Cucurbitales platform

Gene search

Sequence information

Select	Gene	Cds	Cds_length	GC_content	Pep	Pep_length
	Sed11g0951	ATGGCGGTTTCACTTTCATCAGTCACTGCCAGAGCCACATCCTTCCATCTCCACCCCTCTTTCCCATCTTCATCCTTCATTTCCAACACCTTTCACATTCCCTCAAAACACTCCTTTCGCTCAACCTCAATAATAGCTCAAGCCCAATCTCCGCCTCGCCAAACATGGCTCCCGGGCCTCGACCCGCCGCCTCATCTCGACGGGACCCTCGCCGGAGATTTCGGGTTCGACCCACTTGGGCTCGGCCAAGACCCGCCCAGCTTGAAGTGGTTCGTCCAAGCCGAGCTCGTCCATTGTCGCTTCGCCATGCTCGGCGTCTCGGGAATTCTTCTCACCGATTTGCTTCGTGTGACAGGAATCAGTGAATTGCCTGTTTGGTACAATGCGGGTGCTGTGGAATATGGCTTCACCAACAAACAAACGCTCTTCATTGTTCAGCTGCTCTTGATGGGGTTTGTGGAAACCAAAAGGTATATGGATTTCAAAAGCCCTGGATCTCAAGCACAATCAGGAACTTTCTTTGGATTGGAATCTGCTTTCGAAGGTCTCGAACCCGGGTACCCTGGAGGTCCCCTGCTGAATCCTCTTGGCCTGGCTAAAGATATCAAGAATGCCCATCAATGGAAGCTCAAGGAGATTAAGAATGGACGCCTTGCGATGGTAGCCATGCTTGGGATCTTTGTGCAAGCCTATGTGACTCAAACAGGGCCAATAGATAACCTCTTGGAACACCTTTCTAATCCATGGCACAAGACTATTATCCAGACCCTCTCAAGCTCAAGTCCTTGA	789	51.08	MAVSLSSVTARATSFHLHPSFPSSSFISNTFHIPSKHSFRSTSIIAQAQSPPRQTWLPGLDPPPHLDGTLAGDFGFDPLGLGQDPPSLKWFVQAELVHCRFAMLGVSGILLTDLLRVTGISELPVWYNAGAVEYGFTNKQTLFIVQLLLMGFVETKRYMDFKSPGSQAQSGTFFGLESAFEGLEPGYPGGPLLNPLGLAKDIKNAHQWKLKEIKNGRLAMVAMLGIFVQAYVTQTGPIDNLLEHLSNPWHKTIIQTLSSSSP	262

Gff information

Chromosome	Start	End	Strand	Old_gene	Gene	Num
11	23937939	23939513	+	Sed0028014.1	Sed11g0951	729597

Annotation

Seq ID	Length	Analysis	Description	Start	End	IPR	GO
Sed11g0951	262	PANTHER	CHLOROPHYLL A/B BINDING PROTEIN	4	253	IPR001344	GO:0009416(PANTHER)\|GO:0009765(InterPro)\|GO:0009768(PANTHER)\|GO:0016020(InterPro)
Sed11g0951	262	FunFam	Chlorophyll a-b binding protein, chloroplastic	54	261	-	-
Sed11g0951	262	Pfam	Chlorophyll A-B binding protein	62	230	IPR022796	-
Sed11g0951	262	Gene3D	Chlorophyll a/b binding protein domain	54	261	-	-
Sed11g0951	262	SUPERFAMILY	Chlorophyll a-b binding protein	51	259	-	-

Pathway

Select	Query	KO	Definition	Second KO	KEGG Genes ID	GHOSTX Score
	Sed11g0951	K08911	-	-	csv:101219846	396.741

Dupl-types

Gene1	Location1	Gene2	Location2	E-value	Duplicated-type
Sed08g1153	Sed-Chr8:22676092	Sed11g0951	Sed-Chr11:23937939	7.80E-44	dispersed
Sed08g1156	Sed-Chr8:22736962	Sed11g0951	Sed-Chr11:23937939	7.80E-44	dispersed
Sed11g0951	Sed-Chr11:23937939	Sed12g1956	Sed-Chr12:30606377	2.00E-52	dispersed
Sed11g0951	Sed-Chr11:23937939	Sed08g2078	Sed-Chr8:34963279	1.10E-53	transposed

Deco-Alignment

Select	Vvi1	Blo1	Blo2	Bda1	Bda2	Bpe1	Bpe2	Bma1	Bma2	Cmo1	Cmo2	Cma1	Cma2	Car1	Car2	Sed1	Cpe1	Cpe2	Bhi1	Tan1	Cmetu1	Lac1	Hepe1	Mch1	Lcy1	Cla1	Cam1	Cec1	Cco1	Clacu1	Cmu1	Cre1	Cone1	Cone2	Cone3	Cone4	Lsi1	Csa1	Chy1	Cme1	Blo3	Blo4	Bda3	Bda4	Bpe3	Bpe4	Bma3	Bma4	Sed2	Cmo3	Cmo4	Cma3	Cma4	Car3	Car4	Cpe3	Cpe4	Bhi2	Tan2	Cmetu2	Lac2	Hepe2	Mch2	Lcy2	Cla2	Cam2	Cec2	Cco2	Clacu2	Cmu2	Cre2	Lsi2	Csa2	Chy2	Cme2
	Vvi18g770	.	.	.	.	.	.	.	.	.	Cmo12g00495	.	.	.	Car12g00507	Sed11g0951	.	Cpe07g00484	Bhi04g00351	Tan02g1837	Cmetu03g1729	.	Hepe08g1279	.	Lcy13g2071	Cla08g01570	Cam08g2067	Cec08g1644	Cco08g1778	Clacu08g1753	.	Cre08g1539	Cone4ag1571	Cone7ag1381	.	.	.	.	.	Cme03g02045	Blo17g00857	.	.	.	.	.	.	.	.	.	.	Cma12g00551	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	Lsi08g01472	Csa02g01960	Chy03g01543	.

Syn-Families

Gene	Event_type	S_start	S_end	Function	Ath_gene	Identity(%)	E-value	Score
Sed13g1378	.	1	441	Chloroplast and Mitochondria Gene Families	AT2G28800	61.8	1.2e-134	477.6
Sed04g0012	.	71	408	Chloroplast and Mitochondria Gene Families	AT2G28800	56.1	6.8e-98	355.5
Sed04g0013	.	1	295	Chloroplast and Mitochondria Gene Families	AT2G28800	57.3	1.4e-87	321.2
Sed10g1833	.	3	256	Chloroplast and Mitochondria Gene Families	AT1G15820	79.2	8.7e-117	417.5
Sed10g1832	.	3	256	Chloroplast and Mitochondria Gene Families	AT1G15820	79.2	1.9e-116	416.4
Sed05g2091	.	1	265	Chloroplast and Mitochondria Gene Families	AT3G27690	89.1	6.2e-143	504.6
Sed04g3726	.	1	264	Chloroplast and Mitochondria Gene Families	AT3G27690	87.2	4.9e-140	495.0
Sed10g0156	.	2	267	Chloroplast and Mitochondria Gene Families	AT3G27690	76.5	4.3e-120	428.7
Sed10g0157	.	2	266	Chloroplast and Mitochondria Gene Families	AT3G27690	76.8	7.4e-120	427.9
Sed10g0155	.	2	266	Chloroplast and Mitochondria Gene Families	AT3G27690	76.8	9.7e-120	427.6
Sed14g1562	.	2	268	Chloroplast and Mitochondria Gene Families	AT3G27690	76.1	1.6e-119	426.8
Sed14g1563	.	2	268	Chloroplast and Mitochondria Gene Families	AT3G27690	76.1	1.6e-119	426.8
Sed01g2226	.	2	265	Chloroplast and Mitochondria Gene Families	AT3G27690	76.7	1.4e-118	423.7
Sed05g1289	.	179	446	Chloroplast and Mitochondria Gene Families	AT3G27690	74.5	2.6e-117	419.5
Sed01g0736	.	2	262	Chloroplast and Mitochondria Gene Families	AT3G27690	76.4	5.0e-116	415.2
Sed06g1212	.	28	247	Chloroplast and Mitochondria Gene Families	AT3G27690	86.8	2.5e-115	412.9
Sed05g1288	.	19	244	Chloroplast and Mitochondria Gene Families	AT3G27690	77.3	9.4e-107	384.4
Sed13g1162	.	5	264	Chloroplast and Mitochondria Gene Families	AT3G27690	67.0	4.0e-97	352.4
Sed10g1659	.	110	313	Chloroplast and Mitochondria Gene Families	AT3G27690	53.1	1.0e-52	204.9
Sed06g0152	.	3	267	Chloroplast and Mitochondria Gene Families	AT3G61470	80.5	4.9e-128	454.9
Sed06g1754	.	3	267	Chloroplast and Mitochondria Gene Families	AT3G61470	80.1	8.3e-128	454.1
Sed12g1695	.	69	274	Chloroplast and Mitochondria Gene Families	AT3G61470	64.1	4.8e-83	305.4
Sed08g2078	.	22	245	Chloroplast and Mitochondria Gene Families	AT3G61470	50.6	2.3e-61	233.4
Sed11g0951	.	43	253	Chloroplast and Mitochondria Gene Families	AT3G61470	50.5	1.6e-54	210.7
Sed01g2838	.	1	200	Chloroplast and Mitochondria Gene Families	AT3G54890	79.5	2.0e-87	319.7
Sed14g0644	.	6	288	Chloroplast and Mitochondria Gene Families	AT3G08940	79.2	1.9e-128	456.4
Sed14g0643	.	6	307	Chloroplast and Mitochondria Gene Families	AT3G08940	73.8	2.8e-124	442.6
Sed01g2387	.	1	330	Chloroplast and Mitochondria Gene Families	AT1G76570	72.8	1.9e-140	496.5
Sed08g1153	.	1	269	Chloroplast and Mitochondria Gene Families	AT1G61520	84.6	7.0e-133	471.1
Sed08g1156	.	1	269	Chloroplast and Mitochondria Gene Families	AT1G61520	84.6	7.0e-133	471.1
Sed05g2091	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G05070	89.4	8.5e-144	507.3
Sed04g3726	.	1	264	Chloroplast and Mitochondria Gene Families	AT2G05070	87.9	4.4e-140	495.0
Sed10g0156	.	5	267	Chloroplast and Mitochondria Gene Families	AT2G05070	78.4	8.6e-120	427.6
Sed01g2226	.	5	265	Chloroplast and Mitochondria Gene Families	AT2G05070	78.9	8.6e-120	427.6
Sed10g0157	.	5	266	Chloroplast and Mitochondria Gene Families	AT2G05070	78.7	1.5e-119	426.8
Sed10g0155	.	5	266	Chloroplast and Mitochondria Gene Families	AT2G05070	78.7	1.9e-119	426.4
Sed14g1562	.	5	268	Chloroplast and Mitochondria Gene Families	AT2G05070	77.3	5.6e-119	424.9
Sed14g1563	.	5	268	Chloroplast and Mitochondria Gene Families	AT2G05070	77.3	5.6e-119	424.9
Sed05g1289	.	189	446	Chloroplast and Mitochondria Gene Families	AT2G05070	79.2	4.7e-118	421.8
Sed06g1212	.	28	247	Chloroplast and Mitochondria Gene Families	AT2G05070	87.7	9.8e-116	414.1
Sed01g0736	.	7	262	Chloroplast and Mitochondria Gene Families	AT2G05070	77.5	8.3e-115	411.0
Sed05g1288	.	22	244	Chloroplast and Mitochondria Gene Families	AT2G05070	79.1	3.7e-107	385.6
Sed13g1162	.	8	264	Chloroplast and Mitochondria Gene Families	AT2G05070	67.7	3.5e-97	352.4
Sed10g1659	.	110	313	Chloroplast and Mitochondria Gene Families	AT2G05070	53.6	6.9e-53	205.3
Sed05g2091	.	1	237	Chloroplast and Mitochondria Gene Families	AT2G05100	89.5	4.8e-125	445.3
Sed04g3726	.	1	236	Chloroplast and Mitochondria Gene Families	AT2G05100	87.8	2.4e-121	433.0
Sed14g1562	.	5	240	Chloroplast and Mitochondria Gene Families	AT2G05100	76.7	6.3e-101	365.2
Sed14g1563	.	5	240	Chloroplast and Mitochondria Gene Families	AT2G05100	76.7	6.3e-101	365.2
Sed10g0156	.	5	239	Chloroplast and Mitochondria Gene Families	AT2G05100	75.8	8.2e-101	364.8
Sed01g2226	.	5	237	Chloroplast and Mitochondria Gene Families	AT2G05100	77.0	8.2e-101	364.8
Sed10g0157	.	5	238	Chloroplast and Mitochondria Gene Families	AT2G05100	76.2	1.4e-100	364.0
Sed10g0155	.	5	238	Chloroplast and Mitochondria Gene Families	AT2G05100	76.2	1.8e-100	363.6
Sed01g0736	.	7	238	Chloroplast and Mitochondria Gene Families	AT2G05100	76.5	2.0e-99	360.1
Sed05g1289	.	208	418	Chloroplast and Mitochondria Gene Families	AT2G05100	82.0	2.6e-99	359.8
Sed06g1212	.	28	219	Chloroplast and Mitochondria Gene Families	AT2G05100	86.5	3.2e-97	352.8
Sed05g1288	.	18	216	Chloroplast and Mitochondria Gene Families	AT2G05100	75.4	9.4e-89	324.7
Sed13g1162	.	8	236	Chloroplast and Mitochondria Gene Families	AT2G05100	67.6	2.9e-82	303.1
Sed10g1659	.	110	297	Chloroplast and Mitochondria Gene Families	AT2G05100	52.3	2.4e-44	177.2
Sed14g0644	.	1	171	Chloroplast and Mitochondria Gene Families	AT2G40100	68.2	2.0e-62	236.5
Sed14g0643	.	1	190	Chloroplast and Mitochondria Gene Families	AT2G40100	61.5	7.7e-59	224.6
Sed14g1562	.	1	268	Chloroplast and Mitochondria Gene Families	AT1G29930	88.1	2.5e-135	479.2
Sed14g1563	.	1	268	Chloroplast and Mitochondria Gene Families	AT1G29930	88.1	2.5e-135	479.2
Sed10g0157	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29930	87.6	3.3e-135	478.8
Sed10g0155	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29930	87.3	4.3e-135	478.4
Sed01g2226	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29930	87.6	4.7e-134	474.9
Sed10g0156	.	1	267	Chloroplast and Mitochondria Gene Families	AT1G29930	87.3	8.1e-134	474.2
Sed01g0736	.	1	262	Chloroplast and Mitochondria Gene Families	AT1G29930	88.6	3.4e-132	468.8
Sed05g1289	.	182	446	Chloroplast and Mitochondria Gene Families	AT1G29930	83.3	6.2e-126	448.0
Sed06g1212	.	4	247	Chloroplast and Mitochondria Gene Families	AT1G29930	82.4	3.9e-120	428.7
Sed04g3726	.	3	264	Chloroplast and Mitochondria Gene Families	AT1G29930	78.9	7.6e-116	414.5
Sed05g2091	.	30	265	Chloroplast and Mitochondria Gene Families	AT1G29930	82.9	4.9e-115	411.8
Sed05g1288	.	21	244	Chloroplast and Mitochondria Gene Families	AT1G29930	84.0	4.2e-114	408.7
Sed13g1162	.	22	264	Chloroplast and Mitochondria Gene Families	AT1G29930	69.7	1.1e-93	340.9
Sed14g1562	.	1	268	Chloroplast and Mitochondria Gene Families	AT1G29920	87.7	9.5e-135	477.2
Sed14g1563	.	1	268	Chloroplast and Mitochondria Gene Families	AT1G29920	87.7	9.5e-135	477.2
Sed10g0157	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29920	87.3	1.2e-134	476.9
Sed10g0155	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29920	86.9	1.6e-134	476.5
Sed01g2226	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29920	87.3	1.8e-133	473.0
Sed10g0156	.	1	267	Chloroplast and Mitochondria Gene Families	AT1G29920	86.9	3.1e-133	472.2
Sed01g0736	.	1	262	Chloroplast and Mitochondria Gene Families	AT1G29920	88.3	1.3e-131	466.8
Sed05g1289	.	182	446	Chloroplast and Mitochondria Gene Families	AT1G29920	83.3	8.1e-126	447.6
Sed06g1212	.	4	247	Chloroplast and Mitochondria Gene Families	AT1G29920	82.4	5.1e-120	428.3
Sed04g3726	.	32	264	Chloroplast and Mitochondria Gene Families	AT1G29920	84.8	9.9e-116	414.1
Sed05g2091	.	30	265	Chloroplast and Mitochondria Gene Families	AT1G29920	82.9	4.9e-115	411.8
Sed05g1288	.	21	244	Chloroplast and Mitochondria Gene Families	AT1G29920	84.0	4.2e-114	408.7
Sed13g1162	.	22	264	Chloroplast and Mitochondria Gene Families	AT1G29920	69.7	1.1e-93	340.9
Sed14g1562	.	1	268	Chloroplast and Mitochondria Gene Families	AT1G29910	87.7	9.5e-135	477.2
Sed14g1563	.	1	268	Chloroplast and Mitochondria Gene Families	AT1G29910	87.7	9.5e-135	477.2
Sed10g0157	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29910	87.3	1.2e-134	476.9
Sed10g0155	.	1	266	Chloroplast and Mitochondria Gene Families	AT1G29910	86.9	1.6e-134	476.5
Sed01g2226	.	1	265	Chloroplast and Mitochondria Gene Families	AT1G29910	87.3	1.8e-133	473.0
Sed10g0156	.	1	267	Chloroplast and Mitochondria Gene Families	AT1G29910	86.9	3.1e-133	472.2
Sed01g0736	.	1	262	Chloroplast and Mitochondria Gene Families	AT1G29910	88.3	1.3e-131	466.8
Sed05g1289	.	182	446	Chloroplast and Mitochondria Gene Families	AT1G29910	83.3	8.1e-126	447.6
Sed06g1212	.	4	247	Chloroplast and Mitochondria Gene Families	AT1G29910	82.4	5.1e-120	428.3
Sed04g3726	.	32	264	Chloroplast and Mitochondria Gene Families	AT1G29910	84.8	9.9e-116	414.1
Sed05g2091	.	30	265	Chloroplast and Mitochondria Gene Families	AT1G29910	82.9	4.9e-115	411.8
Sed05g1288	.	21	244	Chloroplast and Mitochondria Gene Families	AT1G29910	84.0	4.2e-114	408.7
Sed13g1162	.	22	264	Chloroplast and Mitochondria Gene Families	AT1G29910	69.7	1.1e-93	340.9
Sed10g1659	.	50	328	Chloroplast and Mitochondria Gene Families	AT4G10340	84.6	1.7e-134	476.5
Sed14g1562	.	41	256	Chloroplast and Mitochondria Gene Families	AT4G10340	51.5	3.8e-57	219.5
Sed14g1563	.	41	256	Chloroplast and Mitochondria Gene Families	AT4G10340	51.5	3.8e-57	219.5
Sed10g0155	.	50	254	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	4.9e-57	219.2
Sed10g0156	.	51	255	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	4.9e-57	219.2
Sed10g0157	.	50	254	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	4.9e-57	219.2
Sed01g0736	.	50	254	Chloroplast and Mitochondria Gene Families	AT4G10340	54.1	4.9e-57	219.2
Sed01g2226	.	40	253	Chloroplast and Mitochondria Gene Families	AT4G10340	53.2	1.9e-56	217.2
Sed05g1289	.	230	434	Chloroplast and Mitochondria Gene Families	AT4G10340	53.1	3.2e-56	216.5
Sed06g1212	.	31	235	Chloroplast and Mitochondria Gene Families	AT4G10340	53.1	4.2e-56	216.1
Sed05g2091	.	49	253	Chloroplast and Mitochondria Gene Families	AT4G10340	52.6	1.3e-54	211.1
Sed04g3726	.	48	252	Chloroplast and Mitochondria Gene Families	AT4G10340	51.7	5.6e-53	205.7
Sed13g1162	.	46	252	Chloroplast and Mitochondria Gene Families	AT4G10340	53.1	4.0e-51	199.5
Sed14g1562	.	1	268	Chloroplast and Mitochondria Gene Families	AT2G34420	87.0	1.5e-132	469.9
Sed14g1563	.	1	268	Chloroplast and Mitochondria Gene Families	AT2G34420	87.0	1.5e-132	469.9
Sed10g0157	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34420	86.5	2.0e-132	469.5
Sed10g0155	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34420	86.1	2.6e-132	469.2
Sed01g2226	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34420	86.5	2.2e-131	466.1
Sed10g0156	.	1	267	Chloroplast and Mitochondria Gene Families	AT2G34420	86.2	4.9e-131	464.9
Sed01g0736	.	1	262	Chloroplast and Mitochondria Gene Families	AT2G34420	88.3	3.2e-130	462.2
Sed05g1289	.	188	446	Chloroplast and Mitochondria Gene Families	AT2G34420	84.7	3.1e-125	445.7
Sed06g1212	.	29	247	Chloroplast and Mitochondria Gene Families	AT2G34420	92.7	3.5e-121	432.2
Sed04g3726	.	32	264	Chloroplast and Mitochondria Gene Families	AT2G34420	84.4	2.2e-115	412.9
Sed05g2091	.	3	265	Chloroplast and Mitochondria Gene Families	AT2G34420	77.5	2.2e-115	412.9
Sed05g1288	.	21	244	Chloroplast and Mitochondria Gene Families	AT2G34420	84.0	5.4e-114	408.3
Sed13g1162	.	22	264	Chloroplast and Mitochondria Gene Families	AT2G34420	70.1	1.1e-93	340.9
Sed10g1659	.	110	313	Chloroplast and Mitochondria Gene Families	AT2G34420	52.4	1.8e-53	207.2
Sed01g2226	.	1	265	Chloroplast and Mitochondria Gene Families	AT2G34430	87.2	1.2e-134	476.9
Sed14g1562	.	1	268	Chloroplast and Mitochondria Gene Families	AT2G34430	88.1	6.2e-134	474.6
Sed14g1563	.	1	268	Chloroplast and Mitochondria Gene Families	AT2G34430	88.1	6.2e-134	474.6
Sed10g0157	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34430	87.6	8.0e-134	474.2
Sed10g0155	.	1	266	Chloroplast and Mitochondria Gene Families	AT2G34430	87.3	1.1e-133	473.8
Sed10g0156	.	1	267	Chloroplast and Mitochondria Gene Families	AT2G34430	86.9	2.3e-133	472.6
Sed01g0736	.	1	262	Chloroplast and Mitochondria Gene Families	AT2G34430	87.9	5.4e-130	461.5
Sed05g1289	.	182	446	Chloroplast and Mitochondria Gene Families	AT2G34430	83.3	5.6e-127	451.4
Sed06g1212	.	29	247	Chloroplast and Mitochondria Gene Families	AT2G34430	92.7	4.6e-121	431.8
Sed05g1288	.	22	244	Chloroplast and Mitochondria Gene Families	AT2G34430	84.3	2.9e-115	412.5
Sed04g3726	.	32	264	Chloroplast and Mitochondria Gene Families	AT2G34430	84.3	1.9e-114	409.8
Sed05g2091	.	31	265	Chloroplast and Mitochondria Gene Families	AT2G34430	82.8	2.1e-113	406.4
Sed13g1162	.	34	264	Chloroplast and Mitochondria Gene Families	AT2G34430	70.5	1.1e-93	340.9
Sed14g0644	.	3	288	Chloroplast and Mitochondria Gene Families	AT5G01530	81.1	5.7e-133	471.5
Sed14g0643	.	3	307	Chloroplast and Mitochondria Gene Families	AT5G01530	76.1	1.0e-129	460.7
Sed07g1803	.	48	307	Chloroplast and Mitochondria Gene Families	AT5G40810	94.2	4.9e-144	508.1
Sed13g1065	.	48	307	Chloroplast and Mitochondria Gene Families	AT5G40810	93.8	1.4e-143	506.5
Sed13g1067	.	48	307	Chloroplast and Mitochondria Gene Families	AT5G40810	93.8	1.4e-143	506.5
Sed13g1066	.	48	307	Chloroplast and Mitochondria Gene Families	AT5G40810	93.8	1.4e-143	506.5
Sed07g1803	.	1	307	Chloroplast and Mitochondria Gene Families	AT3G27240	85.8	2.1e-149	526.2
Sed13g1065	.	1	307	Chloroplast and Mitochondria Gene Families	AT3G27240	84.2	6.6e-148	521.2
Sed13g1067	.	1	307	Chloroplast and Mitochondria Gene Families	AT3G27240	84.2	6.6e-148	521.2
Sed13g1066	.	1	307	Chloroplast and Mitochondria Gene Families	AT3G27240	84.2	6.6e-148	521.2
Sed05g3793	.	5	323	Chloroplast and Mitochondria Gene Families	AT2G30160	74.4	1.5e-137	486.9
Sed03g2513	.	81	360	Chloroplast and Mitochondria Gene Families	AT2G30160	63.3	2.2e-101	366.7
Sed05g3793	.	5	329	Chloroplast and Mitochondria Gene Families	AT1G07030	75.0	2.4e-140	496.1
Sed03g2513	.	60	360	Chloroplast and Mitochondria Gene Families	AT1G07030	61.0	1.9e-105	380.2
Sed07g0557	.	1	301	Chloroplast and Mitochondria Gene Families	AT2G47490	76.4	1.5e-131	466.8
Sed03g1162	.	11	313	Chloroplast and Mitochondria Gene Families	AT2G47490	61.4	1.1e-105	380.9
Sed07g0813	.	1	297	Chloroplast and Mitochondria Gene Families	AT2G47490	62.8	6.0e-96	348.6
Sed03g1162	.	10	362	Chloroplast and Mitochondria Gene Families	AT1G25380	63.8	1.3e-121	434.1
Sed07g0557	.	12	293	Chloroplast and Mitochondria Gene Families	AT1G25380	65.3	4.3e-106	382.5
Sed07g0813	.	12	289	Chloroplast and Mitochondria Gene Families	AT1G25380	53.5	7.5e-74	275.4
Sed01g2055	.	7	584	Chloroplast and Mitochondria Gene Families	AT4G21490	75.0	3.3e-257	885.2
Sed01g2056	.	7	584	Chloroplast and Mitochondria Gene Families	AT4G21490	75.0	3.3e-257	885.2
Sed08g2309	.	7	573	Chloroplast and Mitochondria Gene Families	AT4G21490	73.0	4.3e-249	858.2
Sed05g3116	.	5	584	Chloroplast and Mitochondria Gene Families	AT4G21490	69.6	4.0e-239	825.1
Sed05g1975	.	4	574	Chloroplast and Mitochondria Gene Families	AT4G21490	65.2	1.8e-226	783.1
Sed09g1672	.	3	182	Chloroplast and Mitochondria Gene Families	AT1G17530	65.6	7.4e-62	234.6
Sed04g0795	.	5	186	Chloroplast and Mitochondria Gene Families	AT1G17530	63.8	2.6e-59	226.1
Sed06g0682	.	1	179	Chloroplast and Mitochondria Gene Families	AT1G17530	56.9	1.3e-50	197.2
Sed06g0682	.	1	183	Chloroplast and Mitochondria Gene Families	AT3G04800	56.5	4.6e-51	198.7
Sed04g0795	.	22	186	Chloroplast and Mitochondria Gene Families	AT3G04800	56.3	2.5e-41	166.4
Sed09g1672	.	18	184	Chloroplast and Mitochondria Gene Families	AT3G04800	54.4	7.4e-41	164.9
Sed09g1672	.	2	184	Chloroplast and Mitochondria Gene Families	AT1G72750	66.8	7.6e-62	234.6
Sed04g0795	.	15	186	Chloroplast and Mitochondria Gene Families	AT1G72750	67.2	2.1e-59	226.5
Sed06g0682	.	3	183	Chloroplast and Mitochondria Gene Families	AT1G72750	57.1	1.2e-51	200.7
Sed06g1856	.	4	217	Chloroplast and Mitochondria Gene Families	AT1G26100	58.9	4.4e-67	252.3
Sed06g1857	.	7	182	Chloroplast and Mitochondria Gene Families	AT1G26100	65.3	1.9e-65	246.9
Sed03g0307	.	1	226	Chloroplast and Mitochondria Gene Families	AT5G38630	69.2	8.9e-89	324.3
Sed11g2091	.	1	224	Chloroplast and Mitochondria Gene Families	AT5G38630	68.0	4.6e-85	312.0
Sed01g3590	.	23	218	Chloroplast and Mitochondria Gene Families	AT4G25570	69.9	9.2e-80	294.7
Sed03g0981	.	6	356	Chloroplast and Mitochondria Gene Families	AT5G14040	81.6	2.0e-170	596.3
Sed11g1566	.	7	356	Chloroplast and Mitochondria Gene Families	AT5G14040	82.4	1.7e-169	593.2
Sed08g1540	.	5	354	Chloroplast and Mitochondria Gene Families	AT5G14040	73.3	3.3e-149	525.8
Sed05g2146	.	11	298	Chloroplast and Mitochondria Gene Families	AT5G14040	52.4	2.0e-85	313.9
Sed05g2147	.	11	298	Chloroplast and Mitochondria Gene Families	AT5G14040	52.4	2.0e-85	313.9
Sed03g0982	.	15	283	Chloroplast and Mitochondria Gene Families	AT5G14040	52.6	8.0e-71	265.4
Sed11g1566	.	8	356	Chloroplast and Mitochondria Gene Families	AT3G48850	71.2	5.2e-144	508.4
Sed03g0981	.	8	356	Chloroplast and Mitochondria Gene Families	AT3G48850	69.2	2.4e-141	499.6
Sed08g1540	.	8	361	Chloroplast and Mitochondria Gene Families	AT3G48850	69.7	3.2e-141	499.2
Sed05g2146	.	11	297	Chloroplast and Mitochondria Gene Families	AT3G48850	51.5	1.1e-85	314.7
Sed05g2147	.	11	297	Chloroplast and Mitochondria Gene Families	AT3G48850	51.5	1.1e-85	314.7
Sed05g2146	.	14	307	Chloroplast and Mitochondria Gene Families	AT2G17270	75.5	6.7e-132	468.0
Sed05g2147	.	14	307	Chloroplast and Mitochondria Gene Families	AT2G17270	75.5	6.7e-132	468.0
Sed08g1540	.	57	352	Chloroplast and Mitochondria Gene Families	AT2G17270	52.4	8.6e-87	318.2
Sed11g1566	.	62	353	Chloroplast and Mitochondria Gene Families	AT2G17270	52.4	2.8e-85	313.2
Sed03g0981	.	56	347	Chloroplast and Mitochondria Gene Families	AT2G17270	52.1	3.6e-85	312.8
Sed11g2055	.	16	319	Chloroplast and Mitochondria Gene Families	AT5G15640	75.6	4.4e-131	465.3
Sed13g1891	.	12	346	Chloroplast and Mitochondria Gene Families	AT5G26200	67.5	3.3e-124	442.6
Sed09g1667	.	1	347	Chloroplast and Mitochondria Gene Families	AT5G26200	59.0	5.7e-108	388.7
Sed09g1667	.	1	352	Chloroplast and Mitochondria Gene Families	AT1G72820	74.4	7.0e-146	514.6
Sed13g1891	.	1	347	Chloroplast and Mitochondria Gene Families	AT1G72820	68.4	2.8e-126	449.5
Sed01g3857	.	79	284	Chloroplast and Mitochondria Gene Families	AT5G52570	51.0	8.3e-50	194.9
Sed13g0115	.	1	217	Chloroplast and Mitochondria Gene Families	AT4G25700	64.8	3.7e-71	265.8
Sed07g0989	.	1	225	Chloroplast and Mitochondria Gene Families	AT4G25700	60.9	1.0e-65	247.7
Sed07g0991	.	1	225	Chloroplast and Mitochondria Gene Families	AT4G25700	60.9	1.0e-65	247.7
Sed07g0988	.	1	221	Chloroplast and Mitochondria Gene Families	AT4G25700	61.1	8.7e-65	244.6
Sed07g0990	.	1	221	Chloroplast and Mitochondria Gene Families	AT4G25700	61.1	8.7e-65	244.6
Sed01g3857	.	40	200	Chloroplast and Mitochondria Gene Families	AT4G25700	60.9	6.9e-54	208.4
Sed07g1878	.	96	358	Chloroplast and Mitochondria Gene Families	AT5G54290	85.2	2.0e-119	426.8
Sed08g0534	.	65	552	Chloroplast and Mitochondria Gene Families	AT2G18710	85.2	1.8e-236	816.2

Syn-Orthogroups

Select	Orthogroup	Bda	Bhi	Blo	Bma	Bpe	Cam	Car	Cco	Cec	Chy	Cla	Clacu	Cma	Cme	Cmetu	Cmo	Cmu	Cone	Cpe	Cre	Csa	HCH	Hepe	Lac	Lcy	Lsi	Mch	Sed	Tan	Vvi	Total
	OG0012954	0	1	1	0	0	1	1	1	1	1	1	1	1	1	1	1	1	2	1	1	1	1	1	1	1	1	1	1	1	1	28