Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Mch11g1220 ATGGCTTATACTTTGGAATCATGGACGAAGGAATACAATGAAGCTTTGAAACTCTCTGAAGATGTCAACAGCATGATTTCTGAGAGAAGTTCCCTTGCTGCATCCGGACCGGAATCGCAGCGCCATGCCTCAGCTATACGCAGGAAGATCACGATATTGGGTACCAGACTTGATACCTTACAGACTCAGTTACCCAAGCTTCAAGGAAAGCAACCAATATCAGAGAAAGAGATGAATCGCCGCAAGGACATGCTTGCAAATTTGAGATCAAAAACTAATCAGATGGCTTCAGCTTTGAACATGTCAAACTTTGCCAACCGCGATAGCTTACTTGGCCCAGAAATAAAACCAGCTGATGTCATGAGCAGATCAACAGGACTGGACAACCATGGCCTAGTTGAGCAAGATGAAGGCCTTGAGAAGCTGGAAGAGACTGTCATTAGCACAAAACATATTGCATTGGCTGTCAATGAAGAACTTGACCTTCACACCAGACTTATTGATGATTTGGATGAACACGTCGATGTTACAGATTCTCGATTGCGGCGAGTGCAGAAGAGGCTGACAATATTGAACAAGCGGACCAAGGGCGGTTGCACCTGCATGTGCATGCTTTTATCAGTTGTCGCGATTGTCATTCTTATCGCTGCCGTATGGCTACTCATCAAGTATTTGTAA 678 44.69 MAYTLESWTKEYNEALKLSEDVNSMISERSSLAASGPESQRHASAIRRKITILGTRLDTLQTQLPKLQGKQPISEKEMNRRKDMLANLRSKTNQMASALNMSNFANRDSLLGPEIKPADVMSRSTGLDNHGLVEQDEGLEKLEETVISTKHIALAVNEELDLHTRLIDDLDEHVDVTDSRLRRVQKRLTILNKRTKGGCTCMCMLLSVVAIVILIAAVWLLIKYL 225
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
11 8635703 8638399 + MC11g1009 Mch11g1220 680154

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Mch11g1220 225 PANTHER SYNTAXIN 11 211 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Mch11g1220 225 FunFam syntaxin-51 isoform X2 132 193 - -
Mch11g1220 225 Gene3D - 131 193 - -
Mch11g1220 225 Pfam SNARE domain 166 215 IPR000727 -
Mch11g1220 225 SUPERFAMILY SNARE fusion complex 132 190 - -
Mch11g1220 225 CDD SNARE_Qc 134 188 - -
Mch11g1220 225 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 134 191 IPR000727 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Mch11g1220 K08503 - - csv:101208669 376.326
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi19g583 Blo03g00538 . Bda07g00381 Bda09g00411 . Bpe08g01109 . . Cmo16g00959 . Cma01g01111 Cma09g00975 Car01g00980 Car09g00889 Sed07g2705 Cpe06g00787 Cpe02g00792 Bhi09g01700 Tan01g3132 Cmetu01g0482 . Hepe01g1245 Mch11g1220 . . . . . . . . Cone6ag0041 Cone9ag0047 Cone14ag1185 Cone15ag1202 Lsi02g01877 . . . . . Bda05g00693 . . Bpe03g00767 Bma07g01281 Bma14g00320 . Cmo01g01156 Cmo09g00974 . Cma16g00924 . Car16g00895 Cpe14g00748 . . . . . . . . Cla09g01036 Cam09g1092 Cec09g1092 Cco09g1113 . . Cre09g1057 . . Chy01g01059 Cme01g00994
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Mch8g0402 . 8 342 SNARE and Associated Proteins AT3G24350 66.1 2.2e-104 375.9
Mch1g0568 . 39 346 SNARE and Associated Proteins AT1G08560 66.2 2.5e-101 365.5
Mch1g1511 . 450 751 SNARE and Associated Proteins AT2G18260 53.7 5.2e-83 304.7
Mch5g1533 . 19 279 SNARE and Associated Proteins AT3G11820 82.4 1.5e-117 419.5
Mch1g0981 . 21 280 SNARE and Associated Proteins AT3G11820 73.5 1.6e-103 372.9
Mch3g1169 . 31 281 SNARE and Associated Proteins AT3G11820 64.9 1.1e-91 333.6
Mch5g1220 . 25 277 SNARE and Associated Proteins AT3G11820 52.6 1.1e-67 253.8
Mch5g1533 . 1 279 SNARE and Associated Proteins AT3G52400 64.6 1.6e-93 339.7
Mch1g0981 . 32 280 SNARE and Associated Proteins AT3G52400 65.9 3.9e-87 318.5
Mch3g1169 . 1 281 SNARE and Associated Proteins AT3G52400 55.7 1.6e-80 296.6
Mch3g1169 . 1 299 SNARE and Associated Proteins AT4G03330 68.5 9.4e-109 390.2
Mch5g1533 . 1 280 SNARE and Associated Proteins AT4G03330 58.4 2.1e-84 309.3
Mch1g0981 . 1 286 SNARE and Associated Proteins AT4G03330 51.9 3.3e-77 285.4
Mch3g1169 . 1 303 SNARE and Associated Proteins AT1G61290 77.9 4.0e-128 454.5
Mch5g1533 . 1 280 SNARE and Associated Proteins AT1G61290 62.4 1.0e-91 333.6
Mch1g0981 . 1 292 SNARE and Associated Proteins AT1G61290 55.5 3.0e-83 305.4
Mch3g1169 . 1 303 SNARE and Associated Proteins AT1G11250 76.9 3.1e-125 444.9
Mch5g1533 . 1 280 SNARE and Associated Proteins AT1G11250 62.9 3.8e-94 341.7
Mch1g0981 . 1 289 SNARE and Associated Proteins AT1G11250 56.4 2.4e-85 312.4
Mch5g1220 . 1 301 SNARE and Associated Proteins AT3G03800 73.4 2.8e-113 405.2
Mch2g0632 . 1 305 SNARE and Associated Proteins AT3G03800 57.5 4.0e-83 305.1
Mch5g1220 . 1 195 SNARE and Associated Proteins AT5G08080 77.5 3.7e-78 288.1
Mch2g0632 . 1 204 SNARE and Associated Proteins AT5G08080 60.3 6.3e-54 207.6
Mch10g1680 . 1 256 SNARE and Associated Proteins AT5G16830 58.8 1.4e-74 276.6
Mch10g1680 . 1 256 SNARE and Associated Proteins AT5G46860 66.0 2.3e-79 292.4
Mch10g1680 . 1 256 SNARE and Associated Proteins AT4G17730 61.7 1.4e-73 273.1
Mch10g1680 . 65 256 SNARE and Associated Proteins AT1G32270 60.9 6.3e-53 204.9
Mch9g1485 . 1 334 SNARE and Associated Proteins AT5G05760 66.3 5.9e-112 401.0
Mch8g0402 . 8 342 SNARE and Associated Proteins AT3G24350 66.1 2.2e-104 375.9
Mch8g2794 . 1 327 SNARE and Associated Proteins AT5G26980 76.5 1.6e-127 452.6
Mch9g0690 . 1 319 SNARE and Associated Proteins AT5G26980 67.9 1.8e-105 379.4
Mch11g1612 . 1 114 SNARE and Associated Proteins AT5G26980 70.4 1.7e-36 150.2
Mch8g2794 . 1 330 SNARE and Associated Proteins AT4G02195 65.4 7.1e-107 384.0
Mch9g0690 . 1 319 SNARE and Associated Proteins AT4G02195 67.1 1.2e-106 383.3
Mch8g2794 . 1 328 SNARE and Associated Proteins AT3G05710 75.4 4.4e-128 454.5
Mch9g0690 . 1 322 SNARE and Associated Proteins AT3G05710 64.2 1.0e-100 363.6
Mch11g1220 . 1 226 SNARE and Associated Proteins AT1G16240 69.2 5.7e-82 300.8
Mch11g1220 . 1 226 SNARE and Associated Proteins AT1G79590 68.4 1.4e-81 299.7
Mch11g1194 . 56 247 SNARE and Associated Proteins AT1G28490 71.4 1.1e-65 246.5
Mch5g1759 . 1 261 SNARE and Associated Proteins AT3G09740 79.5 6.7e-111 397.1
Mch2g0282 . 1 261 SNARE and Associated Proteins AT3G09740 66.3 1.9e-89 325.9
Mch2g0362 . 1 262 SNARE and Associated Proteins AT3G09740 65.7 3.2e-89 325.1
Mch5g1759 . 1 261 SNARE and Associated Proteins AT3G45280 64.0 1.2e-86 316.6
Mch2g0362 . 1 262 SNARE and Associated Proteins AT3G45280 63.4 1.3e-82 303.1
Mch2g0282 . 1 261 SNARE and Associated Proteins AT3G45280 63.6 2.3e-82 302.4
Mch5g1759 . 1 261 SNARE and Associated Proteins AT3G61450 67.8 6.6e-95 344.0
Mch2g0362 . 1 262 SNARE and Associated Proteins AT3G61450 57.2 8.7e-79 290.4
Mch2g0282 . 1 261 SNARE and Associated Proteins AT3G61450 57.4 2.5e-78 288.9
Mch4g2528 . 65 303 SNARE and Associated Proteins AT1G51740 72.4 4.6e-90 327.8
Mch11g1356 . 39 217 SNARE and Associated Proteins AT1G51740 68.5 4.8e-55 211.5
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002063 3 5 2 3 2 1 3 1 2 1 1 1 3 2 2 3 1 4 3 1 2 2 1 2 2 2 1 5 3 1 65