319 . 10 236 SNARE and Associated Proteins AT4G03330 57.3 3.3e-64 242.3
Lsi02g00706 . 1 299 SNARE and Associated Proteins AT1G61290 78.6 4.7e-127 451.1
Lsi01g01181 . 1 293 SNARE and Associated Proteins AT1G61290 56.3 7.5e-85 310.8
Lsi03g01810 . 1 254 SNARE and Associated Proteins AT1G61290 63.8 7.1e-83 304.3
Lsi03g01319 . 10 236 SNARE and Associated Proteins AT1G61290 52.9 2.9e-60 229.2
Lsi02g00706 . 1 299 SNARE and Associated Proteins AT1G11250 77.6 4.7e-124 441.0
Lsi01g01181 . 1 293 SNARE and Associated Proteins AT1G11250 57.0 6.1e-87 317.8
Lsi03g01810 . 1 254 SNARE and Associated Proteins AT1G11250 63.0 9.7e-85 310.5
Lsi03g01319 . 12 236 SNARE and Associated Proteins AT1G11250 54.7 2.3e-62 236.1
Lsi03g01319 . 12 259 SNARE and Associated Proteins AT3G03800 76.6 5.4e-99 357.8
Lsi03g01319 . 12 154 SNARE and Associated Proteins AT5G08080 83.2 1.2e-60 229.9
Lsi07g01177 . 1 272 SNARE and Associated Proteins AT5G16830 56.5 8.0e-73 270.8
Lsi07g01177 . 1 272 SNARE and Associated Proteins AT5G46860 62.5 1.3e-77 286.6
Lsi07g01177 . 1 190 SNARE and Associated Proteins AT4G17730 76.4 1.7e-72 269.6
Lsi07g01177 . 65 272 SNARE and Associated Proteins AT1G32270 55.3 1.4e-50 197.2
Lsi04g00969 . 1 286 SNARE and Associated Proteins AT5G05760 64.5 6.6e-90 327.8
Lsi08g01147 . 8 338 SNARE and Associated Proteins AT3G24350 65.1 4.7e-102 368.2
Lsi11g00612 . 1 327 SNARE and Associated Proteins AT5G26980 75.8 1.1e-126 449.9
Lsi02g02441 . 1 286 SNARE and Associated Proteins AT5G26980 64.8 2.7e-88 322.4
Lsi11g00612 . 1 329 SNARE and Associated Proteins AT4G02195 64.7 3.7e-106 381.7
Lsi02g02441 . 1 286 SNARE and Associated Proteins AT4G02195 66.9 3.6e-93 338.6
Lsi11g00612 . 1 328 SNARE and Associated Proteins AT3G05710 75.4 9.3e-129 456.8
Lsi02g02441 . 1 286 SNARE and Associated Proteins AT3G05710 62.5 2.8e-85 312.4
Lsi02g01877 . 1 225 SNARE and Associated Proteins AT1G16240 69.5 2.4e-83 305.4
Lsi05g00543 . 23 286 SNARE and Associated Proteins AT1G16240 57.6 7.1e-75 277.3
Lsi02g01877 . 1 225 SNARE and Associated Proteins AT1G79590 68.7 2.3e-82 302.4
Lsi05g00543 . 23 286 SNARE and Associated Proteins AT1G79590 58.3 4.3e-76 281.6
Lsi09g01890 . 38 229 SNARE and Associated Proteins AT1G28490 72.9 3.2e-68 255.0
Lsi03g02035 . 38 327 SNARE and Associated Proteins AT3G09740 72.6 5.0e-109 391.0
Lsi10g01278 . 1 254 SNARE and Associated Proteins AT3G09740 60.7 4.9e-80 294.7
Lsi03g02035 . 38 327 SNARE and Associated Proteins AT3G45280 58.7 1.6e-83 306.2
Lsi10g01278 . 1 254 SNARE and Associated Proteins AT3G45280 57.7 1.4e-74 276.6
Lsi03g02035 . 38 324 SNARE and Associated Proteins AT3G61450 62.1 1.4e-90 329.7
Lsi10g01278 . 1 251 SNARE and Associated Proteins AT3G61450 54.9 2.4e-71 265.8
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45
       

Transcriptome

Select Gene Chr Type da1 da2 da3 da4 da5 da6 da7 da8 da9 da10
Lsi07g01177 Lsi_Chr07 FPKM 9.810247 10.892914 11.654415 10.986849 11.327628 13.67406 12.894954 9.15416 9.301529 11.362833