Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Mch10g1680 ATGAGCTTTCAAGATATCGAGGCTGGCCGGCCGTTTGCTTCTTCCAGGAGAGACCTCATCAATGGCAAACAGGATCCCACGCAAGCCGTTGCCTCGGGTATTTTTCAGATTAATACTGCCGTCGCTACGTTTCAGAGGCTTGTCAACACCTTAGGAACCCCCAAGGACACCCCTGAGCTACGCGAGAAGCTGCACAAGACCAGGTTACATATTGGACAGTTGGTAAAAGACACCTCTGCTAAACTTAAACAAGCCAGTGAAATAGATCATCATGTTGAAGTTAATGCTAGTAAGAAAATTGCAGATGCTAAACTTGCAAAAGATTTTCAAGCAGTGCTGAAAGAATTTCAGAAGGCTCAACGACTTGCAGCTGAGAGGGAAACGGCGTATACACCTTTTGTTCCCCAAGCCGTTCTTCCTTCTAGCTACACAGCCAGTGAGTCAGAAGTAAGCTCAGAAAAGAGTCTTGAACAGCGTGCCCTCCTTGTGGAATCCAGGAGACAAGAGGTCTTGCTTTTGGACAATGAAATAGCCTTCAATGAGGCAATAATTGAGGAAAGAGAGCAAGGTATTCATGAAATCCAGCAGCAAATTGGAGAAGTCAATGAAATTTTTAAAGATCTTGCAGTTCTGGTCCATGAACAGGGAGCCATGATTGATGATATTGGATCCAACATAGAGGGTGCCCATGCTGCAACGTCACAGGGAACAACTCAGCTTGTAAAAGCTTCCAAGACACAAAAATCAAATTCGTCTCTGGCTTGCTTACTTTTGGTGATATTTGGCATCATCCTCCTTATTGTGATCATAATAGTAGTTGCTTAA 825 44.12 MSFQDIEAGRPFASSRRDLINGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSAKLKQASEIDHHVEVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYTPFVPQAVLPSSYTASESEVSSEKSLEQRALLVESRRQEVLLLDNEIAFNEAIIEEREQGIHEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIEGAHAATSQGTTQLVKASKTQKSNSSLACLLLVIFGIILLIVIIIVVA 274
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
10 16855632 16861526 - MC10g1335 Mch10g1680 678773

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Mch10g1680 274 CDD SynN 24 138 IPR006011 GO:0016020(InterPro)
Mch10g1680 274 Gene3D - 174 274 - -
Mch10g1680 274 SMART tSNARE_6 176 243 IPR000727 -
Mch10g1680 274 PANTHER SYNTAXIN 36 263 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Mch10g1680 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Mch10g1680 274 Gene3D - 21 134 - -
Mch10g1680 274 FunFam Syntaxin-22 like 174 274 - -
Mch10g1680 274 Pfam Syntaxin-like protein 30 130 IPR006011 GO:0016020(InterPro)
Mch10g1680 274 CDD SNARE_Qa 184 242 - -
Mch10g1680 274 Pfam SNARE domain 218 269 IPR000727 -
Mch10g1680 274 FunFam Syntaxin-22 like 21 134 - -
Mch10g1680 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
Mch10g1680 274 SMART SynN_4 16 128 IPR006011 GO:0016020(InterPro)
Mch10g1680 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Mch10g1680 - - - - 0.0
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Mch8g0402 . 8 342 SNARE and Associated Proteins AT3G24350 66.1 2.2e-104 375.9
Mch1g0568 . 39 346 SNARE and Associated Proteins AT1G08560 66.2 2.5e-101 365.5
Mch1g1511 . 450 751 SNARE and Associated Proteins AT2G18260 53.7 5.2e-83 304.7
Mch5g1533 . 19 279 SNARE and Associated Proteins AT3G11820 82.4 1.5e-117 419.5
Mch1g0981 . 21 280 SNARE and Associated Proteins AT3G11820 73.5 1.6e-103 372.9
Mch3g1169 . 31 281 SNARE and Associated Proteins AT3G11820 64.9 1.1e-91 333.6
Mch5g1220 . 25 277 SNARE and Associated Proteins AT3G11820 52.6 1.1e-67 253.8
Mch5g1533 . 1 279 SNARE and Associated Proteins AT3G52400 64.6 1.6e-93 339.7
Mch1g0981 . 32 280 SNARE and Associated Proteins AT3G52400 65.9 3.9e-87 318.5
Mch3g1169 . 1 281 SNARE and Associated Proteins AT3G52400 55.7 1.6e-80 296.6
Mch3g1169 . 1 299 SNARE and Associated Proteins AT4G03330 68.5 9.4e-109 390.2
Mch5g1533 . 1 280 SNARE and Associated Proteins AT4G03330 58.4 2.1e-84 309.3
Mch1g0981 . 1 286 SNARE and Associated Proteins AT4G03330 51.9 3.3e-77 285.4
Mch3g1169 . 1 303 SNARE and Associated Proteins AT1G61290 77.9 4.0e-128 454.5
Mch5g1533 . 1 280 SNARE and Associated Proteins AT1G61290 62.4 1.0e-91 333.6
Mch1g0981 . 1 292 SNARE and Associated Proteins AT1G61290 55.5 3.0e-83 305.4
Mch3g1169 . 1 303 SNARE and Associated Proteins AT1G11250 76.9 3.1e-125 444.9
Mch5g1533 . 1 280 SNARE and Associated Proteins AT1G11250 62.9 3.8e-94 341.7
Mch1g0981 . 1 289 SNARE and Associated Proteins AT1G11250 56.4 2.4e-85 312.4
Mch5g1220 . 1 301 SNARE and Associated Proteins AT3G03800 73.4 2.8e-113 405.2
Mch2g0632 . 1 305 SNARE and Associated Proteins AT3G03800 57.5 4.0e-83 305.1
Mch5g1220 . 1 195 SNARE and Associated Proteins AT5G08080 77.5 3.7e-78 288.1
Mch2g0632 . 1 204 SNARE and Associated Proteins AT5G08080 60.3 6.3e-54 207.6
Mch10g1680 . 1 256 SNARE and Associated Proteins AT5G16830 58.8 1.4e-74 276.6
Mch10g1680 . 1 256 SNARE and Associated Proteins AT5G46860 66.0 2.3e-79 292.4
Mch10g1680 . 1 256 SNARE and Associated Proteins AT4G17730 61.7 1.4e-73 273.1
Mch10g1680 . 65 256 SNARE and Associated Proteins AT1G32270 60.9 6.3e-53 204.9
Mch9g1485 . 1 334 SNARE and Associated Proteins AT5G05760 66.3 5.9e-112 401.0
Mch8g0402 . 8 342 SNARE and Associated Proteins AT3G24350 66.1 2.2e-104 375.9
Mch8g2794 . 1 327 SNARE and Associated Proteins AT5G26980 76.5 1.6e-127 452.6
Mch9g0690 . 1 319 SNARE and Associated Proteins AT5G26980 67.9 1.8e-105 379.4
Mch11g1612 . 1 114 SNARE and Associated Proteins AT5G26980 70.4 1.7e-36 150.2
Mch8g2794 . 1 330 SNARE and Associated Proteins AT4G02195 65.4 7.1e-107 384.0
Mch9g0690 . 1 319 SNARE and Associated Proteins AT4G02195 67.1 1.2e-106 383.3
Mch8g2794 . 1 328 SNARE and Associated Proteins AT3G05710 75.4 4.4e-128 454.5
Mch9g0690 . 1 322 SNARE and Associated Proteins AT3G05710 64.2 1.0e-100 363.6
Mch11g1220 . 1 226 SNARE and Associated Proteins AT1G16240 69.2 5.7e-82 300.8
Mch11g1220 . 1 226 SNARE and Associated Proteins AT1G79590 68.4 1.4e-81 299.7
Mch11g1194 . 56 247 SNARE and Associated Proteins AT1G28490 71.4 1.1e-65 246.5
Mch5g1759 . 1 261 SNARE and Associated Proteins AT3G09740 79.5 6.7e-111 397.1
Mch2g0282 . 1 261 SNARE and Associated Proteins AT3G09740 66.3 1.9e-89 325.9
Mch2g0362 . 1 262 SNARE and Associated Proteins AT3G09740 65.7 3.2e-89 325.1
Mch5g1759 . 1 261 SNARE and Associated Proteins AT3G45280 64.0 1.2e-86 316.6
Mch2g0362 . 1 262 SNARE and Associated Proteins AT3G45280 63.4 1.3e-82 303.1
Mch2g0282 . 1 261 SNARE and Associated Proteins AT3G45280 63.6 2.3e-82 302.4
Mch5g1759 . 1 261 SNARE and Associated Proteins AT3G61450 67.8 6.6e-95 344.0
Mch2g0362 . 1 262 SNARE and Associated Proteins AT3G61450 57.2 8.7e-79 290.4
Mch2g0282 . 1 261 SNARE and Associated Proteins AT3G61450 57.4 2.5e-78 288.9
Mch4g2528 . 65 303 SNARE and Associated Proteins AT1G51740 72.4 4.6e-90 327.8
Mch11g1356 . 39 217 SNARE and Associated Proteins AT1G51740 68.5 4.8e-55 211.5
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45