Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Lsi09g01890 ATGCCATCGGCTCAAGATCCGTTCTATGTTGTAAAAGACGAGATTCAAGAATCTGAGAGAGAGTACAACAAACAAAAGAGTTGCTTGCTTCCTGTGAAAGCATTGAATGGCAGGAAGGTGGATGAATTGGACAAAGCTATAGCTGTGGCAGCTAGAGATCCATCTTGGTATGGCATTGATGAAGCAGAACTTGAAAAACGAAGGAGATGGACGAGTACAGCTAGGACACAGGTTGGAAATGTTAAGAAAGTAGTAGGAGCCGGGAAGGAGCAAACGGGAACTGCTAGTGCAAGTGGGATGCGTCGAGAATTGATGAGACTACCTAATGCACATGAAACAGACAGATCAAACTTATATACAGCCAACCAAGCAAATGATGACTTCATCACATCTGAATCAGATAGACAGCTGCTTCTAATAAAGCAGCAGGACGAGGAGTTGGATGAGTTGAGTGCAAGCGTGGAGAGAATTGGAGGTGTTGGGCTTACTATACACGAAGAGCTCCTTGCACAGGATAAAATTATCGACGACCTAGGAATGGAAATGGACAGTACATCAAATCGTCTTGATTTTGTTCAGAAAAAAGTAGCTGTGGTCATGAAGAAGGCCAGCGCCAAGGGGCAGATAATGATGATATTGTTCTTGGTGGCTTTGTTCATCATCCTTTTTGTGTTGGTGTTCCTCACCTAG 690 43.77 MPSAQDPFYVVKDEIQESEREYNKQKSCLLPVKALNGRKVDELDKAIAVAARDPSWYGIDEAELEKRRRWTSTARTQVGNVKKVVGAGKEQTGTASASGMRRELMRLPNAHETDRSNLYTANQANDDFITSESDRQLLLIKQQDEELDELSASVERIGGVGLTIHEELLAQDKIIDDLGMEMDSTSNRLDFVQKKVAVVMKKASAKGQIMMILFLVALFIILFVLVFLT 229
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
9 27715983 27720666 + Lsi09G018900.1 Lsi09g01890 671503

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Lsi09g01890 229 CDD SNARE_Qc 140 197 - -
Lsi09g01890 229 Pfam Syntaxin 6, N-terminal 39 82 IPR015260 GO:0016020|GO:0048193
Lsi09g01890 229 ProSitePatterns Syntaxin / epimorphin family signature. 143 182 IPR006012 GO:0005484|GO:0006886|GO:0016020
Lsi09g01890 229 SUPERFAMILY t-snare proteins 5 83 IPR010989 GO:0016020|GO:0016192
Lsi09g01890 229 Pfam SNARE domain 174 225 IPR000727 -
Lsi09g01890 229 Gene3D - 144 208 - -
Lsi09g01890 229 SUPERFAMILY SNARE fusion complex 136 199 - -
Lsi09g01890 229 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 137 199 IPR000727 -
Lsi09g01890 229 SMART tSNARE_6 132 199 IPR000727 -
Lsi09g01890 229 PANTHER SYNTAXIN-61 6 228 - -
Lsi09g01890 229 Gene3D - 32 87 - -
Lsi09g01890 229 PANTHER SYNTAXIN 6 228 IPR045242 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Lsi09g01890 K08500 SYP6; syntaxin of plants SYP6 - csv:101212527 330.872
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Lsi09g01890 Lsi-Chr9:27715983 Lsi02g01877 Lsi-Chr2:24587361 1.84E-08 transposed
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Lsi08g01147 . 8 338 SNARE and Associated Proteins AT3G24350 65.1 4.7e-102 368.2
Lsi01g01659 . 1 309 SNARE and Associated Proteins AT1G08560 69.0 1.0e-100 363.6
Lsi01g00668 . 428 710 SNARE and Associated Proteins AT2G18260 55.2 2.3e-81 299.3
Lsi03g01810 . 19 254 SNARE and Associated Proteins AT3G11820 80.5 1.4e-102 369.8
Lsi01g01181 . 26 282 SNARE and Associated Proteins AT3G11820 73.2 2.4e-102 369.0
Lsi02g00706 . 31 281 SNARE and Associated Proteins AT3G11820 66.9 7.8e-93 337.4
Lsi03g01319 . 12 236 SNARE and Associated Proteins AT3G11820 55.6 1.7e-63 240.0
Lsi01g01181 . 33 282 SNARE and Associated Proteins AT3G52400 65.2 6.5e-85 311.2
Lsi03g01810 . 1 255 SNARE and Associated Proteins AT3G52400 63.7 3.0e-82 302.4
Lsi02g00706 . 1 281 SNARE and Associated Proteins AT3G52400 56.7 1.5e-81 300.1
Lsi03g01319 . 11 236 SNARE and Associated Proteins AT3G52400 52.7 3.7e-56 215.7
Lsi02g00706 . 1 299 SNARE and Associated Proteins AT4G03330 68.5 2.4e-107 385.6
Lsi01g01181 . 1 298 SNARE and Associated Proteins AT4G03330 51.5 9.0e-78 287.3
Lsi03g01810 . 1 253 SNARE and Associated Proteins AT4G03330 59.1 2.9e-76 282.3
Lsi03g01319 . 10 236 SNARE and Associated Proteins AT4G03330 57.3 3.3e-64 242.3
Lsi02g00706 . 1 299 SNARE and Associated Proteins AT1G61290 78.6 4.7e-127 451.1
Lsi01g01181 . 1 293 SNARE and Associated Proteins AT1G61290 56.3 7.5e-85 310.8
Lsi03g01810 . 1 254 SNARE and Associated Proteins AT1G61290 63.8 7.1e-83 304.3
Lsi03g01319 . 10 236 SNARE and Associated Proteins AT1G61290 52.9 2.9e-60 229.2
Lsi02g00706 . 1 299 SNARE and Associated Proteins AT1G11250 77.6 4.7e-124 441.0
Lsi01g01181 . 1 293 SNARE and Associated Proteins AT1G11250 57.0 6.1e-87 317.8
Lsi03g01810 . 1 254 SNARE and Associated Proteins AT1G11250 63.0 9.7e-85 310.5
Lsi03g01319 . 12 236 SNARE and Associated Proteins AT1G11250 54.7 2.3e-62 236.1
Lsi03g01319 . 12 259 SNARE and Associated Proteins AT3G03800 76.6 5.4e-99 357.8
Lsi03g01319 . 12 154 SNARE and Associated Proteins AT5G08080 83.2 1.2e-60 229.9
Lsi07g01177 . 1 272 SNARE and Associated Proteins AT5G16830 56.5 8.0e-73 270.8
Lsi07g01177 . 1 272 SNARE and Associated Proteins AT5G46860 62.5 1.3e-77 286.6
Lsi07g01177 . 1 190 SNARE and Associated Proteins AT4G17730 76.4 1.7e-72 269.6
Lsi07g01177 . 65 272 SNARE and Associated Proteins AT1G32270 55.3 1.4e-50 197.2
Lsi04g00969 . 1 286 SNARE and Associated Proteins AT5G05760 64.5 6.6e-90 327.8
Lsi08g01147 . 8 338 SNARE and Associated Proteins AT3G24350 65.1 4.7e-102 368.2
Lsi11g00612 . 1 327 SNARE and Associated Proteins AT5G26980 75.8 1.1e-126 449.9
Lsi02g02441 . 1 286 SNARE and Associated Proteins AT5G26980 64.8 2.7e-88 322.4
Lsi11g00612 . 1 329 SNARE and Associated Proteins AT4G02195 64.7 3.7e-106 381.7
Lsi02g02441 . 1 286 SNARE and Associated Proteins AT4G02195 66.9 3.6e-93 338.6
Lsi11g00612 . 1 328 SNARE and Associated Proteins AT3G05710 75.4 9.3e-129 456.8
Lsi02g02441 . 1 286 SNARE and Associated Proteins AT3G05710 62.5 2.8e-85 312.4
Lsi02g01877 . 1 225 SNARE and Associated Proteins AT1G16240 69.5 2.4e-83 305.4
Lsi05g00543 . 23 286 SNARE and Associated Proteins AT1G16240 57.6 7.1e-75 277.3
Lsi02g01877 . 1 225 SNARE and Associated Proteins AT1G79590 68.7 2.3e-82 302.4
Lsi05g00543 . 23 286 SNARE and Associated Proteins AT1G79590 58.3 4.3e-76 281.6
Lsi09g01890 . 38 229 SNARE and Associated Proteins AT1G28490 72.9 3.2e-68 255.0
Lsi03g02035 . 38 327 SNARE and Associated Proteins AT3G09740 72.6 5.0e-109 391.0
Lsi10g01278 . 1 254 SNARE and Associated Proteins AT3G09740 60.7 4.9e-80 294.7
Lsi03g02035 . 38 327 SNARE and Associated Proteins AT3G45280 58.7 1.6e-83 306.2
Lsi10g01278 . 1 254 SNARE and Associated Proteins AT3G45280 57.7 1.4e-74 276.6
Lsi03g02035 . 38 324 SNARE and Associated Proteins AT3G61450 62.1 1.4e-90 329.7
Lsi10g01278 . 1 251 SNARE and Associated Proteins AT3G61450 54.9 2.4e-71 265.8
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003549 2 1 2 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 5 4 0 44