Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Tan09g1055 ATGGCACTCTCCATTTCTTCCACTGCGCTCTCGACCCTCCCACTCAGAGAATCATCCCACAAACCTCATAACTTTCCGGGAAAATTTCCAAAGTACAATCTCCGGCGAGATTCTTCTCATCTGAACGCCGCTAAGTCCGGCGTGTCCAGCGTCTGTGAACCGCTCCCTCCCGATCGACCCCTCTGGTTCCCCGGCAGCAGCCCCCCTGAGTGGCTCGACGGCAGCCTTCCCGGCGATTTTGGCTTCGATCCGCTTGGATTGGGCTCCGACCCAGAGCTACTAAAATGGTTCGCACAAGCGGAGCTAATGCACGCGAGATGGGCAATGCTAGCAGTGGCCGGAATCCTGTTACCGGAATGGTTCGAAAGCTTGGGACTCATACAGAATTTCTCCTGGTACGACGCCGGAACGCGAGAGTATTTTGCAGACCCGACGACGTTGCTGGTAGCGCAACTGGCTCTGATGGGGTGGGTGGAGGGGCGGCGGTGGGCGGACCTGGTCAACCCGGGCAGTGTGGACGTGGACCTCAAACTGCCCCACAAGAAGAAGCCAAAGCCCGACGTGGGCTACCCGGGCGGATTCTGGTTCGACCCGATGATGTGGGGGAGAGGGTCGCCGGAGCCGGTGATGGTGCTGCGGACTAAGGAGATTAAGAATGGGCGGTTGGCGATGTTGGCGTTTGTTGGACTGTGGTTTCAGGCTATTTATACCGGCCAAGGCCCGCTTGAAAATCTCGCCGCCCACGTTGCAGATCCCGGCCACTGCAACATTTTTTCGGCGTTCAGGTCGGGTTGA 795 58.36 MALSISSTALSTLPLRESSHKPHNFPGKFPKYNLRRDSSHLNAAKSGVSSVCEPLPPDRPLWFPGSSPPEWLDGSLPGDFGFDPLGLGSDPELLKWFAQAELMHARWAMLAVAGILLPEWFESLGLIQNFSWYDAGTREYFADPTTLLVAQLALMGWVEGRRWADLVNPGSVDVDLKLPHKKKPKPDVGYPGGFWFDPMMWGRGSPEPVMVLRTKEIKNGRLAMLAFVGLWFQAIYTGQGPLENLAAHVADPGHCNIFSAFRSG 264
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
9 62798005 62799959 + Tan0018512.1 Tan09g1055 763398

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Tan09g1055 264 PANTHER CHLOROPHYLL A/B BINDING PROTEIN 45 258 IPR001344 GO:0009416(PANTHER)|GO:0009535(PANTHER)|GO:0009765(InterPro)|GO:0009768(PANTHER)|GO:0016020(InterPro)
Tan09g1055 264 Pfam Chlorophyll A-B binding protein 68 234 IPR022796 -
Tan09g1055 264 SUPERFAMILY Chlorophyll a-b binding protein 58 261 - -
Tan09g1055 264 Gene3D Chlorophyll a/b binding protein domain 69 254 - -
Tan09g1055 264 FunFam Chlorophyll a-b binding protein, chloroplastic 69 254 - -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Tan09g1055 K08908 - - csv:101211430 489.574
       

Dupl-types

Select Gene1 Location1 Gene2 Location2 E-value Duplicated-type
Tan02g1249 Tan-Chr2:32299137 Tan09g1055 Tan-Chr9:62798005 6.10E-36 dispersed
Tan04g0044 Tan-Chr4:410879 Tan09g1055 Tan-Chr9:62798005 2.60E-85 dispersed
Tan05g2431 Tan-Chr5:75463232 Tan09g1055 Tan-Chr9:62798005 7.50E-55 dispersed
Tan09g0704 Tan-Chr9:56612610 Tan09g1055 Tan-Chr9:62798005 1.40E-41 dispersed
Tan09g1055 Tan-Chr9:62798005 Tan11g0846 Tan-Chr11:6949329 6.10E-39 dispersed
Tan09g1055 Tan-Chr9:62798005 Tan09g2110 Tan-Chr9:71467726 1.20E-55 transposed
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi11g48 Blo01g00576 . . . . . . . . . . . . . Sed12g1695 Cpe04g01009 . Bhi02g01759 Tan09g1055 Cmetu02g0801 . Hepe09g0945 . . . . . . . . . . . Cone4ag0830 . . . . Cme02g00318 . . . . . . . . . . . . . . Car11g00625 . . . . . . . . . Cla03g01434 Cam03g1513 Cec03g1553 Cco03g1546 Clacu03g1538 Cmu03g2095 Cre03g1766 . Csa01g03007 Chy02g01290 .
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Tan01g2469 . 1 388 Chloroplast and Mitochondria Gene Families AT2G28800 66.9 2.7e-137 486.1
Tan02g2141 . 71 423 Chloroplast and Mitochondria Gene Families AT2G28800 55.7 2.3e-99 360.1
Tan02g2142 . 71 361 Chloroplast and Mitochondria Gene Families AT2G28800 62.7 1.2e-97 354.4
Tan02g1249 . 3 255 Chloroplast and Mitochondria Gene Families AT1G15820 79.6 7.7e-119 424.1
Tan02g0465 . 1 265 Chloroplast and Mitochondria Gene Families AT3G27690 89.5 3.6e-144 508.4
Tan04g2344 . 179 444 Chloroplast and Mitochondria Gene Families AT3G27690 76.6 5.5e-121 431.4
Tan03g2667 . 2 265 Chloroplast and Mitochondria Gene Families AT3G27690 77.4 9.4e-121 430.6
Tan03g2668 . 2 265 Chloroplast and Mitochondria Gene Families AT3G27690 76.7 8.0e-120 427.6
Tan05g2609 . 6 267 Chloroplast and Mitochondria Gene Families AT3G27690 77.6 5.2e-119 424.9
Tan05g2608 . 6 267 Chloroplast and Mitochondria Gene Families AT3G27690 76.9 7.5e-118 421.0
Tan05g0624 . 2 263 Chloroplast and Mitochondria Gene Families AT3G27690 77.0 1.3e-117 420.2
Tan01g1601 . 5 264 Chloroplast and Mitochondria Gene Families AT3G27690 67.0 1.5e-97 353.6
Tan01g5181 . 114 330 Chloroplast and Mitochondria Gene Families AT3G27690 51.2 8.4e-53 204.9
Tan10g1823 . 72 275 Chloroplast and Mitochondria Gene Families AT3G27690 53.8 9.3e-52 201.4
Tan04g0044 . 3 268 Chloroplast and Mitochondria Gene Families AT3G61470 80.2 4.0e-128 454.9
Tan09g1055 . 57 261 Chloroplast and Mitochondria Gene Families AT3G61470 65.9 8.5e-86 314.3
Tan09g2110 . 22 249 Chloroplast and Mitochondria Gene Families AT3G61470 51.7 2.2e-65 246.5
Tan05g2431 . 21 244 Chloroplast and Mitochondria Gene Families AT3G61470 50.4 8.6e-62 234.6
Tan02g1837 . 41 250 Chloroplast and Mitochondria Gene Families AT3G61470 50.2 1.5e-53 207.2
Tan11g0846 . 1 198 Chloroplast and Mitochondria Gene Families AT3G54890 82.1 3.6e-90 328.6
Tan03g0807 . 4 286 Chloroplast and Mitochondria Gene Families AT3G08940 83.1 6.5e-135 477.6
Tan01g5181 . 4 337 Chloroplast and Mitochondria Gene Families AT1G76570 73.4 9.6e-143 503.8
Tan09g0704 . 1 273 Chloroplast and Mitochondria Gene Families AT1G61520 85.3 1.1e-134 476.9
Tan02g0465 . 1 265 Chloroplast and Mitochondria Gene Families AT2G05070 89.4 4.1e-144 508.1
Tan03g2667 . 5 265 Chloroplast and Mitochondria Gene Families AT2G05070 78.6 3.2e-120 428.7
Tan05g2609 . 7 267 Chloroplast and Mitochondria Gene Families AT2G05070 78.9 1.2e-119 426.8
Tan03g2668 . 5 265 Chloroplast and Mitochondria Gene Families AT2G05070 77.8 2.7e-119 425.6
Tan04g2344 . 208 444 Chloroplast and Mitochondria Gene Families AT2G05070 84.0 6.0e-119 424.5
Tan05g2608 . 7 267 Chloroplast and Mitochondria Gene Families AT2G05070 78.2 1.8e-118 422.9
Tan05g0624 . 7 263 Chloroplast and Mitochondria Gene Families AT2G05070 78.2 7.4e-117 417.5
Tan01g1601 . 8 264 Chloroplast and Mitochondria Gene Families AT2G05070 68.4 4.5e-98 355.1
Tan01g5181 . 114 330 Chloroplast and Mitochondria Gene Families AT2G05070 50.2 2.4e-51 199.9
Tan02g0465 . 1 237 Chloroplast and Mitochondria Gene Families AT2G05100 89.5 2.3e-125 446.0
Tan03g2667 . 5 237 Chloroplast and Mitochondria Gene Families AT2G05100 76.8 1.4e-101 367.1
Tan04g2344 . 189 416 Chloroplast and Mitochondria Gene Families AT2G05100 77.8 5.2e-101 365.2
Tan05g2609 . 7 239 Chloroplast and Mitochondria Gene Families AT2G05100 77.4 5.2e-101 365.2
Tan03g2668 . 5 237 Chloroplast and Mitochondria Gene Families AT2G05100 75.9 1.2e-100 364.0
Tan05g0624 . 7 239 Chloroplast and Mitochondria Gene Families AT2G05100 77.0 1.2e-100 364.0
Tan05g2608 . 7 239 Chloroplast and Mitochondria Gene Families AT2G05100 77.0 1.5e-100 363.6
Tan01g1601 . 8 236 Chloroplast and Mitochondria Gene Families AT2G05100 68.1 6.4e-83 305.1
Tan10g1823 . 72 259 Chloroplast and Mitochondria Gene Families AT2G05100 53.1 2.2e-43 173.7
Tan03g0807 . 4 168 Chloroplast and Mitochondria Gene Families AT2G40100 74.0 2.2e-67 252.7
Tan03g2667 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29930 89.1 7.1e-136 480.7
Tan03g2668 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29930 89.1 7.1e-136 480.7
Tan05g0624 . 1 263 Chloroplast and Mitochondria Gene Families AT1G29930 89.0 1.8e-134 476.1
Tan05g2609 . 5 267 Chloroplast and Mitochondria Gene Families AT1G29930 87.9 1.8e-134 476.1
Tan05g2608 . 6 267 Chloroplast and Mitochondria Gene Families AT1G29930 87.1 5.7e-133 471.1
Tan04g2344 . 185 444 Chloroplast and Mitochondria Gene Families AT1G29930 85.7 8.7e-126 447.2
Tan02g0465 . 30 265 Chloroplast and Mitochondria Gene Families AT1G29930 83.8 3.7e-116 415.2
Tan01g1601 . 15 264 Chloroplast and Mitochondria Gene Families AT1G29930 68.9 1.0e-94 344.0
Tan03g2667 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29920 88.8 2.7e-135 478.8
Tan03g2668 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29920 88.8 2.7e-135 478.8
Tan05g0624 . 1 263 Chloroplast and Mitochondria Gene Families AT1G29920 88.6 6.7e-134 474.2
Tan05g2609 . 5 267 Chloroplast and Mitochondria Gene Families AT1G29920 87.5 6.7e-134 474.2
Tan05g2608 . 6 267 Chloroplast and Mitochondria Gene Families AT1G29920 86.7 2.1e-132 469.2
Tan04g2344 . 185 444 Chloroplast and Mitochondria Gene Families AT1G29920 85.7 1.1e-125 446.8
Tan02g0465 . 30 265 Chloroplast and Mitochondria Gene Families AT1G29920 83.8 3.7e-116 415.2
Tan01g1601 . 15 264 Chloroplast and Mitochondria Gene Families AT1G29920 68.9 1.0e-94 344.0
Tan03g2667 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29910 88.8 2.7e-135 478.8
Tan03g2668 . 1 265 Chloroplast and Mitochondria Gene Families AT1G29910 88.8 2.7e-135 478.8
Tan05g0624 . 1 263 Chloroplast and Mitochondria Gene Families AT1G29910 88.6 6.7e-134 474.2
Tan05g2609 . 5 267 Chloroplast and Mitochondria Gene Families AT1G29910 87.5 6.7e-134 474.2
Tan05g2608 . 6 267 Chloroplast and Mitochondria Gene Families AT1G29910 86.7 2.1e-132 469.2
Tan04g2344 . 185 444 Chloroplast and Mitochondria Gene Families AT1G29910 85.7 1.1e-125 446.8
Tan02g0465 . 30 265 Chloroplast and Mitochondria Gene Families AT1G29910 83.8 3.7e-116 415.2
Tan01g1601 . 15 264 Chloroplast and Mitochondria Gene Families AT1G29910 68.9 1.0e-94 344.0
Tan10g1823 . 11 290 Chloroplast and Mitochondria Gene Families AT4G10340 82.9 3.7e-135 478.4
Tan03g2668 . 37 253 Chloroplast and Mitochondria Gene Families AT4G10340 52.0 9.0e-57 218.0
Tan05g2609 . 39 255 Chloroplast and Mitochondria Gene Families AT4G10340 51.6 9.0e-57 218.0
Tan03g2667 . 37 253 Chloroplast and Mitochondria Gene Families AT4G10340 52.0 1.2e-56 217.6
Tan05g0624 . 51 255 Chloroplast and Mitochondria Gene Families AT4G10340 54.1 1.2e-56 217.6
Tan04g2344 . 228 432 Chloroplast and Mitochondria Gene Families AT4G10340 53.6 3.4e-56 216.1
Tan05g2608 . 39 255 Chloroplast and Mitochondria Gene Families AT4G10340 51.1 3.4e-56 216.1
Tan02g0465 . 49 253 Chloroplast and Mitochondria Gene Families AT4G10340 52.2 5.5e-54 208.8
Tan01g1601 . 46 252 Chloroplast and Mitochondria Gene Families AT4G10340 53.6 6.7e-52 201.8
Tan03g2667 . 1 265 Chloroplast and Mitochondria Gene Families AT2G34420 88.4 3.0e-134 475.3
Tan03g2668 . 1 265 Chloroplast and Mitochondria Gene Families AT2G34420 88.4 3.0e-134 475.3
Tan05g0624 . 1 263 Chloroplast and Mitochondria Gene Families AT2G34420 89.0 1.1e-133 473.4
Tan05g2609 . 6 267 Chloroplast and Mitochondria Gene Families AT2G34420 87.9 3.3e-133 471.9
Tan05g2608 . 6 267 Chloroplast and Mitochondria Gene Families AT2G34420 87.1 4.7e-132 468.0
Tan04g2344 . 185 444 Chloroplast and Mitochondria Gene Families AT2G34420 86.0 1.7e-126 449.5
Tan02g0465 . 3 265 Chloroplast and Mitochondria Gene Families AT2G34420 77.2 1.3e-116 416.8
Tan01g1601 . 22 264 Chloroplast and Mitochondria Gene Families AT2G34420 70.9 1.8e-94 343.2
Tan10g1823 . 72 275 Chloroplast and Mitochondria Gene Families AT2G34420 51.4 8.3e-52 201.4
Tan03g2668 . 1 265 Chloroplast and Mitochondria Gene Families AT2G34430 89.1 1.4e-136 483.0
Tan03g2667 . 1 265 Chloroplast and Mitochondria Gene Families AT2G34430 89.9 4.2e-136 481.5
Tan05g2609 . 5 267 Chloroplast and Mitochondria Gene Families AT2G34430 87.5 1.6e-135 479.6
Tan05g2608 . 6 267 Chloroplast and Mitochondria Gene Families AT2G34430 86.7 5.1e-134 474.6
Tan05g0624 . 1 263 Chloroplast and Mitochondria Gene Families AT2G34430 88.3 1.9e-133 472.6
Tan04g2344 . 185 444 Chloroplast and Mitochondria Gene Families AT2G34430 86.4 2.4e-128 455.7
Tan02g0465 . 31 265 Chloroplast and Mitochondria Gene Families AT2G34430 83.6 2.0e-114 409.5
Tan01g1601 . 34 264 Chloroplast and Mitochondria Gene Families AT2G34430 71.4 1.8e-94 343.2
Tan10g1823 . 72 275 Chloroplast and Mitochondria Gene Families AT2G34430 51.4 1.1e-51 201.1
Tan03g0807 . 3 286 Chloroplast and Mitochondria Gene Families AT5G01530 83.5 3.7e-138 488.4
Tan01g1465 . 48 307 Chloroplast and Mitochondria Gene Families AT5G40810 94.2 4.1e-144 508.1
Tan01g1466 . 48 307 Chloroplast and Mitochondria Gene Families AT5G40810 94.2 4.1e-144 508.1
Tan01g1465 . 1 307 Chloroplast and Mitochondria Gene Families AT3G27240 85.5 1.7e-149 526.2
Tan01g1466 . 1 307 Chloroplast and Mitochondria Gene Families AT3G27240 85.5 1.7e-149 526.2
Tan05g0522 . 5 327 Chloroplast and Mitochondria Gene Families AT2G30160 74.7 7.5e-143 504.2
Tan03g0759 . 11 311 Chloroplast and Mitochondria Gene Families AT2G30160 67.1 4.0e-112 402.1
Tan05g0522 . 5 329 Chloroplast and Mitochondria Gene Families AT1G07030 76.2 1.5e-143 506.5
Tan03g0759 . 7 311 Chloroplast and Mitochondria Gene Families AT1G07030 68.5 2.2e-118 422.9
Tan06g0765 . 1 305 Chloroplast and Mitochondria Gene Families AT2G47490 77.3 4.4e-137 485.0
Tan11g1839 . 15 318 Chloroplast and Mitochondria Gene Families AT2G47490 62.2 5.6e-108 388.3
Tan11g1839 . 7 360 Chloroplast and Mitochondria Gene Families AT1G25380 63.2 1.5e-123 440.3
Tan06g0765 . 11 297 Chloroplast and Mitochondria Gene Families AT1G25380 64.8 1.9e-107 386.7
Tan05g3212 . 5 584 Chloroplast and Mitochondria Gene Families AT4G21490 74.5 2.7e-257 885.2
Tan05g0812 . 1 585 Chloroplast and Mitochondria Gene Families AT4G21490 69.8 6.1e-241 830.9
Tan02g0260 . 2 409 Chloroplast and Mitochondria Gene Families AT4G21490 68.5 1.9e-170 596.7
Tan06g0153 . 10 186 Chloroplast and Mitochondria Gene Families AT1G17530 65.7 1.0e-61 233.8
Tan09g0514 . 4 179 Chloroplast and Mitochondria Gene Families AT1G17530 59.6 7.5e-52 201.1
Tan09g0514 . 12 183 Chloroplast and Mitochondria Gene Families AT3G04800 59.5 5.9e-52 201.4
Tan06g0153 . 22 190 Chloroplast and Mitochondria Gene Families AT3G04800 55.0 2.9e-43 172.6
Tan06g0153 . 13 190 Chloroplast and Mitochondria Gene Families AT1G72750 69.4 1.0e-64 243.8
Tan09g0514 . 5 183 Chloroplast and Mitochondria Gene Families AT1G72750 59.3 3.1e-53 205.7
Tan04g0906 . 1 223 Chloroplast and Mitochondria Gene Families AT1G26100 62.8 3.8e-72 268.9
Tan04g0907 . 18 174 Chloroplast and Mitochondria Gene Families AT1G26100 70.7 2.3e-61 233.0
Tan11g0368 . 1 166 Chloroplast and Mitochondria Gene Families AT1G26100 50.9 6.3e-43 171.8
Tan11g0367 . 1 226 Chloroplast and Mitochondria Gene Families AT5G38630 71.8 1.2e-91 333.6
Tan11g0368 . 1 173 Chloroplast and Mitochondria Gene Families AT5G38630 71.1 5.0e-69 258.5
Tan07g0336 . 23 219 Chloroplast and Mitochondria Gene Families AT4G25570 71.6 1.6e-82 303.5
Tan11g1719 . 5 222 Chloroplast and Mitochondria Gene Families AT1G14730 50.9 3.4e-62 235.7
Tan11g1546 . 9 364 Chloroplast and Mitochondria Gene Families AT5G14040 83.2 2.5e-171 599.0
Tan07g0051 . 9 367 Chloroplast and Mitochondria Gene Families AT5G14040 75.5 2.6e-160 562.4
Tan09g2425 . 34 343 Chloroplast and Mitochondria Gene Families AT5G14040 84.6 1.1e-155 547.0
Tan02g0561 . 11 298 Chloroplast and Mitochondria Gene Families AT5G14040 51.0 2.0e-83 307.0
Tan07g0051 . 11 364 Chloroplast and Mitochondria Gene Families AT3G48850 73.0 1.2e-146 516.9
Tan11g1546 . 8 356 Chloroplast and Mitochondria Gene Families AT3G48850 71.8 6.1e-146 514.6
Tan09g2425 . 7 343 Chloroplast and Mitochondria Gene Families AT3G48850 68.2 5.9e-141 498.0
Tan02g0561 . 11 297 Chloroplast and Mitochondria Gene Families AT3G48850 50.2 1.1e-83 307.8
Tan02g0561 . 8 308 Chloroplast and Mitochondria Gene Families AT2G17270 72.8 1.2e-129 460.3
Tan07g0051 . 66 368 Chloroplast and Mitochondria Gene Families AT2G17270 51.8 1.9e-87 320.1
Tan09g2425 . 47 344 Chloroplast and Mitochondria Gene Families AT2G17270 51.2 3.9e-85 312.4
Tan11g1546 . 62 357 Chloroplast and Mitochondria Gene Families AT2G17270 52.0 6.6e-85 311.6
Tan11g0423 . 17 320 Chloroplast and Mitochondria Gene Families AT5G15640 76.9 3.3e-132 468.8
Tan11g0424 . 17 318 Chloroplast and Mitochondria Gene Families AT5G15640 75.7 7.6e-129 457.6
Tan10g1104 . 17 324 Chloroplast and Mitochondria Gene Families AT5G15640 50.3 1.3e-80 297.4
Tan01g4590 . 12 340 Chloroplast and Mitochondria Gene Families AT5G26200 69.3 1.1e-125 447.2
Tan06g0146 . 1 344 Chloroplast and Mitochondria Gene Families AT5G26200 58.9 1.4e-107 387.1
Tan06g0146 . 1 348 Chloroplast and Mitochondria Gene Families AT1G72820 76.1 4.8e-148 521.5
Tan01g4590 . 1 341 Chloroplast and Mitochondria Gene Families AT1G72820 68.8 1.6e-127 453.4
Tan01g0198 . 97 300 Chloroplast and Mitochondria Gene Families AT5G52570 57.8 8.4e-56 214.5
Tan07g1609 . 78 283 Chloroplast and Mitochondria Gene Families AT5G52570 51.9 2.2e-48 189.9
Tan01g0200 . 97 280 Chloroplast and Mitochondria Gene Families AT5G52570 54.9 1.0e-45 181.0
Tan01g0199 . 1 221 Chloroplast and Mitochondria Gene Families AT4G25700 61.8 4.1e-68 255.4
Tan01g0201 . 1 221 Chloroplast and Mitochondria Gene Families AT4G25700 61.8 4.1e-68 255.4
Tan01g0198 . 1 219 Chloroplast and Mitochondria Gene Families AT4G25700 61.9 2.0e-67 253.1
Tan01g0200 . 1 219 Chloroplast and Mitochondria Gene Families AT4G25700 61.9 2.0e-67 253.1
Tan07g1609 . 67 200 Chloroplast and Mitochondria Gene Families AT4G25700 76.1 8.0e-56 214.5
Tan01g1588 . 50 359 Chloroplast and Mitochondria Gene Families AT5G54290 75.2 1.5e-120 430.3
Tan01g1589 . 39 315 Chloroplast and Mitochondria Gene Families AT5G54290 82.0 3.3e-120 429.1
Tan09g1638 . 53 546 Chloroplast and Mitochondria Gene Families AT2G18710 85.5 1.7e-240 829.3
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0001904 3 2 3 3 2 2 3 2 2 2 2 2 2 2 2 2 2 4 3 2 2 2 2 1 3 1 2 3 2 2 67