Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Tan01g2212 ATGAGCTTTCAAGATATCGAGGCTGGTCGCCCGTTTGCTTCTTCGAGGAGAGACCTCATCAATGGCAAACAGGATCCCACGCAAGCCGTTGCCTCGGGTATTTTTCAGATTAATACTGCCGTCGCTACGTTTCAGAGGCTTGTTAACACCTTAGGAACGCCGAAGGATACCCCCGAGCTACGCGAGAAGCTGCACAAGACCAGGTTACATATTGGACAGTTGGTTAAAGACACCTCTGCTAAACTTAAACAAGCAAGCGAAATAGATCATCATGCTGAAGTTAATGCGAGCAAGAAAATTGCAGATGCTAAACTTGCGAAAGATTTTCAAGCAGTGTTGAAAGAATTTCAGAAGGCTCAACGACTTGCAGCTGAGAGGGAAACGGCATATACACCTTTTGTTCCTCAGGCTGTTTTACCTTCTAGCTACACAGCCGGTGAGTCAGATGCAAGCTCAGAAAAGAATCTTGAACAGCGTGCCCTCCTTATGGAATCCAGGAGACAAGAGGTCTTGCTGTTGGACAATGAAATAGCATTCAATGAGGCAATAATTGAGGAAAGAGAACAAGGTATTCATGAAATCCAGCAGCAAATCGGAGAAGTGAATGAAATTTTTAAAGATCTCGCGGTTCTAGTCCACGAACAGGGAGCCATGATTGATGATATTGGATCGAACATAGAGAGTTCCCATGCTGCAACGTCACAGGGAACGGCTCAGCTTGTAAAAGCTTCAAAGACACAAAGATCAAATTCATCTCTGGCTTGCTTACTTTTGGTGATATTTGGTATTATCCTTCTCATTGTGATCATAATAGTTGTTGCTTAA 825 43.76 MSFQDIEAGRPFASSRRDLINGKQDPTQAVASGIFQINTAVATFQRLVNTLGTPKDTPELREKLHKTRLHIGQLVKDTSAKLKQASEIDHHAEVNASKKIADAKLAKDFQAVLKEFQKAQRLAAERETAYTPFVPQAVLPSSYTAGESDASSEKNLEQRALLMESRRQEVLLLDNEIAFNEAIIEEREQGIHEIQQQIGEVNEIFKDLAVLVHEQGAMIDDIGSNIESSHAATSQGTAQLVKASKTQRSNSSLACLLLVIFGIILLIVIIIVVA 274
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
1 26239413 26245652 - Tan0011779.1 Tan01g2212 739636

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Tan01g2212 274 ProSiteProfiles t-SNARE coiled-coil homology domain profile. 181 243 IPR000727 -
Tan01g2212 274 Gene3D - 175 274 - -
Tan01g2212 274 CDD SynN 24 158 IPR006011 GO:0016020(InterPro)
Tan01g2212 274 PANTHER SYNTAXIN 36 264 IPR045242 GO:0000149(PANTHER)|GO:0005484(PANTHER)|GO:0006886(PANTHER)|GO:0006906(PANTHER)|GO:0012505(PANTHER)|GO:0016021(PANTHER)|GO:0031201(PANTHER)|GO:0048278(PANTHER)
Tan01g2212 274 ProSitePatterns Syntaxin / epimorphin family signature. 187 226 IPR006012 GO:0005484(InterPro)|GO:0006886(InterPro)|GO:0016020(InterPro)
Tan01g2212 274 Gene3D - 21 134 - -
Tan01g2212 274 SMART SynN_4 16 128 IPR006011 GO:0016020(InterPro)
Tan01g2212 274 SUPERFAMILY t-snare proteins 24 236 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Tan01g2212 274 CDD SNARE_Qa 184 242 - -
Tan01g2212 274 Pfam SNARE domain 218 269 IPR000727 -
Tan01g2212 274 FunFam Syntaxin-22 like 21 134 - -
Tan01g2212 274 SMART tSNARE_6 176 243 IPR000727 -
Tan01g2212 274 Pfam Syntaxin-like protein 30 130 IPR006011 GO:0016020(InterPro)
Tan01g2212 274 FunFam Syntaxin-22 like 174 274 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Tan01g2212 - - - - 0.0
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi2g709 Blo02g00982 . Bda06g01261 Bda08g00639 Bpe05g00520 Bpe07g00233 . . Cmo06g00644 Cmo16g01226 . . . . Sed02g0067 Cpe14g00975 . Bhi11g00014 Tan01g2212 Cmetu06g0720 . . Mch10g1680 . Cla10g00138 Cam10g0137 Cec10g0147 Cco10g0147 Clacu10g0141 Cmu10g0988 Cre10g0399 Cone8ag0484 Cone12ag0481 . . Lsi07g01177 . . Cme06g02454 . . . . . . Bma05g00704 Bma12g00235 . . . Cma06g00638 Cma16g01176 Car06g00569 Car16g01109 . . . . . . . . . . . . . . . . . Csa03g00149 Chy06g02160 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Tan02g2666 . 8 337 SNARE and Associated Proteins AT3G24350 62.6 1.1e-102 370.9
Tan03g0640 . 1 308 SNARE and Associated Proteins AT1G08560 71.2 3.4e-105 379.0
Tan03g1990 . 375 673 SNARE and Associated Proteins AT2G18260 56.5 3.1e-87 319.3
Tan08g1616 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 2.2e-115 412.9
Tan03g1265 . 21 280 SNARE and Associated Proteins AT3G11820 70.4 3.7e-99 359.0
Tan05g3221 . 26 281 SNARE and Associated Proteins AT3G11820 65.6 3.0e-93 339.3
Tan10g1572 . 27 285 SNARE and Associated Proteins AT3G11820 52.1 1.7e-67 253.8
Tan08g1616 . 1 279 SNARE and Associated Proteins AT3G52400 63.9 1.4e-91 334.0
Tan03g1265 . 1 275 SNARE and Associated Proteins AT3G52400 59.8 2.1e-84 310.1
Tan05g3221 . 1 281 SNARE and Associated Proteins AT3G52400 56.5 6.4e-81 298.5
Tan05g3221 . 1 299 SNARE and Associated Proteins AT4G03330 69.9 2.5e-108 389.4
Tan08g1616 . 1 280 SNARE and Associated Proteins AT4G03330 58.0 2.7e-83 306.2
Tan03g1265 . 1 278 SNARE and Associated Proteins AT4G03330 52.3 6.8e-74 275.0
Tan10g1572 . 1 285 SNARE and Associated Proteins AT4G03330 51.2 9.5e-68 254.6
Tan05g3221 . 1 303 SNARE and Associated Proteins AT1G61290 78.5 5.3e-127 451.4
Tan08g1616 . 1 280 SNARE and Associated Proteins AT1G61290 62.4 4.6e-91 332.0
Tan03g1265 . 1 275 SNARE and Associated Proteins AT1G61290 56.4 6.3e-80 295.0
Tan05g3221 . 1 303 SNARE and Associated Proteins AT1G11250 77.9 1.1e-124 443.7
Tan08g1616 . 1 280 SNARE and Associated Proteins AT1G11250 62.9 1.7e-93 340.1
Tan03g1265 . 1 275 SNARE and Associated Proteins AT1G11250 56.7 1.7e-82 303.5
Tan10g1572 . 1 308 SNARE and Associated Proteins AT3G03800 73.1 3.9e-114 408.7
Tan05g0864 . 78 348 SNARE and Associated Proteins AT3G03800 58.3 2.3e-82 303.1
Tan10g1572 . 1 203 SNARE and Associated Proteins AT5G08080 76.4 1.9e-78 289.7
Tan05g0864 . 47 247 SNARE and Associated Proteins AT5G08080 59.7 6.3e-53 204.9
Tan01g2212 . 1 256 SNARE and Associated Proteins AT5G16830 59.9 6.6e-76 281.6
Tan01g2212 . 1 256 SNARE and Associated Proteins AT5G46860 66.8 6.6e-81 298.1
Tan01g2212 . 1 256 SNARE and Associated Proteins AT4G17730 61.3 1.3e-73 273.9
Tan01g2212 . 65 256 SNARE and Associated Proteins AT1G32270 60.9 1.3e-52 204.5
Tan04g0181 . 1 334 SNARE and Associated Proteins AT5G05760 65.7 1.4e-112 403.7
Tan02g2666 . 8 337 SNARE and Associated Proteins AT3G24350 62.6 1.1e-102 370.9
Tan06g0761 . 1 319 SNARE and Associated Proteins AT5G26980 66.8 1.9e-103 373.2
Tan06g0762 . 1 328 SNARE and Associated Proteins AT5G26980 65.0 1.6e-102 370.2
Tan08g0631 . 1 228 SNARE and Associated Proteins AT5G26980 78.1 2.1e-86 316.6
Tan08g0630 . 1 228 SNARE and Associated Proteins AT5G26980 78.1 2.1e-86 316.6
Tan08g0633 . 1 258 SNARE and Associated Proteins AT5G26980 69.0 1.2e-81 300.8
Tan08g0632 . 1 270 SNARE and Associated Proteins AT5G26980 65.9 3.0e-80 296.2
Tan08g0634 . 1 300 SNARE and Associated Proteins AT5G26980 59.3 1.7e-75 280.4
Tan06g0761 . 1 319 SNARE and Associated Proteins AT4G02195 67.2 1.6e-105 380.2
Tan06g0762 . 1 328 SNARE and Associated Proteins AT4G02195 65.4 3.3e-103 372.5
Tan08g0631 . 1 230 SNARE and Associated Proteins AT4G02195 68.0 9.1e-77 284.6
Tan08g0630 . 1 230 SNARE and Associated Proteins AT4G02195 68.0 9.1e-77 284.6
Tan08g0633 . 1 260 SNARE and Associated Proteins AT4G02195 60.2 5.1e-72 268.9
Tan08g0632 . 1 272 SNARE and Associated Proteins AT4G02195 57.5 1.3e-70 264.2
Tan08g0634 . 1 302 SNARE and Associated Proteins AT4G02195 51.8 7.2e-66 248.4
Tan06g0761 . 1 319 SNARE and Associated Proteins AT3G05710 63.4 4.3e-98 355.5
Tan06g0762 . 1 328 SNARE and Associated Proteins AT3G05710 61.7 4.7e-97 352.1
Tan08g0631 . 1 229 SNARE and Associated Proteins AT3G05710 80.3 1.3e-91 334.0
Tan08g0630 . 1 229 SNARE and Associated Proteins AT3G05710 80.3 1.3e-91 334.0
Tan08g0633 . 1 259 SNARE and Associated Proteins AT3G05710 71.0 7.6e-87 318.2
Tan08g0632 . 1 271 SNARE and Associated Proteins AT3G05710 67.9 1.9e-85 313.5
Tan08g0634 . 1 301 SNARE and Associated Proteins AT3G05710 61.1 1.1e-80 297.7
Tan01g3132 . 1 233 SNARE and Associated Proteins AT1G16240 71.7 2.0e-89 326.2
Tan01g1776 . 4 232 SNARE and Associated Proteins AT1G16240 67.7 1.5e-81 300.1
Tan01g1777 . 4 232 SNARE and Associated Proteins AT1G16240 67.7 1.5e-81 300.1
Tan01g3132 . 1 233 SNARE and Associated Proteins AT1G79590 71.2 1.9e-88 323.2
Tan01g1776 . 4 232 SNARE and Associated Proteins AT1G79590 68.1 7.7e-82 301.2
Tan01g1777 . 4 232 SNARE and Associated Proteins AT1G79590 68.1 7.7e-82 301.2
Tan09g0537 . 56 246 SNARE and Associated Proteins AT1G28490 70.7 1.7e-65 246.5
Tan11g2093 . 56 246 SNARE and Associated Proteins AT1G28490 70.2 1.9e-64 243.0
Tan11g2090 . 56 246 SNARE and Associated Proteins AT1G28490 70.2 1.9e-64 243.0
Tan11g2091 . 56 192 SNARE and Associated Proteins AT1G28490 66.4 3.4e-42 169.1
Tan11g2092 . 56 192 SNARE and Associated Proteins AT1G28490 66.4 3.4e-42 169.1
Tan08g1893 . 1 264 SNARE and Associated Proteins AT3G09740 79.7 8.5e-113 404.1
Tan05g0265 . 1 265 SNARE and Associated Proteins AT3G09740 68.3 9.4e-96 347.4
Tan05g0265 . 1 265 SNARE and Associated Proteins AT3G45280 65.7 8.5e-89 324.3
Tan08g1893 . 1 264 SNARE and Associated Proteins AT3G45280 64.4 1.2e-87 320.5
Tan08g1893 . 1 261 SNARE and Associated Proteins AT3G61450 68.6 2.1e-95 346.3
Tan05g0265 . 1 262 SNARE and Associated Proteins AT3G61450 60.8 3.0e-86 315.8
Tan11g0243 . 65 310 SNARE and Associated Proteins AT1G51740 74.1 2.6e-92 335.9
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0003742 3 1 1 2 2 1 2 1 1 1 1 1 2 1 1 2 1 4 2 1 1 1 1 1 2 1 1 3 1 2 45