Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Mch11g1194 ATGCCATCGGCTCAAGATCCCTTCTATGTTGTAAAGGACGAGATTCAAGAATCTATTGATAAACTGCAATCCAGCTTTCACCAATGGGAAAGGATTTCTTCCGATCCAGGAGAGAGAGTACAACTCACTAAAGAGTTGCTCGCTGCCTGTGAGAGCATTGAATGGCAGGTGGACGAATTAGACAAAGCTATTGCTGTGGCAGCTAGAGACCCTTCTTGGTATGGCATTGATGATTTAGAACTTGAAAAACGAAGGAGATGGACGAGTACAGCTAGGACACAGGTTGGAAATGTCAAGAAAGTAGTGGGAGCTGGAAAGGAGCAAACCGGACCCGCTAGTGCAAATGGGATGCGTCGGGAATTGATGAGACTACCTAACCCACACGATACAGACAGATCAAACTTATATACACCCCACCAAGCTAACGACGACTTCATCACATCCGAATCAGATAGACAACTGCTTCTCATAAAGCAGCAGGACGAGGAGTTGGATGAGCTGAGTGCAAGCGTGGAGAGAATTGGAGGCGTTGGGCTTACCATACATGAAGAGCTGCTTGCACAGGATAAAATTATTGACGAGCTAGGAATGGAAATGGACAGTACATCAAATCGTCTTGATTTTGTTCAGAAAAAAGTGGCTGTGGTCATGAAGAAGGCTAGCGCCAAGGGCCAGATAATGATGATATTGTTCTTGTTGGCTTTGTTCATCATTCTTTTTGTGTTGGTATTCCTCACATAA 741 44.67 MPSAQDPFYVVKDEIQESIDKLQSSFHQWERISSDPGERVQLTKELLAACESIEWQVDELDKAIAVAARDPSWYGIDDLELEKRRRWTSTARTQVGNVKKVVGAGKEQTGPASANGMRRELMRLPNPHDTDRSNLYTPHQANDDFITSESDRQLLLIKQQDEELDELSASVERIGGVGLTIHEELLAQDKIIDELGMEMDSTSNRLDFVQKKVAVVMKKASAKGQIMMILFLLALFIILFVLVFLT 246
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
11 8383989 8387804 - MC11g0985 Mch11g1194 680128

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Mch11g1194 246 SMART tSNARE_6 149 216 IPR000727 -
Mch11g1194 246 ProSitePatterns Syntaxin / epimorphin family signature. 160 199 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Mch11g1194 246 CDD SNARE_NTD_AtSYP61-like 5 102 - -
Mch11g1194 246 CDD SNARE_Qc 157 214 - -
Mch11g1194 246 Gene3D - 161 225 - -
Mch11g1194 246 SUPERFAMILY SNARE fusion complex 153 216 - -
Mch11g1194 246 Gene3D - 2 104 - -
Mch11g1194 246 FunFam Syntaxin 10 3 105 - -
Mch11g1194 246 Pfam Syntaxin 6, N-terminal 6 99 IPR015260 GO:0016020(InterPro)|GO:0048193(InterPro)
Mch11g1194 246 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 154 216 IPR000727 -
Mch11g1194 246 PANTHER SYNTAXIN 11 235 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Mch11g1194 246 SUPERFAMILY t-snare proteins 5 100 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Mch11g1194 246 Coils Coil 192 212 - -
Mch11g1194 246 Pfam SNARE domain 191 242 IPR000727 -
Mch11g1194 246 FunFam syntaxin-61 isoform X1 157 218 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Mch11g1194 K08500 - - csv:101212527 400.593
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Mch8g0402 . 8 342 SNARE and Associated Proteins AT3G24350 66.1 2.2e-104 375.9
Mch1g0568 . 39 346 SNARE and Associated Proteins AT1G08560 66.2 2.5e-101 365.5
Mch1g1511 . 450 751 SNARE and Associated Proteins AT2G18260 53.7 5.2e-83 304.7
Mch5g1533 . 19 279 SNARE and Associated Proteins AT3G11820 82.4 1.5e-117 419.5
Mch1g0981 . 21 280 SNARE and Associated Proteins AT3G11820 73.5 1.6e-103 372.9
Mch3g1169 . 31 281 SNARE and Associated Proteins AT3G11820 64.9 1.1e-91 333.6
Mch5g1220 . 25 277 SNARE and Associated Proteins AT3G11820 52.6 1.1e-67 253.8
Mch5g1533 . 1 279 SNARE and Associated Proteins AT3G52400 64.6 1.6e-93 339.7
Mch1g0981 . 32 280 SNARE and Associated Proteins AT3G52400 65.9 3.9e-87 318.5
Mch3g1169 . 1 281 SNARE and Associated Proteins AT3G52400 55.7 1.6e-80 296.6
Mch3g1169 . 1 299 SNARE and Associated Proteins AT4G03330 68.5 9.4e-109 390.2
Mch5g1533 . 1 280 SNARE and Associated Proteins AT4G03330 58.4 2.1e-84 309.3
Mch1g0981 . 1 286 SNARE and Associated Proteins AT4G03330 51.9 3.3e-77 285.4
Mch3g1169 . 1 303 SNARE and Associated Proteins AT1G61290 77.9 4.0e-128 454.5
Mch5g1533 . 1 280 SNARE and Associated Proteins AT1G61290 62.4 1.0e-91 333.6
Mch1g0981 . 1 292 SNARE and Associated Proteins AT1G61290 55.5 3.0e-83 305.4
Mch3g1169 . 1 303 SNARE and Associated Proteins AT1G11250 76.9 3.1e-125 444.9
Mch5g1533 . 1 280 SNARE and Associated Proteins AT1G11250 62.9 3.8e-94 341.7
Mch1g0981 . 1 289 SNARE and Associated Proteins AT1G11250 56.4 2.4e-85 312.4
Mch5g1220 . 1 301 SNARE and Associated Proteins AT3G03800 73.4 2.8e-113 405.2
Mch2g0632 . 1 305 SNARE and Associated Proteins AT3G03800 57.5 4.0e-83 305.1
Mch5g1220 . 1 195 SNARE and Associated Proteins AT5G08080 77.5 3.7e-78 288.1
Mch2g0632 . 1 204 SNARE and Associated Proteins AT5G08080 60.3 6.3e-54 207.6
Mch10g1680 . 1 256 SNARE and Associated Proteins AT5G16830 58.8 1.4e-74 276.6
Mch10g1680 . 1 256 SNARE and Associated Proteins AT5G46860 66.0 2.3e-79 292.4
Mch10g1680 . 1 256 SNARE and Associated Proteins AT4G17730 61.7 1.4e-73 273.1
Mch10g1680 . 65 256 SNARE and Associated Proteins AT1G32270 60.9 6.3e-53 204.9
Mch9g1485 . 1 334 SNARE and Associated Proteins AT5G05760 66.3 5.9e-112 401.0
Mch8g0402 . 8 342 SNARE and Associated Proteins AT3G24350 66.1 2.2e-104 375.9
Mch8g2794 . 1 327 SNARE and Associated Proteins AT5G26980 76.5 1.6e-127 452.6
Mch9g0690 . 1 319 SNARE and Associated Proteins AT5G26980 67.9 1.8e-105 379.4
Mch11g1612 . 1 114 SNARE and Associated Proteins AT5G26980 70.4 1.7e-36 150.2
Mch8g2794 . 1 330 SNARE and Associated Proteins AT4G02195 65.4 7.1e-107 384.0
Mch9g0690 . 1 319 SNARE and Associated Proteins AT4G02195 67.1 1.2e-106 383.3
Mch8g2794 . 1 328 SNARE and Associated Proteins AT3G05710 75.4 4.4e-128 454.5
Mch9g0690 . 1 322 SNARE and Associated Proteins AT3G05710 64.2 1.0e-100 363.6
Mch11g1220 . 1 226 SNARE and Associated Proteins AT1G16240 69.2 5.7e-82 300.8
Mch11g1220 . 1 226 SNARE and Associated Proteins AT1G79590 68.4 1.4e-81 299.7
Mch11g1194 . 56 247 SNARE and Associated Proteins AT1G28490 71.4 1.1e-65 246.5
Mch5g1759 . 1 261 SNARE and Associated Proteins AT3G09740 79.5 6.7e-111 397.1
Mch2g0282 . 1 261 SNARE and Associated Proteins AT3G09740 66.3 1.9e-89 325.9
Mch2g0362 . 1 262 SNARE and Associated Proteins AT3G09740 65.7 3.2e-89 325.1
Mch5g1759 . 1 261 SNARE and Associated Proteins AT3G45280 64.0 1.2e-86 316.6
Mch2g0362 . 1 262 SNARE and Associated Proteins AT3G45280 63.4 1.3e-82 303.1
Mch2g0282 . 1 261 SNARE and Associated Proteins AT3G45280 63.6 2.3e-82 302.4
Mch5g1759 . 1 261 SNARE and Associated Proteins AT3G61450 67.8 6.6e-95 344.0
Mch2g0362 . 1 262 SNARE and Associated Proteins AT3G61450 57.2 8.7e-79 290.4
Mch2g0282 . 1 261 SNARE and Associated Proteins AT3G61450 57.4 2.5e-78 288.9
Mch4g2528 . 65 303 SNARE and Associated Proteins AT1G51740 72.4 4.6e-90 327.8
Mch11g1356 . 39 217 SNARE and Associated Proteins AT1G51740 68.5 4.8e-55 211.5
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003549 2 1 2 2 2 1 2 1 1 1 1 1 2 1 1 2 1 2 1 1 1 1 1 1 1 1 1 5 4 0 44