Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Sed04g2326 ATGCCGTCCGTCTATGGAGATCGATTGACCACCTTTGAGGATTCTGAGAAGGAAAGCGAGTACGGATATGTCCGGAAGGTATCTGGACCAGTCGTCGTGGCAGATGGCATGGGAGGTGCAGCCATGTATGAGTTGGTTCGTGTTGGTCATGATAATCTGATTGGTGAAATCATTAGATTAGAAGGAGATTCTGCCACAATTCAGGTTTATGAGGAAACAGCTGGTTTGATGGTGAATGATCCTGTTTTACGTACTCACAAACCCCTGTCAGTGGAGTTGGGACCTGGAATATTGGGAAATATATTTGATGGCATTCAGAGGCCACTGAAAACAATTGCAAAGAGATCAGGAGATGTCTACATTCCTCGTGGTGTTTCTGTCCCGGCACTTGACAAAGACATACTTTGGGAATTCAAACCCAAAAAACTAGGTGAGGGCGACTTAGTGACAGGCGGAGACTTGTATGCTACTGTCTTTGAGAATAGTTTAATGGAACACCATATCGCACTTCCTCCTGATGCTATGGGGAAAATTACCTATGTTGCACCACCTGGTCAATATTCACTAAAGGATACTGTTTTAGAGCTTGAGTTCCAAGGAGTTAAAAAGCAATTTACCATGCTTCAGAATTGGCCTGTGCGTACTCCTAGACCAGTTGCATCTAAGCTTGCAGCTGATACCCCTCTTCTGACTGGGCAGCGTGTTCTTGATGCACTCTTCCCTTCTGTCCTTGGTGGAACTTGTGCCATTCCTGGAGCATTTGGTTGTGGAAAAACAGTCATTAGTCAAGCTCTCTCTAAATACTCAAATTCTGATACTGTGGTGTATGTTGGTTGTGGAGAGAGAGGAAATGAAATGGCTGAAGTTCTTATGGATTTTCCTCAATTGACAATGACTTTACCTGATGGCCGTGAGGAATCTGTCATGAAGCGTACCACTCTTGTGGCTAACACTTCTAATATGCCTGTGGCTGCTCGTGAAGCTTCCATTTATACTGGAATTACTTTGGCTGAATACTTCAGAGATATGGGATACAATGTCAGCATGATGGCAGATTCAACATCTCGATGGGCAGAAGCACTACGTGAAATATCAGGACGACTGGCTGAAATGCCTGCAGATAGTGGATATCCTGCATACCTAGCAGCACGTCTAGCCTCTTTCTACGAGCGTGCTGGTAAAGTAAAATGTCTTGGTGGGCCGGAACGAACTGGCAGTGTTACCATTGTCGGTGCTGTTTCTCCGCCAGGAGGAGATTTTTCTGATCCTGTGACATCTGCTACCCTCAGTATCGTCCAGGTTTTCTGGGGTCTAGATAAGAAGCTTGCCCAGAGGAAGCATTTCCCATCCGTAAACTGGCTAATTTCATACTCAAAATACTCTACTGCATTGGAGTCCTTCTATGAGAAGTTTGATTCAGATTTTATTAGCATCAGGACGAAGGCTCGAGAAGTTCTCCAGAGAGAAGATGACCTCAATGAAATCGTCCAGCTTGTAGGAAAGGATGCCTTGGCTGAAGGAGATAAGATTACCTTAGAGACTGCAAAGCTTTTGAGGGAGGACTATCTTGCTCAGAATGCATTTACTCCGTATGATAAATTCTGCCCCTTCTACAAGTCGGTCTGGATGATGCGCAATATCATCCATTTCTACAATTTAGCCAATCAGGCAGTAGAAAGGGGAGCAGGCATGGATGGCCAGAAGATAACATACAGTTTGATTAAGCATCGGTTGGGAGATCTGTTCTATCGCCTGGTGTCTCAGAAGTTCGAGGACCCAGCTGAAGGAGAAGCAGCTCTTGTTGAGAAATTTAAGAAGCTGCATGATGATCTTACAAATGGCTTCCGTGCTCTCGAGGACGAAACTCGGTAG 1872 44.98 MPSVYGDRLTTFEDSEKESEYGYVRKVSGPVVVADGMGGAAMYELVRVGHDNLIGEIIRLEGDSATIQVYEETAGLMVNDPVLRTHKPLSVELGPGILGNIFDGIQRPLKTIAKRSGDVYIPRGVSVPALDKDILWEFKPKKLGEGDLVTGGDLYATVFENSLMEHHIALPPDAMGKITYVAPPGQYSLKDTVLELEFQGVKKQFTMLQNWPVRTPRPVASKLAADTPLLTGQRVLDALFPSVLGGTCAIPGAFGCGKTVISQALSKYSNSDTVVYVGCGERGNEMAEVLMDFPQLTMTLPDGREESVMKRTTLVANTSNMPVAAREASIYTGITLAEYFRDMGYNVSMMADSTSRWAEALREISGRLAEMPADSGYPAYLAARLASFYERAGKVKCLGGPERTGSVTIVGAVSPPGGDFSDPVTSATLSIVQVFWGLDKKLAQRKHFPSVNWLISYSKYSTALESFYEKFDSDFISIRTKAREVLQREDDLNEIVQLVGKDALAEGDKITLETAKLLREDYLAQNAFTPYDKFCPFYKSVWMMRNIIHFYNLANQAVERGAGMDGQKITYSLIKHRLGDLFYRLVSQKFEDPAEGEAALVEKFKKLHDDLTNGFRALEDETR 623
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
4 36903707 36910548 - Sed0012993.1 Sed04g2326 710929

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Sed04g2326 623 FunFam V-type proton ATPase catalytic subunit A 194 457 - -
Sed04g2326 623 SUPERFAMILY P-loop containing nucleoside triphosphate hydrolases 202 462 IPR027417 -
Sed04g2326 623 FunFam V-type proton ATPase catalytic subunit A 20 89 - -
Sed04g2326 623 Pfam ATP synthase alpha/beta family, beta-barrel domain 25 85 IPR004100 GO:0046034(InterPro)|GO:1902600(InterPro)
Sed04g2326 623 SUPERFAMILY C-terminal domain of alpha and beta subunits of F1 ATP synthase 471 553 - -
Sed04g2326 623 FunFam V-type proton ATPase catalytic subunit A 459 612 - -
Sed04g2326 623 Gene3D - 20 89 IPR023366 -
Sed04g2326 623 ProSitePatterns ATP synthase alpha and beta subunits signature. 449 458 IPR020003 GO:0005524(InterPro)
Sed04g2326 623 Pfam ATPsynthase alpha/beta subunit N-term extension 102 223 IPR031686 -
Sed04g2326 623 NCBIfam V-type ATPase subunit A 20 611 IPR005725 GO:0016887(InterPro)|GO:0033180(InterPro)|GO:0046961(InterPro)|GO:1902600(InterPro)
Sed04g2326 623 CDD ATP-synt_V_A-type_alpha_N 21 87 - -
Sed04g2326 623 SUPERFAMILY N-terminal domain of alpha and beta subunits of F1 ATP synthase 17 89 IPR036121 GO:0046034(InterPro)|GO:1902600(InterPro)
Sed04g2326 623 Gene3D - 134 205 - -
Sed04g2326 623 Gene3D - 91 457 IPR027417 -
Sed04g2326 623 PANTHER V-TYPE PROTON ATPASE CATALYTIC SUBUNIT A 10 620 IPR022878 GO:0000325(PANTHER)|GO:0046034(InterPro)|GO:0046961(PANTHER)|GO:0046961(InterPro)|GO:1902600(PANTHER)
Sed04g2326 623 CDD V_A-ATPase_A 88 460 - -
Sed04g2326 623 Gene3D - 459 610 IPR024034 -
Sed04g2326 623 Pfam C-terminal domain of V and A type ATP synthase 466 561 - -
Sed04g2326 623 CDD ATP-synt_V_A-type_alpha_C 475 581 - -
Sed04g2326 623 Hamap V-type ATP synthase alpha chain [atpA]. 19 622 IPR022878 GO:0046034(InterPro)|GO:0046961(InterPro)
Sed04g2326 623 Pfam ATP synthase alpha/beta family, nucleotide-binding domain 232 458 IPR000194 GO:0005524(InterPro)
Sed04g2326 623 FunFam V-type proton ATPase catalytic subunit A 134 205 - -
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Sed04g2326 K02145 - - csv:101216234 1209.13
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Sed10g1165 . 1 996 Primary Pumps ATPases(2) AT1G10130 83.5 0.0e+00 1623.2
Sed01g0902 . 1 814 Primary Pumps ATPases(2) AT2G28520 79.8 0.0e+00 1318.1
Sed05g2892 . 1 814 Primary Pumps ATPases(2) AT2G28520 79.1 0.0e+00 1306.6
Sed01g0903 . 1 846 Primary Pumps ATPases(2) AT2G28520 76.8 0.0e+00 1301.6
Sed03g1719 . 1 798 Primary Pumps ATPases(2) AT2G28520 62.9 1.0e-296 1016.9
Sed04g3911 . 10 812 Primary Pumps ATPases(2) AT2G28520 63.6 1.5e-292 1003.0
Sed05g2301 . 10 813 Primary Pumps ATPases(2) AT2G28520 61.8 6.6e-288 987.6
Sed04g3912 . 10 729 Primary Pumps ATPases(2) AT2G28520 62.8 9.3e-258 887.5
Sed04g3911 . 7 817 Primary Pumps ATPases(2) AT2G21410 75.2 0.0e+00 1218.0
Sed05g2301 . 6 818 Primary Pumps ATPases(2) AT2G21410 74.3 0.0e+00 1208.4
Sed03g1719 . 1 803 Primary Pumps ATPases(2) AT2G21410 72.9 0.0e+00 1191.0
Sed04g3912 . 7 729 Primary Pumps ATPases(2) AT2G21410 75.3 0.0e+00 1090.1
Sed01g0902 . 9 819 Primary Pumps ATPases(2) AT2G21410 61.4 3.9e-296 1015.0
Sed05g2892 . 9 818 Primary Pumps ATPases(2) AT2G21410 61.4 3.1e-293 1005.4
Sed01g0903 . 9 851 Primary Pumps ATPases(2) AT2G21410 59.1 3.8e-291 998.4
Sed04g3911 . 8 817 Primary Pumps ATPases(2) AT4G39080 76.0 0.0e+00 1216.4
Sed05g2301 . 1 818 Primary Pumps ATPases(2) AT4G39080 74.7 0.0e+00 1208.4
Sed03g1719 . 1 803 Primary Pumps ATPases(2) AT4G39080 73.5 0.0e+00 1189.9
Sed04g3912 . 8 729 Primary Pumps ATPases(2) AT4G39080 76.0 0.0e+00 1086.2
Sed01g0902 . 9 818 Primary Pumps ATPases(2) AT4G39080 63.1 8.7e-296 1013.8
Sed05g2892 . 9 818 Primary Pumps ATPases(2) AT4G39080 62.7 4.0e-293 1005.0
Sed01g0903 . 9 850 Primary Pumps ATPases(2) AT4G39080 60.7 8.4e-291 997.3
Sed03g1704 . 28 165 Primary Pumps ATPases(2) AT4G34720 98.6 1.1e-60 230.3
Sed03g1705 . 28 165 Primary Pumps ATPases(2) AT4G34720 98.6 1.1e-60 230.3
Sed04g0491 . 29 166 Primary Pumps ATPases(2) AT4G34720 98.6 1.1e-60 230.3
Sed11g1074 . 28 165 Primary Pumps ATPases(2) AT4G34720 98.6 1.1e-60 230.3
Sed11g1075 . 28 165 Primary Pumps ATPases(2) AT4G34720 98.6 1.1e-60 230.3
Sed03g1706 . 28 164 Primary Pumps ATPases(2) AT4G34720 87.6 2.5e-57 219.2
Sed04g0491 . 1 166 Primary Pumps ATPases(2) AT1G75630 80.5 9.8e-68 254.2
Sed03g1704 . 2 165 Primary Pumps ATPases(2) AT1G75630 80.3 6.4e-67 251.5
Sed11g1075 . 2 165 Primary Pumps ATPases(2) AT1G75630 80.3 6.4e-67 251.5
Sed03g1705 . 2 165 Primary Pumps ATPases(2) AT1G75630 79.8 2.4e-66 249.6
Sed11g1074 . 2 165 Primary Pumps ATPases(2) AT1G75630 79.8 2.4e-66 249.6
Sed03g1706 . 2 164 Primary Pumps ATPases(2) AT1G75630 71.1 2.8e-62 236.1
Sed11g1074 . 3 165 Primary Pumps ATPases(2) AT2G16510 98.2 7.6e-74 274.2
Sed03g1704 . 3 165 Primary Pumps ATPases(2) AT2G16510 98.2 1.3e-73 273.5
Sed11g1075 . 3 165 Primary Pumps ATPases(2) AT2G16510 98.2 1.3e-73 273.5
Sed04g0491 . 4 166 Primary Pumps ATPases(2) AT2G16510 98.2 1.7e-73 273.1
Sed03g1705 . 1 165 Primary Pumps ATPases(2) AT2G16510 98.2 2.2e-73 272.7
Sed03g1706 . 3 164 Primary Pumps ATPases(2) AT2G16510 88.3 3.9e-70 261.9
Sed11g1074 . 1 122 Primary Pumps ATPases(2) AT1G19910 96.7 1.6e-52 203.0
Sed03g1704 . 1 122 Primary Pumps ATPases(2) AT1G19910 96.7 2.7e-52 202.2
Sed11g1075 . 1 122 Primary Pumps ATPases(2) AT1G19910 96.7 2.7e-52 202.2
Sed03g1705 . 1 122 Primary Pumps ATPases(2) AT1G19910 95.9 7.9e-52 200.7
Sed04g0491 . 4 123 Primary Pumps ATPases(2) AT1G19910 97.5 1.3e-51 199.9
Sed03g1706 . 1 122 Primary Pumps ATPases(2) AT1G19910 85.2 5.7e-50 194.5
Sed01g1346 . 6 180 Primary Pumps ATPases(2) AT2G25610 82.9 1.7e-71 266.9
Sed13g2038 . 1 180 Primary Pumps ATPases(2) AT2G25610 82.8 3.7e-71 265.8
Sed03g1580 . 4 180 Primary Pumps ATPases(2) AT2G25610 84.2 6.3e-71 265.0
Sed03g1704 . 28 165 Primary Pumps ATPases(2) AT4G38920 98.6 3.1e-60 228.8
Sed03g1705 . 28 165 Primary Pumps ATPases(2) AT4G38920 98.6 3.1e-60 228.8
Sed04g0491 . 29 166 Primary Pumps ATPases(2) AT4G38920 98.6 3.1e-60 228.8
Sed11g1074 . 28 165 Primary Pumps ATPases(2) AT4G38920 98.6 3.1e-60 228.8
Sed11g1075 . 28 165 Primary Pumps ATPases(2) AT4G38920 98.6 3.1e-60 228.8
Sed03g1706 . 28 164 Primary Pumps ATPases(2) AT4G38920 87.6 7.1e-57 217.6
Sed13g2038 . 1 180 Primary Pumps ATPases(2) AT4G32530 76.2 2.7e-76 282.7
Sed01g1346 . 1 180 Primary Pumps ATPases(2) AT4G32530 75.2 6.0e-76 281.6
Sed03g1580 . 1 180 Primary Pumps ATPases(2) AT4G32530 72.9 1.5e-71 266.9
Sed01g1059 . 1 1065 Primary Pumps ATPases(2) AT1G07810 81.0 0.0e+00 1681.4
Sed13g1363 . 1 1066 Primary Pumps ATPases(2) AT1G07810 80.9 0.0e+00 1673.7
Sed01g1060 . 1 796 Primary Pumps ATPases(2) AT1G07810 78.7 0.0e+00 1211.8
Sed01g1059 . 1 1065 Primary Pumps ATPases(2) AT1G07670 80.8 0.0e+00 1681.8
Sed13g1363 . 1 1066 Primary Pumps ATPases(2) AT1G07670 80.8 0.0e+00 1676.8
Sed01g1060 . 1 796 Primary Pumps ATPases(2) AT1G07670 78.4 0.0e+00 1212.6
Sed10g1165 . 1 996 Primary Pumps ATPases(2) AT1G10130 83.5 0.0e+00 1623.2
Sed13g1363 . 22 1047 Primary Pumps ATPases(2) AT4G00900 66.3 0.0e+00 1328.9
Sed01g1059 . 22 1046 Primary Pumps ATPases(2) AT4G00900 66.4 0.0e+00 1328.2
Sed01g1060 . 22 796 Primary Pumps ATPases(2) AT4G00900 64.1 2.5e-279 959.5
Sed04g0475 . 1 126 Primary Pumps ATPases(2) AT4G02620 84.1 5.0e-57 218.0
Sed11g1588 . 1 126 Primary Pumps ATPases(2) AT4G02620 83.3 8.6e-57 217.2
Sed05g2250 . 6 488 Primary Pumps ATPases(2) AT1G76030 96.1 1.6e-268 922.5
Sed05g2251 . 6 488 Primary Pumps ATPases(2) AT1G76030 96.1 1.6e-268 922.5
Sed04g3835 . 9 488 Primary Pumps ATPases(2) AT1G76030 96.5 5.9e-268 920.6
Sed04g3836 . 9 488 Primary Pumps ATPases(2) AT1G76030 96.5 5.9e-268 920.6
Sed04g1358 . 2 109 Primary Pumps ATPases(2) AT3G01390 78.7 6.5e-37 151.0
Sed01g2953 . 1 376 Primary Pumps ATPases(2) AT1G12840 83.2 1.2e-180 630.2
Sed03g0935 . 1 376 Primary Pumps ATPases(2) AT1G12840 82.7 2.0e-178 622.9
Sed05g3426 . 1 261 Primary Pumps ATPases(2) AT3G58730 82.4 5.1e-117 418.3
Sed05g3427 . 1 261 Primary Pumps ATPases(2) AT3G58730 82.4 5.1e-117 418.3
Sed05g3428 . 1 261 Primary Pumps ATPases(2) AT3G58730 82.4 5.1e-117 418.3
Sed04g3452 . 1 261 Primary Pumps ATPases(2) AT3G58730 81.2 8.8e-117 417.5
Sed04g3453 . 1 261 Primary Pumps ATPases(2) AT3G58730 81.2 8.8e-117 417.5
Sed05g1882 . 1 261 Primary Pumps ATPases(2) AT3G58730 81.2 4.4e-116 415.2
Sed03g3115 . 4 454 Primary Pumps ATPases(2) AT3G42050 79.2 1.4e-204 709.9
Sed03g3114 . 4 454 Primary Pumps ATPases(2) AT3G42050 79.2 1.4e-204 709.9
Sed14g0260 . 3 453 Primary Pumps ATPases(2) AT3G42050 78.3 3.2e-204 708.8
Sed14g0261 . 3 453 Primary Pumps ATPases(2) AT3G42050 78.3 3.2e-204 708.8
Sed03g2360 . 1 132 Primary Pumps ATPases(2) AT3G42050 64.2 3.0e-45 180.6
Sed11g1074 . 3 165 Primary Pumps ATPases(2) AT2G16510 98.2 7.6e-74 274.2
Sed03g1704 . 3 165 Primary Pumps ATPases(2) AT2G16510 98.2 1.3e-73 273.5
Sed11g1075 . 3 165 Primary Pumps ATPases(2) AT2G16510 98.2 1.3e-73 273.5
Sed04g0491 . 4 166 Primary Pumps ATPases(2) AT2G16510 98.2 1.7e-73 273.1
Sed03g1705 . 1 165 Primary Pumps ATPases(2) AT2G16510 98.2 2.2e-73 272.7
Sed03g1706 . 3 164 Primary Pumps ATPases(2) AT2G16510 88.3 3.9e-70 261.9
Sed05g2250 . 1 488 Primary Pumps ATPases(2) AT4G38510 95.9 1.3e-270 929.5
Sed05g2251 . 1 488 Primary Pumps ATPases(2) AT4G38510 95.9 1.3e-270 929.5
Sed04g3835 . 12 488 Primary Pumps ATPases(2) AT4G38510 96.9 3.5e-268 921.4
Sed04g3836 . 12 488 Primary Pumps ATPases(2) AT4G38510 96.9 3.5e-268 921.4
Sed06g0421 . 1 183 Primary Pumps ATPases(2) AT1G64200 73.7 5.2e-66 248.4
Sed08g1522 . 1 183 Primary Pumps ATPases(2) AT1G64200 73.2 2.8e-64 242.7
Sed08g1523 . 1 183 Primary Pumps ATPases(2) AT1G64200 73.2 2.8e-64 242.7
Sed08g1524 . 1 183 Primary Pumps ATPases(2) AT1G64200 73.2 2.8e-64 242.7
Sed05g2250 . 9 488 Primary Pumps ATPases(2) AT1G20260 95.8 3.3e-266 914.8
Sed05g2251 . 9 488 Primary Pumps ATPases(2) AT1G20260 95.8 3.3e-266 914.8
Sed04g3835 . 9 488 Primary Pumps ATPases(2) AT1G20260 95.8 4.3e-266 914.4
Sed04g3836 . 9 488 Primary Pumps ATPases(2) AT1G20260 95.8 4.3e-266 914.4
Sed01g0902 . 1 814 Primary Pumps ATPases(2) AT2G28520 79.8 0.0e+00 1318.1
Sed05g2892 . 1 814 Primary Pumps ATPases(2) AT2G28520 79.1 0.0e+00 1306.6
Sed01g0903 . 1 846 Primary Pumps ATPases(2) AT2G28520 76.8 0.0e+00 1301.6
Sed03g1719 . 1 798 Primary Pumps ATPases(2) AT2G28520 62.9 1.0e-296 1016.9
Sed04g3911 . 10 812 Primary Pumps ATPases(2) AT2G28520 63.6 1.5e-292 1003.0
Sed05g2301 . 10 813 Primary Pumps ATPases(2) AT2G28520 61.8 6.6e-288 987.6
Sed04g3912 . 10 729 Primary Pumps ATPases(2) AT2G28520 62.8 9.3e-258 887.5
Sed08g1348 . 1 351 Primary Pumps ATPases(2) AT3G28715 91.5 5.4e-191 664.5
Sed06g0609 . 1 351 Primary Pumps ATPases(2) AT3G28715 91.2 6.0e-190 661.0
Sed06g0421 . 1 229 Primary Pumps ATPases(2) AT4G11150 77.8 6.6e-92 334.7
Sed08g1522 . 1 229 Primary Pumps ATPases(2) AT4G11150 78.7 3.3e-91 332.4
Sed08g1523 . 1 229 Primary Pumps ATPases(2) AT4G11150 78.7 3.3e-91 332.4
Sed08g1524 . 1 229 Primary Pumps ATPases(2) AT4G11150 78.7 3.3e-91 332.4
Sed04g2326 . 1 623 Primary Pumps ATPases(2) AT1G78900 93.7 0.0e+00 1175.6
Sed05g2250 . 6 488 Primary Pumps ATPases(2) AT1G76030 96.1 1.6e-268 922.5
Sed05g2251 . 6 488 Primary Pumps ATPases(2) AT1G76030 96.1 1.6e-268 922.5
Sed04g3835 . 9 488 Primary Pumps ATPases(2) AT1G76030 96.5 5.9e-268 920.6
Sed04g3836 . 9 488 Primary Pumps ATPases(2) AT1G76030 96.5 5.9e-268 920.6
Sed05g2250 . 1 488 Primary Pumps ATPases(2) AT4G38510 95.9 1.3e-270 929.5
Sed05g2251 . 1 488 Primary Pumps ATPases(2) AT4G38510 95.9 1.3e-270 929.5
Sed04g3835 . 12 488 Primary Pumps ATPases(2) AT4G38510 96.9 3.5e-268 921.4
Sed04g3836 . 12 488 Primary Pumps ATPases(2) AT4G38510 96.9 3.5e-268 921.4
Sed05g2250 . 9 488 Primary Pumps ATPases(2) AT1G20260 95.8 3.3e-266 914.8
Sed05g2251 . 9 488 Primary Pumps ATPases(2) AT1G20260 95.8 3.3e-266 914.8
Sed04g3835 . 9 488 Primary Pumps ATPases(2) AT1G20260 95.8 4.3e-266 914.4
Sed04g3836 . 9 488 Primary Pumps ATPases(2) AT1G20260 95.8 4.3e-266 914.4
Sed01g2953 . 1 376 Primary Pumps ATPases(2) AT1G12840 83.2 1.2e-180 630.2
Sed03g0935 . 1 376 Primary Pumps ATPases(2) AT1G12840 82.7 2.0e-178 622.9
Sed05g3426 . 1 261 Primary Pumps ATPases(2) AT3G58730 82.4 5.1e-117 418.3
Sed05g3427 . 1 261 Primary Pumps ATPases(2) AT3G58730 82.4 5.1e-117 418.3
Sed05g3428 . 1 261 Primary Pumps ATPases(2) AT3G58730 82.4 5.1e-117 418.3
Sed04g3452 . 1 261 Primary Pumps ATPases(2) AT3G58730 81.2 8.8e-117 417.5
Sed04g3453 . 1 261 Primary Pumps ATPases(2) AT3G58730 81.2 8.8e-117 417.5
Sed05g1882 . 1 261 Primary Pumps ATPases(2) AT3G58730 81.2 4.4e-116 415.2
Sed06g0421 . 1 229 Primary Pumps ATPases(2) AT4G11150 77.8 6.6e-92 334.7
Sed08g1522 . 1 229 Primary Pumps ATPases(2) AT4G11150 78.7 3.3e-91 332.4
Sed08g1523 . 1 229 Primary Pumps ATPases(2) AT4G11150 78.7 3.3e-91 332.4
Sed08g1524 . 1 229 Primary Pumps ATPases(2) AT4G11150 78.7 3.3e-91 332.4
Sed06g0421 . 1 223 Primary Pumps ATPases(2) AT3G08560 69.5 4.0e-76 282.3
Sed08g1522 . 1 223 Primary Pumps ATPases(2) AT3G08560 69.0 2.6e-75 279.6
Sed08g1523 . 1 223 Primary Pumps ATPases(2) AT3G08560 69.0 2.6e-75 279.6
Sed08g1524 . 1 223 Primary Pumps ATPases(2) AT3G08560 69.0 2.6e-75 279.6
Sed06g0421 . 1 183 Primary Pumps ATPases(2) AT1G64200 73.7 5.2e-66 248.4
Sed08g1522 . 1 183 Primary Pumps ATPases(2) AT1G64200 73.2 2.8e-64 242.7
Sed08g1523 . 1 183 Primary Pumps ATPases(2) AT1G64200 73.2 2.8e-64 242.7
Sed08g1524 . 1 183 Primary Pumps ATPases(2) AT1G64200 73.2 2.8e-64 242.7
Sed04g0475 . 1 126 Primary Pumps ATPases(2) AT4G02620 84.1 5.0e-57 218.0
Sed11g1588 . 1 126 Primary Pumps ATPases(2) AT4G02620 83.3 8.6e-57 217.2
Sed04g1358 . 2 109 Primary Pumps ATPases(2) AT3G01390 78.7 6.5e-37 151.0
Sed03g3115 . 4 454 Primary Pumps ATPases(2) AT3G42050 79.2 1.4e-204 709.9
Sed03g3114 . 4 454 Primary Pumps ATPases(2) AT3G42050 79.2 1.4e-204 709.9
Sed14g0260 . 3 453 Primary Pumps ATPases(2) AT3G42050 78.3 3.2e-204 708.8
Sed14g0261 . 3 453 Primary Pumps ATPases(2) AT3G42050 78.3 3.2e-204 708.8
Sed03g2360 . 1 132 Primary Pumps ATPases(2) AT3G42050 64.2 3.0e-45 180.6
Sed01g0902 . 1 814 Primary Pumps ATPases(2) AT2G28520 79.8 0.0e+00 1318.1
Sed05g2892 . 1 814 Primary Pumps ATPases(2) AT2G28520 79.1 0.0e+00 1306.6
Sed01g0903 . 1 846 Primary Pumps ATPases(2) AT2G28520 76.8 0.0e+00 1301.6
Sed03g1719 . 1 798 Primary Pumps ATPases(2) AT2G28520 62.9 1.0e-296 1016.9
Sed04g3911 . 10 812 Primary Pumps ATPases(2) AT2G28520 63.6 1.5e-292 1003.0
Sed05g2301 . 10 813 Primary Pumps ATPases(2) AT2G28520 61.8 6.6e-288 987.6
Sed04g3912 . 10 729 Primary Pumps ATPases(2) AT2G28520 62.8 9.3e-258 887.5
Sed04g3911 . 7 817 Primary Pumps ATPases(2) AT2G21410 75.2 0.0e+00 1218.0
Sed05g2301 . 6 818 Primary Pumps ATPases(2) AT2G21410 74.3 0.0e+00 1208.4
Sed03g1719 . 1 803 Primary Pumps ATPases(2) AT2G21410 72.9 0.0e+00 1191.0
Sed04g3912 . 7 729 Primary Pumps ATPases(2) AT2G21410 75.3 0.0e+00 1090.1
Sed01g0902 . 9 819 Primary Pumps ATPases(2) AT2G21410 61.4 3.9e-296 1015.0
Sed05g2892 . 9 818 Primary Pumps ATPases(2) AT2G21410 61.4 3.1e-293 1005.4
Sed01g0903 . 9 851 Primary Pumps ATPases(2) AT2G21410 59.1 3.8e-291 998.4
Sed04g3911 . 8 817 Primary Pumps ATPases(2) AT4G39080 76.0 0.0e+00 1216.4
Sed05g2301 . 1 818 Primary Pumps ATPases(2) AT4G39080 74.7 0.0e+00 1208.4
Sed03g1719 . 1 803 Primary Pumps ATPases(2) AT4G39080 73.5 0.0e+00 1189.9
Sed04g3912 . 8 729 Primary Pumps ATPases(2) AT4G39080 76.0 0.0e+00 1086.2
Sed01g0902 . 9 818 Primary Pumps ATPases(2) AT4G39080 63.1 8.7e-296 1013.8
Sed05g2892 . 9 818 Primary Pumps ATPases(2) AT4G39080 62.7 4.0e-293 1005.0
Sed01g0903 . 9 850 Primary Pumps ATPases(2) AT4G39080 60.7 8.4e-291 997.3
Sed03g1704 . 28 165 Primary Pumps ATPases(2) AT4G34720 98.6 1.1e-60 230.3
Sed03g1705 . 28 165 Primary Pumps ATPases(2) AT4G34720 98.6 1.1e-60 230.3
Sed04g0491 . 29 166 Primary Pumps ATPases(2) AT4G34720 98.6 1.1e-60 230.3
Sed11g1074 . 28 165 Primary Pumps ATPases(2) AT4G34720 98.6 1.1e-60 230.3
Sed11g1075 . 28 165 Primary Pumps ATPases(2) AT4G34720 98.6 1.1e-60 230.3
Sed03g1706 . 28 164 Primary Pumps ATPases(2) AT4G34720 87.6 2.5e-57 219.2
Sed11g1074 . 1 122 Primary Pumps ATPases(2) AT1G19910 96.7 1.6e-52 203.0
Sed03g1704 . 1 122 Primary Pumps ATPases(2) AT1G19910 96.7 2.7e-52 202.2
Sed11g1075 . 1 122 Primary Pumps ATPases(2) AT1G19910 96.7 2.7e-52 202.2
Sed03g1705 . 1 122 Primary Pumps ATPases(2) AT1G19910 95.9 7.9e-52 200.7
Sed04g0491 . 4 123 Primary Pumps ATPases(2) AT1G19910 97.5 1.3e-51 199.9
Sed03g1706 . 1 122 Primary Pumps ATPases(2) AT1G19910 85.2 5.7e-50 194.5
Sed03g1704 . 28 165 Primary Pumps ATPases(2) AT4G38920 98.6 3.1e-60 228.8
Sed03g1705 . 28 165 Primary Pumps ATPases(2) AT4G38920 98.6 3.1e-60 228.8
Sed04g0491 . 29 166 Primary Pumps ATPases(2) AT4G38920 98.6 3.1e-60 228.8
Sed11g1074 . 28 165 Primary Pumps ATPases(2) AT4G38920 98.6 3.1e-60 228.8
Sed11g1075 . 28 165 Primary Pumps ATPases(2) AT4G38920 98.6 3.1e-60 228.8
Sed03g1706 . 28 164 Primary Pumps ATPases(2) AT4G38920 87.6 7.1e-57 217.6
Sed04g0491 . 1 166 Primary Pumps ATPases(2) AT1G75630 80.5 9.8e-68 254.2
Sed03g1704 . 2 165 Primary Pumps ATPases(2) AT1G75630 80.3 6.4e-67 251.5
Sed11g1075 . 2 165 Primary Pumps ATPases(2) AT1G75630 80.3 6.4e-67 251.5
Sed03g1705 . 2 165 Primary Pumps ATPases(2) AT1G75630 79.8 2.4e-66 249.6
Sed11g1074 . 2 165 Primary Pumps ATPases(2) AT1G75630 79.8 2.4e-66 249.6
Sed03g1706 . 2 164 Primary Pumps ATPases(2) AT1G75630 71.1 2.8e-62 236.1
Sed11g1074 . 3 165 Primary Pumps ATPases(2) AT2G16510 98.2 7.6e-74 274.2
Sed03g1704 . 3 165 Primary Pumps ATPases(2) AT2G16510 98.2 1.3e-73 273.5
Sed11g1075 . 3 165 Primary Pumps ATPases(2) AT2G16510 98.2 1.3e-73 273.5
Sed04g0491 . 4 166 Primary Pumps ATPases(2) AT2G16510 98.2 1.7e-73 273.1
Sed03g1705 . 1 165 Primary Pumps ATPases(2) AT2G16510 98.2 2.2e-73 272.7
Sed03g1706 . 3 164 Primary Pumps ATPases(2) AT2G16510 88.3 3.9e-70 261.9
Sed13g2038 . 1 180 Primary Pumps ATPases(2) AT4G32530 76.2 2.7e-76 282.7
Sed01g1346 . 1 180 Primary Pumps ATPases(2) AT4G32530 75.2 6.0e-76 281.6
Sed03g1580 . 1 180 Primary Pumps ATPases(2) AT4G32530 72.9 1.5e-71 266.9
Sed01g1346 . 6 180 Primary Pumps ATPases(2) AT2G25610 82.9 1.7e-71 266.9
Sed13g2038 . 1 180 Primary Pumps ATPases(2) AT2G25610 82.8 3.7e-71 265.8
Sed03g1580 . 4 180 Primary Pumps ATPases(2) AT2G25610 84.2 6.3e-71 265.0
Sed08g1348 . 1 351 Primary Pumps ATPases(2) AT3G28710 93.7 4.7e-198 688.0
Sed06g0609 . 1 351 Primary Pumps ATPases(2) AT3G28710 93.4 5.2e-197 684.5
Sed08g1348 . 1 351 Primary Pumps ATPases(2) AT3G28715 91.5 5.4e-191 664.5
Sed06g0609 . 1 351 Primary Pumps ATPases(2) AT3G28715 91.2 6.0e-190 661.0
Sed01g1059 . 1 1065 Primary Pumps ATPases(2) AT1G07810 81.0 0.0e+00 1681.4
Sed13g1363 . 1 1066 Primary Pumps ATPases(2) AT1G07810 80.9 0.0e+00 1673.7
Sed01g1060 . 1 796 Primary Pumps ATPases(2) AT1G07810 78.7 0.0e+00 1211.8
Sed13g1363 . 22 1047 Primary Pumps ATPases(2) AT4G00900 66.3 0.0e+00 1328.9
Sed01g1059 . 22 1046 Primary Pumps ATPases(2) AT4G00900 66.4 0.0e+00 1328.2
Sed01g1060 . 22 796 Primary Pumps ATPases(2) AT4G00900 64.1 2.5e-279 959.5
Sed10g1165 . 1 996 Primary Pumps ATPases(2) AT1G10130 83.5 0.0e+00 1623.2
Sed01g1059 . 1 1065 Primary Pumps ATPases(2) AT1G07670 80.8 0.0e+00 1681.8
Sed13g1363 . 1 1066 Primary Pumps ATPases(2) AT1G07670 80.8 0.0e+00 1676.8
Sed01g1060 . 1 796 Primary Pumps ATPases(2) AT1G07670 78.4 0.0e+00 1212.6
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0006487 2 1 2 1 2 1 2 1 1 1 1 1 1 1 1 2 1 2 2 1 1 0 1 1 1 1 1 1 1 2 37