Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Tan06g0356 ATGGAGGAGCCCGTTCCCGACCAATCCGCCACCGCAAACCGGTGGTTCCGCCGCCTTCCGGAGAATCTCCGCCCAAAAACGTCCGTCCTCGCAGAGATATCAGGTGCCGTCGGCGACCTCGGCACTTACATCCCCATCGTTCTCACTCTTACTCTGGTCACCCATCTCGACCTCGGAACCACCCTAATCTTCACCGCTCTTTACAACATCGTCACCGGCACTCTCTTCGGCATTCCGATGCCGGTTCAGCCGATGAAATCTATCGCCGCCGTCGCCGTCGCTGAGTCTACTCATCTCACTCTCCCTCAAATCGCTGCCGCCGGCCTCTCCACCGCTGCCGTCCTCCTAATCCTCGGCGCCACCGGCCTCATGTCCTTCCTCTACCGCTACCTCCCACTCCCGGTTGTTCGCGGTATCCAGCTTTCTCAGGGACTCTCCTTCGCCTTCTCCGCCATTAAATACATTCGGTACGATCAGGATTTGGTCACCTCTAAAGCCGTCGGACCTCGGTCCTGGCTTGGATTCGACGGACTAATTGTTGCCCTAGTTTCTTGTTTATTTCTAATTTTGACCACTGGAGCCGGCGATTCTCATAATCAAGAACCGTCATCCTCGGAACCGCTTAACGGTTCTGAATCTCGTTCGGGCCGTCGCGCCAGAAGGTTACGGATCTTATCTATGATTCCTGGTGCTCTGATTGTGTTCTTGTTTGGATTATTGATCTGTTTTCTTCGCGATCTTTCCGTTTTGAAGTACCTTAAATTTGGCCCTTCGAAATTACAAATTCTGAAAATCACATGGGAAGATTGGAAAATAGGGTTTGTACGAGCTGCAATTCCCCAAATTCCTCTTTCGATTTTGAATTCAGTGATTGCAGTTTGCAAATTGTCGGGCGATTTGTTTCCAGATCGTGAAGCCTCCGCCATGACTGTCTCTGTCAGTGTGGGGATTATGAACTTCGTCGGTTGCTGGTTTGGCGCAATGCCGGTCTGCCACGGCGCCGGCGGCCTCGCCGGCCAGTACCGGTTCGGTGGGAGAAGTGGGGCGTCGGTGGTGTTTTTAGGGATTGGGAAATTGTTTTTGGGATTTGCGTTTGGGAATTCTTTTGCACAGGTTTTGAGTCAGTTCCCAATTGGAGTTCTTGGAGTTCTTCTGTTATTTGCTGGGATTGAATTGGCCATGGCTTCCAGAGATATGAACAGTAAAGAAGAATCATTTGTGATGTTAGTTTGTGCTGCTGTTTCACTCACAGGTTCAAGTGCTGCTTTGGGTTTTGGAGTTGGGATTGTGCTGTTTCTGCTTCTGAAACTGAGAGAATTTGACTGTTCTTCTTCTGGTTTTGGGTTTCAGAAGATGAAACCCAATTCTGATGGTGAAGAAGAAGAAGAAGAAATCCAGTTGTTAGCTTGA 1410 50.21 MEEPVPDQSATANRWFRRLPENLRPKTSVLAEISGAVGDLGTYIPIVLTLTLVTHLDLGTTLIFTALYNIVTGTLFGIPMPVQPMKSIAAVAVAESTHLTLPQIAAAGLSTAAVLLILGATGLMSFLYRYLPLPVVRGIQLSQGLSFAFSAIKYIRYDQDLVTSKAVGPRSWLGFDGLIVALVSCLFLILTTGAGDSHNQEPSSSEPLNGSESRSGRRARRLRILSMIPGALIVFLFGLLICFLRDLSVLKYLKFGPSKLQILKITWEDWKIGFVRAAIPQIPLSILNSVIAVCKLSGDLFPDREASAMTVSVSVGIMNFVGCWFGAMPVCHGAGGLAGQYRFGGRSGASVVFLGIGKLFLGFAFGNSFAQVLSQFPIGVLGVLLLFAGIELAMASRDMNSKEESFVMLVCAAVSLTGSSAALGFGVGIVLFLLLKLREFDCSSSGFGFQKMKPNSDGEEEEEEIQLLA 469
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
6 2831902 2833615 - Tan0019981.1 Tan06g0356 755060

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Tan06g0356 469 MobiDBLite consensus disorder prediction 195 214 - -
Tan06g0356 469 Pfam Molybdate transporter of MFS superfamily 31 147 IPR031563 GO:0015098(InterPro)|GO:0015689(InterPro)
Tan06g0356 469 Pfam Molybdate transporter of MFS superfamily 274 392 IPR031563 GO:0015098(InterPro)|GO:0015689(InterPro)
Tan06g0356 469 PANTHER - 11 442 IPR031563 GO:0015098(InterPro)|GO:0015689(InterPro)
Tan06g0356 469 MobiDBLite consensus disorder prediction 195 212 - -
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Tan06g0356 - - - - 0.0
       

Dupl-types


Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Tan02g2665 Tan-Chr2:94972674 Tan06g0356 Tan-Chr6:2831902 3.20E-131 dispersed
       

Deco-Alignment


Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi9g454 Blo05g00118 . Bda04g00839 . Bpe06g00709 . . . . Cmo17g00805 . . . . . Cpe12g00720 . . . . . . . . . . . . . . . . . . . Lsi02g02748 Csa07g02193 . Cme01g02642 . . . . . . . . Sed09g1518 . . . . . Car17g00778 . . Bhi09g00085 Tan06g0356 Cmetu01g0125 . Hepe03g1593 . . Cla09g00222 Cam09g0244 Cec09g0248 Cco09g0241 Clacu09g0244 . Cre09g0237 . . Chy01g02027 .
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Tan06g1013 . 19 658 Inorganic Solute Cotransporters AT4G02700 71.6 2.5e-267 918.7
Tan10g0797 . 10 650 Inorganic Solute Cotransporters AT4G02700 64.3 4.2e-243 838.2
Tan11g1359 . 24 650 Inorganic Solute Cotransporters AT4G02700 52.2 1.0e-188 657.5
Tan04g1667 . 31 648 Inorganic Solute Cotransporters AT4G02700 52.9 1.3e-186 650.6
Tan01g3965 . 36 654 Inorganic Solute Cotransporters AT4G02700 51.1 9.0e-185 644.4
Tan04g1668 . 31 612 Inorganic Solute Cotransporters AT4G02700 53.6 3.3e-179 625.9
Tan02g1254 . 28 640 Inorganic Solute Cotransporters AT4G02700 50.6 3.5e-173 605.9
Tan09g1309 . 3 586 Inorganic Solute Cotransporters AT4G02700 50.3 4.5e-168 589.0
Tan09g1310 . 3 513 Inorganic Solute Cotransporters AT4G02700 52.0 8.2e-154 541.6
Tan11g1358 . 1 510 Inorganic Solute Cotransporters AT4G02700 51.6 7.7e-152 535.0
Tan11g1360 . 1 445 Inorganic Solute Cotransporters AT4G02700 51.5 3.6e-133 473.0
Tan04g1667 . 160 659 Inorganic Solute Cotransporters AT1G23090 75.8 7.1e-214 740.7
Tan04g1668 . 160 610 Inorganic Solute Cotransporters AT1G23090 77.2 5.5e-198 688.0
Tan10g0797 . 139 625 Inorganic Solute Cotransporters AT1G23090 55.3 1.3e-154 543.9
Tan06g1013 . 148 634 Inorganic Solute Cotransporters AT1G23090 55.7 4.1e-153 538.9
Tan11g1359 . 162 653 Inorganic Solute Cotransporters AT1G23090 51.7 4.9e-138 488.8
Tan11g1358 . 22 513 Inorganic Solute Cotransporters AT1G23090 51.7 4.9e-138 488.8
Tan01g3965 . 165 656 Inorganic Solute Cotransporters AT1G23090 51.3 7.8e-136 481.5
Tan11g1360 . 22 445 Inorganic Solute Cotransporters AT1G23090 53.8 2.4e-124 443.4
Tan04g1667 . 17 654 Inorganic Solute Cotransporters AT3G15990 63.8 3.0e-228 788.9
Tan04g1668 . 17 614 Inorganic Solute Cotransporters AT3G15990 63.9 4.5e-216 748.4
Tan06g1013 . 5 633 Inorganic Solute Cotransporters AT3G15990 57.9 2.9e-207 719.2
Tan10g0797 . 10 636 Inorganic Solute Cotransporters AT3G15990 55.0 1.3e-199 693.7
Tan01g3965 . 15 652 Inorganic Solute Cotransporters AT3G15990 51.8 1.3e-186 650.6
Tan11g1359 . 19 651 Inorganic Solute Cotransporters AT3G15990 51.6 2.6e-184 642.9
Tan02g1254 . 22 640 Inorganic Solute Cotransporters AT3G15990 50.5 9.4e-174 607.8
Tan11g1358 . 1 511 Inorganic Solute Cotransporters AT3G15990 52.1 7.5e-147 518.5
Tan11g1360 . 1 445 Inorganic Solute Cotransporters AT3G15990 53.0 2.2e-130 463.8
Tan09g1309 . 5 589 Inorganic Solute Cotransporters AT5G19600 65.5 3.4e-221 765.4
Tan09g1312 . 3 596 Inorganic Solute Cotransporters AT5G19600 61.1 7.9e-218 754.2
Tan09g1313 . 3 625 Inorganic Solute Cotransporters AT5G19600 58.5 3.4e-213 738.8
Tan09g1307 . 3 555 Inorganic Solute Cotransporters AT5G19600 64.7 2.7e-202 702.6
Tan09g1310 . 5 514 Inorganic Solute Cotransporters AT5G19600 68.1 2.8e-199 692.6
Tan10g0797 . 26 636 Inorganic Solute Cotransporters AT5G19600 54.7 2.2e-196 682.9
Tan09g1314 . 3 550 Inorganic Solute Cotransporters AT5G19600 59.8 2.8e-191 666.0
Tan06g1013 . 26 645 Inorganic Solute Cotransporters AT5G19600 53.5 8.3e-191 664.5
Tan11g0773 . 24 643 Inorganic Solute Cotransporters AT5G13550 74.4 1.3e-271 932.9
Tan11g0774 . 1 535 Inorganic Solute Cotransporters AT5G13550 77.4 1.6e-240 829.7
Tan04g1667 . 17 654 Inorganic Solute Cotransporters AT3G15990 63.8 3.0e-228 788.9
Tan04g1668 . 17 614 Inorganic Solute Cotransporters AT3G15990 63.9 4.5e-216 748.4
Tan06g1013 . 5 633 Inorganic Solute Cotransporters AT3G15990 57.9 2.9e-207 719.2
Tan10g0797 . 10 636 Inorganic Solute Cotransporters AT3G15990 55.0 1.3e-199 693.7
Tan01g3965 . 15 652 Inorganic Solute Cotransporters AT3G15990 51.8 1.3e-186 650.6
Tan11g1359 . 19 651 Inorganic Solute Cotransporters AT3G15990 51.6 2.6e-184 642.9
Tan02g1254 . 22 640 Inorganic Solute Cotransporters AT3G15990 50.5 9.4e-174 607.8
Tan11g1358 . 1 511 Inorganic Solute Cotransporters AT3G15990 52.1 7.5e-147 518.5
Tan11g1360 . 1 445 Inorganic Solute Cotransporters AT3G15990 53.0 2.2e-130 463.8
Tan01g3965 . 37 657 Inorganic Solute Cotransporters AT4G08620 73.9 6.3e-263 904.0
Tan11g1359 . 23 657 Inorganic Solute Cotransporters AT4G08620 71.3 2.0e-261 899.0
Tan02g1254 . 1 640 Inorganic Solute Cotransporters AT4G08620 67.1 7.3e-243 837.4
Tan11g1358 . 1 517 Inorganic Solute Cotransporters AT4G08620 72.9 3.8e-215 745.3
Tan02g1255 . 1 598 Inorganic Solute Cotransporters AT4G08620 60.8 2.3e-212 736.1
Tan06g1013 . 20 636 Inorganic Solute Cotransporters AT4G08620 55.7 1.4e-201 700.3
Tan10g0797 . 11 627 Inorganic Solute Cotransporters AT4G08620 51.9 8.4e-191 664.5
Tan11g1360 . 1 445 Inorganic Solute Cotransporters AT4G08620 74.8 4.6e-189 658.7
Tan04g1667 . 33 658 Inorganic Solute Cotransporters AT4G08620 52.0 1.3e-186 650.6
Tan01g1356 . 42 655 Inorganic Solute Cotransporters AT4G08620 52.8 1.7e-178 623.6
Tan04g1668 . 33 610 Inorganic Solute Cotransporters AT4G08620 52.8 6.3e-178 621.7
Tan11g1361 . 88 664 Inorganic Solute Cotransporters AT4G08620 56.6 5.0e-175 612.1
Tan11g1361 . 29 662 Inorganic Solute Cotransporters AT1G77990 64.1 3.1e-228 788.9
Tan01g1356 . 27 659 Inorganic Solute Cotransporters AT1G77990 58.6 8.2e-213 737.6
Tan01g3965 . 80 650 Inorganic Solute Cotransporters AT1G77990 53.6 1.2e-171 600.9
Tan06g1013 . 67 632 Inorganic Solute Cotransporters AT1G77990 51.7 2.0e-158 557.0
Tan11g1358 . 1 507 Inorganic Solute Cotransporters AT1G77990 51.1 2.9e-141 500.0
Tan11g1360 . 1 445 Inorganic Solute Cotransporters AT1G77990 52.3 9.0e-127 451.8
Tan11g1360 . 1 449 Inorganic Solute Cotransporters AT1G78000 81.1 2.1e-204 709.1
Tan11g1359 . 141 585 Inorganic Solute Cotransporters AT1G78000 81.3 4.0e-203 704.9
Tan11g1358 . 1 445 Inorganic Solute Cotransporters AT1G78000 81.3 4.0e-203 704.9
Tan01g3965 . 144 588 Inorganic Solute Cotransporters AT1G78000 78.9 1.5e-194 676.4
Tan02g1254 . 135 578 Inorganic Solute Cotransporters AT1G78000 72.6 8.1e-180 627.5
Tan02g1255 . 135 534 Inorganic Solute Cotransporters AT1G78000 64.0 2.4e-147 519.6
Tan06g1013 . 127 570 Inorganic Solute Cotransporters AT1G78000 55.7 2.7e-143 506.1
Tan10g0797 . 118 561 Inorganic Solute Cotransporters AT1G78000 52.1 1.8e-139 493.4
Tan04g1667 . 139 583 Inorganic Solute Cotransporters AT1G78000 55.7 4.5e-138 488.8
Tan04g1668 . 139 583 Inorganic Solute Cotransporters AT1G78000 55.7 4.5e-138 488.8
Tan01g1356 . 148 595 Inorganic Solute Cotransporters AT1G78000 56.1 2.6e-133 473.0
Tan11g1361 . 152 579 Inorganic Solute Cotransporters AT1G78000 55.4 1.4e-131 467.2
Tan11g0773 . 29 543 Inorganic Solute Cotransporters AT3G12520 75.0 5.5e-220 761.1
Tan11g0774 . 1 435 Inorganic Solute Cotransporters AT3G12520 78.9 6.3e-192 667.9
Tan11g1359 . 1 657 Inorganic Solute Cotransporters AT1G22150 75.7 1.3e-287 986.1
Tan01g3965 . 1 661 Inorganic Solute Cotransporters AT1G22150 74.7 4.3e-283 971.1
Tan02g1254 . 28 646 Inorganic Solute Cotransporters AT1G22150 69.4 9.3e-246 847.0
Tan11g1358 . 1 517 Inorganic Solute Cotransporters AT1G22150 78.1 2.0e-232 802.7
Tan02g1255 . 1 602 Inorganic Solute Cotransporters AT1G22150 61.8 2.5e-214 742.7
Tan06g1013 . 18 639 Inorganic Solute Cotransporters AT1G22150 53.6 2.6e-200 696.0
Tan11g1360 . 1 445 Inorganic Solute Cotransporters AT1G22150 78.4 5.9e-200 694.9
Tan04g1667 . 15 656 Inorganic Solute Cotransporters AT1G22150 53.3 3.5e-192 669.1
Tan10g0797 . 10 627 Inorganic Solute Cotransporters AT1G22150 50.7 4.5e-192 668.7
Tan04g1668 . 15 610 Inorganic Solute Cotransporters AT1G22150 54.8 5.4e-185 645.2
Tan01g1356 . 26 655 Inorganic Solute Cotransporters AT1G22150 52.4 2.0e-176 616.7
Tan11g1361 . 78 664 Inorganic Solute Cotransporters AT1G22150 52.6 4.4e-171 599.0
Tan01g1356 . 35 660 Inorganic Solute Cotransporters AT5G10180 62.1 1.2e-224 776.9
Tan11g1361 . 20 666 Inorganic Solute Cotransporters AT5G10180 62.3 6.0e-224 774.6
Tan11g1359 . 46 650 Inorganic Solute Cotransporters AT5G10180 55.5 6.8e-183 638.3
Tan01g3965 . 22 653 Inorganic Solute Cotransporters AT5G10180 52.8 1.1e-180 630.9
Tan02g1254 . 38 640 Inorganic Solute Cotransporters AT5G10180 52.1 1.1e-169 594.3
Tan06g1013 . 25 635 Inorganic Solute Cotransporters AT5G10180 50.8 8.0e-168 588.2
Tan11g1358 . 1 510 Inorganic Solute Cotransporters AT5G10180 55.6 2.8e-152 536.6
Tan11g1360 . 1 445 Inorganic Solute Cotransporters AT5G10180 57.8 1.0e-138 491.5
Tan06g0356 . 15 424 Inorganic Solute Cotransporters AT1G80310 70.3 2.2e-156 549.7
Tan02g2665 . 48 457 Inorganic Solute Cotransporters AT1G80310 55.6 8.3e-124 441.4
Tan02g2665 . 33 461 Inorganic Solute Cotransporters AT2G25680 64.7 1.8e-155 546.6
Tan06g0356 . 16 424 Inorganic Solute Cotransporters AT2G25680 54.9 7.7e-122 434.9
Tan04g2508 . 1 538 Inorganic Solute Cotransporters AT1G80830 76.6 7.8e-227 783.9
Tan11g1251 . 26 501 Inorganic Solute Cotransporters AT1G80830 63.0 2.7e-166 582.8
Tan04g2508 . 19 541 Inorganic Solute Cotransporters AT1G15960 77.5 8.6e-226 780.4
Tan11g1251 . 26 498 Inorganic Solute Cotransporters AT1G15960 63.6 5.0e-165 578.6
Tan05g1588 . 3 496 Inorganic Solute Cotransporters AT2G23150 77.0 2.9e-218 755.4
Tan05g1589 . 3 496 Inorganic Solute Cotransporters AT2G23150 77.0 2.9e-218 755.4
Tan05g1588 . 14 495 Inorganic Solute Cotransporters AT1G47240 74.6 3.6e-208 721.8
Tan05g1589 . 14 495 Inorganic Solute Cotransporters AT1G47240 74.6 3.6e-208 721.8
Tan05g1588 . 8 496 Inorganic Solute Cotransporters AT5G67330 76.7 1.0e-215 746.9
Tan05g1589 . 8 496 Inorganic Solute Cotransporters AT5G67330 76.7 1.0e-215 746.9
Tan05g1588 . 29 496 Inorganic Solute Cotransporters AT4G18790 68.7 6.9e-183 637.9
Tan05g1589 . 29 496 Inorganic Solute Cotransporters AT4G18790 68.7 6.9e-183 637.9
Tan01g2640 . 3 531 Inorganic Solute Cotransporters AT3G45060 70.9 2.4e-223 772.3
Tan01g2641 . 3 523 Inorganic Solute Cotransporters AT3G45060 69.8 1.2e-217 753.4
Tan04g1272 . 14 484 Inorganic Solute Cotransporters AT3G45060 56.6 1.4e-154 543.9
Tan01g2640 . 7 531 Inorganic Solute Cotransporters AT1G08090 80.4 1.2e-251 866.3
Tan01g2641 . 7 523 Inorganic Solute Cotransporters AT1G08090 79.4 4.4e-246 847.8
Tan04g1272 . 14 467 Inorganic Solute Cotransporters AT1G08090 56.4 1.9e-156 550.1
Tan01g2640 . 9 517 Inorganic Solute Cotransporters AT1G08100 76.4 5.1e-231 797.7
Tan01g2641 . 9 509 Inorganic Solute Cotransporters AT1G08100 75.4 1.9e-225 779.2
Tan04g1272 . 1 466 Inorganic Solute Cotransporters AT1G08100 55.9 1.4e-159 560.5
Tan04g1272 . 17 442 Inorganic Solute Cotransporters AT5G14570 51.7 2.2e-127 453.4
Tan04g1272 . 1 466 Inorganic Solute Cotransporters AT1G12940 70.2 4.8e-194 674.9
Tan01g2640 . 34 521 Inorganic Solute Cotransporters AT1G12940 59.0 1.9e-166 583.2
Tan01g2641 . 34 513 Inorganic Solute Cotransporters AT1G12940 58.6 1.2e-163 573.9
Tan01g2640 . 7 531 Inorganic Solute Cotransporters AT5G60770 80.6 3.5e-251 864.8
Tan01g2641 . 7 523 Inorganic Solute Cotransporters AT5G60770 79.4 9.7e-246 846.7
Tan04g1272 . 3 479 Inorganic Solute Cotransporters AT5G60770 54.5 3.2e-156 549.3
Tan01g2640 . 3 531 Inorganic Solute Cotransporters AT5G60780 72.3 7.2e-228 787.3
Tan01g2641 . 3 523 Inorganic Solute Cotransporters AT5G60780 71.2 3.5e-222 768.5
Tan04g1272 . 14 476 Inorganic Solute Cotransporters AT5G60780 56.1 5.3e-154 542.0
Tan05g2801 . 8 351 Inorganic Solute Cotransporters AT4G19680 60.1 1.6e-106 383.6
Tan01g0349 . 7 342 Inorganic Solute Cotransporters AT4G19680 57.1 5.9e-98 355.1
Tan03g2495 . 12 345 Inorganic Solute Cotransporters AT4G19680 53.0 6.6e-89 325.1
Tan05g2801 . 1 351 Inorganic Solute Cotransporters AT4G19690 65.3 2.7e-119 426.0
Tan01g0349 . 1 343 Inorganic Solute Cotransporters AT4G19690 59.4 7.4e-109 391.3
Tan03g2495 . 1 345 Inorganic Solute Cotransporters AT4G19690 57.7 3.1e-99 359.4
Tan02g0022 . 21 255 Inorganic Solute Cotransporters AT1G05300 55.6 1.1e-54 211.1
Tan01g4206 . 37 253 Inorganic Solute Cotransporters AT1G05300 54.2 8.9e-54 208.0
Tan01g4205 . 37 265 Inorganic Solute Cotransporters AT1G05300 52.3 3.4e-53 206.1
Tan01g4205 . 43 352 Inorganic Solute Cotransporters AT5G62160 51.9 1.2e-77 287.7
Tan01g4206 . 43 251 Inorganic Solute Cotransporters AT5G62160 51.6 2.0e-48 190.7
Tan05g0499 . 12 333 Inorganic Solute Cotransporters AT2G30080 68.7 1.5e-122 436.8
Tan05g0500 . 12 333 Inorganic Solute Cotransporters AT2G30080 68.7 1.5e-122 436.8
Tan02g1634 . 24 415 Inorganic Solute Cotransporters AT1G60960 67.8 3.7e-139 492.3
Tan01g4205 . 37 352 Inorganic Solute Cotransporters AT2G32270 55.4 4.9e-89 325.5
Tan02g0022 . 5 356 Inorganic Solute Cotransporters AT2G32270 51.7 1.4e-88 323.9
Tan01g4206 . 37 251 Inorganic Solute Cotransporters AT2G32270 52.6 1.1e-51 201.4
Tan02g1634 . 40 415 Inorganic Solute Cotransporters AT1G10970 69.5 6.7e-132 468.0
Tan02g1634 . 1 415 Inorganic Solute Cotransporters AT4G33020 58.4 1.0e-114 411.0
Tan02g0022 . 28 356 Inorganic Solute Cotransporters AT3G12750 61.9 6.6e-105 378.3
Tan01g4205 . 46 352 Inorganic Solute Cotransporters AT3G12750 57.3 1.5e-93 340.5
Tan01g4206 . 46 250 Inorganic Solute Cotransporters AT3G12750 56.1 4.2e-59 226.1
Tan05g2801 . 2 351 Inorganic Solute Cotransporters AT1G31260 65.4 2.3e-121 433.0
Tan01g0349 . 8 343 Inorganic Solute Cotransporters AT1G31260 61.0 5.0e-108 388.7
Tan03g2495 . 13 345 Inorganic Solute Cotransporters AT1G31260 55.2 2.2e-95 346.7
Tan05g3037 . 219 705 Inorganic Solute Cotransporters AT4G19960 56.1 7.7e-167 584.7
Tan10g1473 . 8 807 Inorganic Solute Cotransporters AT4G13420 60.3 7.2e-261 897.5
Tan04g2184 . 42 771 Inorganic Solute Cotransporters AT4G13420 54.5 1.8e-224 776.5
Tan06g0850 . 28 752 Inorganic Solute Cotransporters AT4G13420 53.7 4.3e-221 765.4
Tan06g0849 . 22 764 Inorganic Solute Cotransporters AT4G13420 53.6 4.7e-220 761.9
Tan04g2183 . 7 744 Inorganic Solute Cotransporters AT4G13420 52.6 9.8e-218 754.2
Tan04g2201 . 98 712 Inorganic Solute Cotransporters AT4G13420 60.5 7.8e-207 718.0
Tan08g2369 . 123 758 Inorganic Solute Cotransporters AT2G30070 66.5 1.1e-237 820.1
Tan08g2370 . 123 758 Inorganic Solute Cotransporters AT2G30070 66.5 1.1e-237 820.1
Tan08g2371 . 6 627 Inorganic Solute Cotransporters AT2G30070 67.0 8.7e-235 810.4
Tan07g0027 . 121 784 Inorganic Solute Cotransporters AT2G30070 51.8 3.0e-195 679.1
Tan07g1332 . 117 773 Inorganic Solute Cotransporters AT2G30070 51.1 7.5e-186 647.9
Tan02g1319 . 118 778 Inorganic Solute Cotransporters AT2G30070 50.8 9.7e-186 647.5
Tan11g0608 . 116 776 Inorganic Solute Cotransporters AT2G30070 51.4 1.0e-182 637.5
Tan02g1320 . 1 614 Inorganic Solute Cotransporters AT2G30070 51.8 7.5e-178 621.3
Tan11g0609 . 5 590 Inorganic Solute Cotransporters AT2G30070 51.9 5.0e-166 582.0
Tan11g0002 . 7 838 Inorganic Solute Cotransporters AT1G60160 77.0 0.0e+00 1227.6
Tan11g0001 . 7 697 Inorganic Solute Cotransporters AT1G60160 62.7 1.2e-269 926.8
Tan01g0510 . 5 848 Inorganic Solute Cotransporters AT1G60160 57.4 3.6e-263 905.2
Tan04g2201 . 99 711 Inorganic Solute Cotransporters AT1G60160 50.7 2.0e-173 607.1
Tan07g0027 . 5 784 Inorganic Solute Cotransporters AT3G02050 78.2 0.0e+00 1211.4
Tan07g1332 . 21 773 Inorganic Solute Cotransporters AT3G02050 55.9 1.6e-239 826.6
Tan08g2369 . 26 758 Inorganic Solute Cotransporters AT3G02050 53.7 2.8e-236 815.8
Tan08g2370 . 26 758 Inorganic Solute Cotransporters AT3G02050 53.7 2.8e-236 815.8
Tan11g0608 . 15 776 Inorganic Solute Cotransporters AT3G02050 54.5 4.6e-231 798.5
Tan02g1319 . 4 778 Inorganic Solute Cotransporters AT3G02050 53.4 2.5e-229 792.7
Tan04g1407 . 16 790 Inorganic Solute Cotransporters AT3G02050 52.8 2.5e-229 792.7
Tan04g1213 . 4 779 Inorganic Solute Cotransporters AT3G02050 51.2 8.0e-228 787.7
Tan08g2371 . 5 627 Inorganic Solute Cotransporters AT3G02050 51.4 1.3e-190 664.1
Tan02g1320 . 1 614 Inorganic Solute Cotransporters AT3G02050 53.5 5.5e-184 642.1
Tan11g0609 . 13 590 Inorganic Solute Cotransporters AT3G02050 54.5 5.8e-178 622.1
Tan07g1332 . 1 773 Inorganic Solute Cotransporters AT5G14880 75.9 0.0e+00 1178.3
Tan11g0608 . 9 776 Inorganic Solute Cotransporters AT5G14880 73.2 0.0e+00 1125.9
Tan02g1319 . 1 776 Inorganic Solute Cotransporters AT5G14880 70.9 0.0e+00 1103.6
Tan04g1213 . 1 779 Inorganic Solute Cotransporters AT5G14880 68.4 1.2e-308 1056.2
Tan04g1407 . 1 790 Inorganic Solute Cotransporters AT5G14880 63.7 3.2e-285 978.4
Tan02g1322 . 1 719 Inorganic Solute Cotransporters AT5G14880 64.2 1.9e-277 952.6
Tan02g1323 . 3 678 Inorganic Solute Cotransporters AT5G14880 63.6 1.0e-259 893.6
Tan02g1320 . 1 612 Inorganic Solute Cotransporters AT5G14880 70.4 1.8e-256 882.9
Tan11g0609 . 1 590 Inorganic Solute Cotransporters AT5G14880 71.6 2.4e-248 855.9
Tan07g0027 . 25 784 Inorganic Solute Cotransporters AT5G14880 57.7 5.0e-246 848.2
Tan08g2369 . 9 758 Inorganic Solute Cotransporters AT5G14880 52.4 5.9e-223 771.5
Tan08g2370 . 9 758 Inorganic Solute Cotransporters AT5G14880 52.4 5.9e-223 771.5
Tan02g1324 . 1 531 Inorganic Solute Cotransporters AT5G14880 60.9 1.2e-199 694.1
Tan08g2371 . 9 627 Inorganic Solute Cotransporters AT5G14880 50.6 5.2e-179 625.5
Tan07g0027 . 25 783 Inorganic Solute Cotransporters AT4G23640 60.6 8.1e-265 910.6
Tan07g1332 . 13 771 Inorganic Solute Cotransporters AT4G23640 50.5 2.3e-211 733.0
Tan04g1407 . 1 790 Inorganic Solute Cotransporters AT2G40540 80.0 0.0e+00 1271.5
Tan07g1332 . 1 771 Inorganic Solute Cotransporters AT2G40540 63.4 1.0e-291 1000.0
Tan02g1319 . 12 776 Inorganic Solute Cotransporters AT2G40540 62.1 3.0e-283 971.8
Tan11g0608 . 12 776 Inorganic Solute Cotransporters AT2G40540 63.2 1.1e-282 969.9
Tan04g1213 . 1 779 Inorganic Solute Cotransporters AT2G40540 60.1 1.0e-275 946.8
Tan02g1322 . 12 719 Inorganic Solute Cotransporters AT2G40540 55.9 2.9e-241 832.4
Tan07g0027 . 25 784 Inorganic Solute Cotransporters AT2G40540 54.8 1.1e-240 830.5
Tan02g1323 . 1 678 Inorganic Solute Cotransporters AT2G40540 55.0 4.4e-226 781.9
Tan08g2369 . 16 758 Inorganic Solute Cotransporters AT2G40540 51.5 5.8e-226 781.6
Tan08g2370 . 16 758 Inorganic Solute Cotransporters AT2G40540 51.5 5.8e-226 781.6
Tan02g1320 . 1 612 Inorganic Solute Cotransporters AT2G40540 61.0 1.2e-223 773.9
Tan11g0609 . 1 590 Inorganic Solute Cotransporters AT2G40540 60.8 3.8e-209 725.7
Tan02g1324 . 1 531 Inorganic Solute Cotransporters AT2G40540 52.0 4.5e-170 595.9
Tan07g1332 . 13 773 Inorganic Solute Cotransporters AT1G70300 75.4 0.0e+00 1164.1
Tan02g1319 . 1 778 Inorganic Solute Cotransporters AT1G70300 73.7 0.0e+00 1152.5
Tan11g0608 . 12 776 Inorganic Solute Cotransporters AT1G70300 72.4 0.0e+00 1104.4
Tan04g1213 . 1 779 Inorganic Solute Cotransporters AT1G70300 71.0 0.0e+00 1100.9
Tan02g1322 . 1 721 Inorganic Solute Cotransporters AT1G70300 67.7 3.9e-291 998.0
Tan04g1407 . 1 790 Inorganic Solute Cotransporters AT1G70300 62.0 7.1e-277 950.7
Tan02g1323 . 3 680 Inorganic Solute Cotransporters AT1G70300 67.0 1.5e-271 932.9
Tan02g1320 . 1 614 Inorganic Solute Cotransporters AT1G70300 74.1 4.2e-269 924.9
Tan11g0609 . 1 590 Inorganic Solute Cotransporters AT1G70300 70.7 9.4e-245 844.0
Tan07g0027 . 25 784 Inorganic Solute Cotransporters AT1G70300 55.8 4.8e-241 831.6
Tan08g2369 . 9 758 Inorganic Solute Cotransporters AT1G70300 53.2 1.1e-229 793.9
Tan08g2370 . 9 758 Inorganic Solute Cotransporters AT1G70300 53.2 1.1e-229 793.9
Tan02g1324 . 1 533 Inorganic Solute Cotransporters AT1G70300 65.8 1.8e-211 733.4
Tan08g2371 . 10 627 Inorganic Solute Cotransporters AT1G70300 51.7 1.9e-184 643.7
Tan01g0510 . 15 848 Inorganic Solute Cotransporters AT5G09400 78.9 0.0e+00 1270.8
Tan11g0002 . 60 838 Inorganic Solute Cotransporters AT5G09400 55.8 9.6e-251 864.0
Tan05g3037 . 6 705 Inorganic Solute Cotransporters AT1G31120 65.5 1.3e-281 966.5
Tan04g2201 . 130 711 Inorganic Solute Cotransporters AT1G31120 51.4 2.0e-173 607.1
Tan05g3037 . 6 705 Inorganic Solute Cotransporters AT2G35060 67.0 1.7e-281 966.1
Tan04g2201 . 130 711 Inorganic Solute Cotransporters AT2G35060 50.9 3.7e-172 602.8
Tan01g0510 . 225 848 Inorganic Solute Cotransporters AT4G33530 76.2 1.8e-267 919.1
Tan11g0002 . 220 838 Inorganic Solute Cotransporters AT4G33530 56.3 6.5e-196 681.4
Tan01g3180 . 1 336 Inorganic Solute Cotransporters AT1G55910 60.8 2.8e-102 369.4
Tan05g2696 . 137 982 Inorganic Solute Cotransporters AT1G30450 85.2 0.0e+00 1461.8
Tan01g2398 . 4 397 Inorganic Solute Cotransporters AT2G29410 55.7 9.2e-97 351.3
Tan01g2397 . 4 397 Inorganic Solute Cotransporters AT2G29410 55.7 9.2e-97 351.3
Tan07g0139 . 1 418 Inorganic Solute Cotransporters AT2G46800 72.5 6.9e-135 478.0
Tan07g0140 . 1 418 Inorganic Solute Cotransporters AT2G46800 72.5 6.9e-135 478.0
Tan07g0141 . 1 418 Inorganic Solute Cotransporters AT2G46800 72.5 6.9e-135 478.0
Tan01g2398 . 38 397 Inorganic Solute Cotransporters AT2G46800 51.0 1.2e-78 291.2
Tan01g2397 . 38 397 Inorganic Solute Cotransporters AT2G46800 51.0 1.2e-78 291.2
Tan07g0139 . 28 418 Inorganic Solute Cotransporters AT3G61940 59.7 7.1e-109 391.3
Tan07g0140 . 28 418 Inorganic Solute Cotransporters AT3G61940 59.7 7.1e-109 391.3
Tan07g0141 . 28 418 Inorganic Solute Cotransporters AT3G61940 59.7 7.1e-109 391.3
Tan07g0139 . 1 419 Inorganic Solute Cotransporters AT3G58810 69.3 1.5e-137 486.9
Tan07g0140 . 1 419 Inorganic Solute Cotransporters AT3G58810 69.3 1.5e-137 486.9
Tan07g0141 . 1 419 Inorganic Solute Cotransporters AT3G58810 69.3 1.5e-137 486.9
Tan10g0608 . 7 500 Inorganic Solute Cotransporters AT4G13510 79.8 2.5e-222 768.8
Tan06g2341 . 30 528 Inorganic Solute Cotransporters AT4G13510 80.0 2.1e-221 765.8
Tan08g1053 . 4 503 Inorganic Solute Cotransporters AT4G13510 73.6 2.4e-201 699.1
Tan07g2156 . 4 483 Inorganic Solute Cotransporters AT4G13510 73.6 8.0e-197 684.1
Tan07g2156 . 4 480 Inorganic Solute Cotransporters AT4G28700 77.9 7.5e-211 730.7
Tan08g1053 . 4 500 Inorganic Solute Cotransporters AT4G28700 73.5 2.8e-202 702.2
Tan06g2341 . 40 526 Inorganic Solute Cotransporters AT4G28700 75.4 1.8e-201 699.5
Tan10g0608 . 15 489 Inorganic Solute Cotransporters AT4G28700 75.4 4.5e-200 694.9
Tan10g0608 . 7 478 Inorganic Solute Cotransporters AT3G24290 79.3 8.7e-212 733.8
Tan06g2341 . 35 508 Inorganic Solute Cotransporters AT3G24290 77.6 9.3e-206 713.8
Tan08g1053 . 4 481 Inorganic Solute Cotransporters AT3G24290 74.8 8.7e-196 680.6
Tan07g2156 . 4 480 Inorganic Solute Cotransporters AT3G24290 73.8 3.7e-194 675.2
Tan10g0608 . 7 496 Inorganic Solute Cotransporters AT3G24300 78.0 2.0e-216 749.2
Tan06g2341 . 35 526 Inorganic Solute Cotransporters AT3G24300 76.2 1.1e-209 726.9
Tan08g1053 . 4 507 Inorganic Solute Cotransporters AT3G24300 71.4 1.0e-196 683.7
Tan07g2156 . 4 480 Inorganic Solute Cotransporters AT3G24300 72.2 2.2e-191 666.0
Tan08g1053 . 2 501 Inorganic Solute Cotransporters AT1G64780 80.0 3.1e-220 761.9
Tan06g2341 . 42 508 Inorganic Solute Cotransporters AT1G64780 79.1 3.7e-205 711.8
Tan10g0608 . 17 496 Inorganic Solute Cotransporters AT1G64780 75.4 4.5e-203 704.9
Tan07g2156 . 6 480 Inorganic Solute Cotransporters AT1G64780 76.3 3.9e-199 691.8
Tan10g0265 . 42 1211 Inorganic Solute Cotransporters AT1G01790 67.0 0.0e+00 1316.6
Tan02g1099 . 5 729 Inorganic Solute Cotransporters AT4G04850 71.7 5.8e-279 957.6
Tan10g0265 . 106 1215 Inorganic Solute Cotransporters AT4G00630 72.6 0.0e+00 1375.1
Tan01g2387 . 66 193 Inorganic Solute Cotransporters AT3G46900 59.2 7.7e-37 151.0
Tan03g0891 . 30 194 Inorganic Solute Cotransporters AT2G37920 72.7 7.3e-66 248.1
Tan02g1574 . 1 142 Inorganic Solute Cotransporters AT5G20650 56.8 3.8e-38 155.2
Tan07g2221 . 1 524 Inorganic Solute Cotransporters AT3G54700 83.4 9.5e-257 883.2
Tan10g0685 . 3 503 Inorganic Solute Cotransporters AT3G54700 80.5 1.2e-243 839.7
Tan06g2413 . 4 519 Inorganic Solute Cotransporters AT3G54700 79.7 3.0e-242 835.1
Tan10g0686 . 4 518 Inorganic Solute Cotransporters AT3G54700 77.3 2.8e-240 828.6
Tan11g1301 . 1 517 Inorganic Solute Cotransporters AT3G54700 75.7 5.6e-233 804.3
Tan01g0158 . 3 501 Inorganic Solute Cotransporters AT3G54700 61.4 1.2e-177 620.5
Tan01g5152 . 3 497 Inorganic Solute Cotransporters AT3G54700 53.1 4.9e-144 508.8
Tan07g2221 . 1 525 Inorganic Solute Cotransporters AT2G38940 83.6 4.1e-260 894.4
Tan06g2413 . 3 527 Inorganic Solute Cotransporters AT2G38940 77.5 6.4e-245 844.0
Tan10g0686 . 3 518 Inorganic Solute Cotransporters AT2G38940 76.6 1.3e-242 836.3
Tan10g0685 . 3 525 Inorganic Solute Cotransporters AT2G38940 76.4 6.6e-242 833.9
Tan11g1301 . 1 533 Inorganic Solute Cotransporters AT2G38940 73.8 1.5e-233 806.2
Tan01g0158 . 3 500 Inorganic Solute Cotransporters AT2G38940 60.7 3.3e-177 619.0
Tan01g5152 . 3 497 Inorganic Solute Cotransporters AT2G38940 52.1 4.1e-143 505.8
Tan01g5152 . 3 495 Inorganic Solute Cotransporters AT1G76430 63.9 3.8e-181 632.1
Tan10g0685 . 1 503 Inorganic Solute Cotransporters AT5G43340 71.4 4.8e-213 738.0
Tan07g2221 . 3 530 Inorganic Solute Cotransporters AT5G43340 67.2 5.1e-207 718.0
Tan10g0686 . 7 521 Inorganic Solute Cotransporters AT5G43340 66.4 1.0e-199 693.7
Tan06g2413 . 3 516 Inorganic Solute Cotransporters AT5G43340 66.6 2.0e-198 689.5
Tan11g1301 . 1 520 Inorganic Solute Cotransporters AT5G43340 65.6 1.5e-195 679.9
Tan01g0158 . 4 500 Inorganic Solute Cotransporters AT5G43340 57.8 3.0e-167 585.9
Tan01g5152 . 5 497 Inorganic Solute Cotransporters AT5G43340 50.9 3.1e-135 479.6
Tan10g0686 . 3 522 Inorganic Solute Cotransporters AT5G43350 79.0 2.6e-246 848.6
Tan06g2413 . 3 516 Inorganic Solute Cotransporters AT5G43350 79.1 1.0e-239 826.6
Tan07g2221 . 1 524 Inorganic Solute Cotransporters AT5G43350 77.2 3.9e-239 824.7
Tan10g0685 . 3 504 Inorganic Solute Cotransporters AT5G43350 76.7 9.7e-230 793.5
Tan11g1301 . 1 521 Inorganic Solute Cotransporters AT5G43350 72.8 4.0e-223 771.5
Tan01g0158 . 3 500 Inorganic Solute Cotransporters AT5G43350 63.2 1.5e-182 636.7
Tan01g5152 . 3 499 Inorganic Solute Cotransporters AT5G43350 54.2 4.6e-147 518.8
Tan10g0686 . 3 521 Inorganic Solute Cotransporters AT5G43360 80.3 1.2e-248 856.3
Tan06g2413 . 2 518 Inorganic Solute Cotransporters AT5G43360 79.5 1.2e-240 829.7
Tan07g2221 . 1 524 Inorganic Solute Cotransporters AT5G43360 77.7 3.3e-238 821.6
Tan10g0685 . 3 504 Inorganic Solute Cotransporters AT5G43360 76.9 2.3e-231 798.9
Tan11g1301 . 1 520 Inorganic Solute Cotransporters AT5G43360 72.8 1.5e-222 769.6
Tan01g0158 . 3 500 Inorganic Solute Cotransporters AT5G43360 63.0 2.6e-182 636.0
Tan01g5152 . 3 497 Inorganic Solute Cotransporters AT5G43360 53.7 3.0e-146 516.2
Tan10g0686 . 3 522 Inorganic Solute Cotransporters AT5G43370 79.2 6.7e-247 850.5
Tan06g2413 . 3 516 Inorganic Solute Cotransporters AT5G43370 79.5 1.1e-241 833.2
Tan07g2221 . 1 524 Inorganic Solute Cotransporters AT5G43370 77.0 1.8e-239 825.9
Tan10g0685 . 3 504 Inorganic Solute Cotransporters AT5G43370 76.4 2.6e-230 795.4
Tan11g1301 . 1 521 Inorganic Solute Cotransporters AT5G43370 72.7 6.1e-224 774.2
Tan01g0158 . 3 500 Inorganic Solute Cotransporters AT5G43370 63.2 1.4e-183 640.2
Tan01g5152 . 3 499 Inorganic Solute Cotransporters AT5G43370 54.1 3.2e-148 522.7
Tan10g0686 . 7 518 Inorganic Solute Cotransporters AT2G32830 78.9 2.3e-242 835.5
Tan06g2413 . 7 529 Inorganic Solute Cotransporters AT2G32830 78.1 5.1e-242 834.3
Tan07g2221 . 1 541 Inorganic Solute Cotransporters AT2G32830 75.4 4.4e-241 831.2
Tan11g1301 . 1 523 Inorganic Solute Cotransporters AT2G32830 74.1 3.5e-230 795.0
Tan10g0685 . 8 507 Inorganic Solute Cotransporters AT2G32830 75.6 2.1e-227 785.8
Tan01g0158 . 5 518 Inorganic Solute Cotransporters AT2G32830 61.0 2.5e-180 629.4
Tan01g5152 . 2 497 Inorganic Solute Cotransporters AT2G32830 55.6 5.5e-151 531.9
Tan01g5152 . 1 495 Inorganic Solute Cotransporters AT1G20860 63.3 2.0e-175 613.2
Tan07g2221 . 6 518 Inorganic Solute Cotransporters AT1G20860 52.2 6.3e-137 485.3
Tan08g2179 . 131 489 Inorganic Solute Cotransporters AT2G38290 75.5 3.6e-159 558.5
Tan02g2695 . 106 435 Inorganic Solute Cotransporters AT2G38290 59.7 1.3e-111 400.6
Tan03g2133 . 120 465 Inorganic Solute Cotransporters AT2G38290 56.3 4.8e-111 398.7
Tan09g1768 . 42 485 Inorganic Solute Cotransporters AT4G10310 51.0 2.4e-116 416.8
Tan04g1300 . 20 567 Inorganic Solute Cotransporters AT3G26570 71.7 4.2e-205 711.8
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0002045 4 2 3 3 2 2 2 3 2 2 2 2 1 2 2 2 2 3 2 2 2 2 2 2 2 2 2 2 2 2 65