Gene search

Sequence information

Select Gene Cds Cds_length GC_content Pep Pep_length
Tan11g0243 ATGGCGAAGTTCAGGGATAGGACTGAAGATTTTAAAGATGCTGTGCGGCATTCTGCTTTTTCTTTAGGGTTTAACGAGTCCAAGTTGGCGGGTATTATGGCATCTTTCATCATTCAGAAACCTCGACAAAGGTCACCTTTCATCAAAGCTGCCCTAAAAACGCTAGAGAGCATTGGTGCTCTTGAAGAGTTTATGTTGAAACATCAAAAGGACTATGTAGATATGTATCGCACGACAGATCAAGAGAGAGACGATATTGAACATGAGGTAACTGCCTTCATCAAAGCATGCCAAGAACAAATCGATATCCTAAAAAACAACATTAATGAGGATGAAGCGCACTCAAAGGGCTGGCTTGGTGCTAGGACTGATGATGCTAATGCCGATACTATTGCACACAAACATGGGGTGGTTCTAATTTTGAGTGAGAAACTTCATTCAGTAACAGCACAATTTGATAAGCTAAGAGCCATTCGATTTCAAGATATCATAAACAAAGCAGTACCAAGAAGAAAAGTGAACCAAGTAAATAAACCACGTTCTGCAAATACCCCTGAATATAATAATAATATGGAGCTGAGGGAACCTGATAATTTTGAGCATCAACCTGTCCGAGCCCAACAGCAAATGTTGGATGATGAAACTCGTGCACTTCAGGTTGAGTTGACTAGTCTTCTTGACGCAGTCCAGGAAACAGAAACTAAGATGGTAGAGATGTCTGCTTTAAATCACCTTATGTCTACACACGTTTTGCAGCAAGCACAACAAATTGAACTTCTTTATGAACAGGCTGTTGAAGCTACAAAGAACGTCGAGCTCGGTAATAAAGAACTTGCTCAAGCAATTCAGCGGAATAGCAGCAGCAGAACCTTCCTTCTGCTTTTTCTATTTGTGCTCACCTTTTCAATTCTCTTTCTTGATTGGTATAGTTGA 933 40.41 MAKFRDRTEDFKDAVRHSAFSLGFNESKLAGIMASFIIQKPRQRSPFIKAALKTLESIGALEEFMLKHQKDYVDMYRTTDQERDDIEHEVTAFIKACQEQIDILKNNINEDEAHSKGWLGARTDDANADTIAHKHGVVLILSEKLHSVTAQFDKLRAIRFQDIINKAVPRRKVNQVNKPRSANTPEYNNNMELREPDNFEHQPVRAQQQMLDDETRALQVELTSLLDAVQETETKMVEMSALNHLMSTHVLQQAQQIELLYEQAVEATKNVELGNKELAQAIQRNSSSRTFLLLFLFVLTFSILFLDWYS 310
       

Gff information

Chromosome Start End Strand Old_gene Gene Num
11 1956686 1959340 + Tan0012869.1 Tan11g0243 767180

Annotation

Select Seq ID Length Analysis Description Start End IPR GO
Tan11g0243 310 Gene3D - 206 307 - -
Tan11g0243 310 SUPERFAMILY t-snare proteins 61 274 IPR010989 GO:0016020(InterPro)|GO:0016192(InterPro)
Tan11g0243 310 Coils Coil 94 114 - -
Tan11g0243 310 FunFam Syntaxin-81 like 213 307 - -
Tan11g0243 310 PANTHER SYNTAXIN-18 1 310 - GO:0005783(PANTHER)|GO:0006890(PANTHER)|GO:0031201(PANTHER)
Tan11g0243 310 Pfam SNARE-complex protein Syntaxin-18 N-terminus 5 86 IPR019529 -
       

Pathway

Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Tan11g0243 K08492 - - csv:101207161 551.977
       

Deco-Alignment

Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi13g422 . . . . . . . . . . . . . . Sed03g0404 Cpe13g01079 . Bhi04g02346 Tan11g0243 Cmetu03g1342 . Hepe02g3337 . Lcy10g2218 . . . . . . . . . . Cone18ag0421 Lsi03g00333 Csa06g00159 . . . . . . . . . . . Cmo04g03046 Cmo15g00129 Cma04g02924 Cma15g00119 Car04g02811 Car15g00129 . Cpe01g02531 . . . . . . . Cla11g00615 Cam11g0668 Cec11g0667 Cco11g0653 Clacu11g0790 Cmu11g0646 Cre11g1122 . . Chy03g00164 Cme03g00216
       

Syn-Families

Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Tan02g2666 . 8 337 SNARE and Associated Proteins AT3G24350 62.6 1.1e-102 370.9
Tan03g0640 . 1 308 SNARE and Associated Proteins AT1G08560 71.2 3.4e-105 379.0
Tan03g1990 . 375 673 SNARE and Associated Proteins AT2G18260 56.5 3.1e-87 319.3
Tan08g1616 . 19 279 SNARE and Associated Proteins AT3G11820 80.8 2.2e-115 412.9
Tan03g1265 . 21 280 SNARE and Associated Proteins AT3G11820 70.4 3.7e-99 359.0
Tan05g3221 . 26 281 SNARE and Associated Proteins AT3G11820 65.6 3.0e-93 339.3
Tan10g1572 . 27 285 SNARE and Associated Proteins AT3G11820 52.1 1.7e-67 253.8
Tan08g1616 . 1 279 SNARE and Associated Proteins AT3G52400 63.9 1.4e-91 334.0
Tan03g1265 . 1 275 SNARE and Associated Proteins AT3G52400 59.8 2.1e-84 310.1
Tan05g3221 . 1 281 SNARE and Associated Proteins AT3G52400 56.5 6.4e-81 298.5
Tan05g3221 . 1 299 SNARE and Associated Proteins AT4G03330 69.9 2.5e-108 389.4
Tan08g1616 . 1 280 SNARE and Associated Proteins AT4G03330 58.0 2.7e-83 306.2
Tan03g1265 . 1 278 SNARE and Associated Proteins AT4G03330 52.3 6.8e-74 275.0
Tan10g1572 . 1 285 SNARE and Associated Proteins AT4G03330 51.2 9.5e-68 254.6
Tan05g3221 . 1 303 SNARE and Associated Proteins AT1G61290 78.5 5.3e-127 451.4
Tan08g1616 . 1 280 SNARE and Associated Proteins AT1G61290 62.4 4.6e-91 332.0
Tan03g1265 . 1 275 SNARE and Associated Proteins AT1G61290 56.4 6.3e-80 295.0
Tan05g3221 . 1 303 SNARE and Associated Proteins AT1G11250 77.9 1.1e-124 443.7
Tan08g1616 . 1 280 SNARE and Associated Proteins AT1G11250 62.9 1.7e-93 340.1
Tan03g1265 . 1 275 SNARE and Associated Proteins AT1G11250 56.7 1.7e-82 303.5
Tan10g1572 . 1 308 SNARE and Associated Proteins AT3G03800 73.1 3.9e-114 408.7
Tan05g0864 . 78 348 SNARE and Associated Proteins AT3G03800 58.3 2.3e-82 303.1
Tan10g1572 . 1 203 SNARE and Associated Proteins AT5G08080 76.4 1.9e-78 289.7
Tan05g0864 . 47 247 SNARE and Associated Proteins AT5G08080 59.7 6.3e-53 204.9
Tan01g2212 . 1 256 SNARE and Associated Proteins AT5G16830 59.9 6.6e-76 281.6
Tan01g2212 . 1 256 SNARE and Associated Proteins AT5G46860 66.8 6.6e-81 298.1
Tan01g2212 . 1 256 SNARE and Associated Proteins AT4G17730 61.3 1.3e-73 273.9
Tan01g2212 . 65 256 SNARE and Associated Proteins AT1G32270 60.9 1.3e-52 204.5
Tan04g0181 . 1 334 SNARE and Associated Proteins AT5G05760 65.7 1.4e-112 403.7
Tan02g2666 . 8 337 SNARE and Associated Proteins AT3G24350 62.6 1.1e-102 370.9
Tan06g0761 . 1 319 SNARE and Associated Proteins AT5G26980 66.8 1.9e-103 373.2
Tan06g0762 . 1 328 SNARE and Associated Proteins AT5G26980 65.0 1.6e-102 370.2
Tan08g0631 . 1 228 SNARE and Associated Proteins AT5G26980 78.1 2.1e-86 316.6
Tan08g0630 . 1 228 SNARE and Associated Proteins AT5G26980 78.1 2.1e-86 316.6
Tan08g0633 . 1 258 SNARE and Associated Proteins AT5G26980 69.0 1.2e-81 300.8
Tan08g0632 . 1 270 SNARE and Associated Proteins AT5G26980 65.9 3.0e-80 296.2
Tan08g0634 . 1 300 SNARE and Associated Proteins AT5G26980 59.3 1.7e-75 280.4
Tan06g0761 . 1 319 SNARE and Associated Proteins AT4G02195 67.2 1.6e-105 380.2
Tan06g0762 . 1 328 SNARE and Associated Proteins AT4G02195 65.4 3.3e-103 372.5
Tan08g0631 . 1 230 SNARE and Associated Proteins AT4G02195 68.0 9.1e-77 284.6
Tan08g0630 . 1 230 SNARE and Associated Proteins AT4G02195 68.0 9.1e-77 284.6
Tan08g0633 . 1 260 SNARE and Associated Proteins AT4G02195 60.2 5.1e-72 268.9
Tan08g0632 . 1 272 SNARE and Associated Proteins AT4G02195 57.5 1.3e-70 264.2
Tan08g0634 . 1 302 SNARE and Associated Proteins AT4G02195 51.8 7.2e-66 248.4
Tan06g0761 . 1 319 SNARE and Associated Proteins AT3G05710 63.4 4.3e-98 355.5
Tan06g0762 . 1 328 SNARE and Associated Proteins AT3G05710 61.7 4.7e-97 352.1
Tan08g0631 . 1 229 SNARE and Associated Proteins AT3G05710 80.3 1.3e-91 334.0
Tan08g0630 . 1 229 SNARE and Associated Proteins AT3G05710 80.3 1.3e-91 334.0
Tan08g0633 . 1 259 SNARE and Associated Proteins AT3G05710 71.0 7.6e-87 318.2
Tan08g0632 . 1 271 SNARE and Associated Proteins AT3G05710 67.9 1.9e-85 313.5
Tan08g0634 . 1 301 SNARE and Associated Proteins AT3G05710 61.1 1.1e-80 297.7
Tan01g3132 . 1 233 SNARE and Associated Proteins AT1G16240 71.7 2.0e-89 326.2
Tan01g1776 . 4 232 SNARE and Associated Proteins AT1G16240 67.7 1.5e-81 300.1
Tan01g1777 . 4 232 SNARE and Associated Proteins AT1G16240 67.7 1.5e-81 300.1
Tan01g3132 . 1 233 SNARE and Associated Proteins AT1G79590 71.2 1.9e-88 323.2
Tan01g1776 . 4 232 SNARE and Associated Proteins AT1G79590 68.1 7.7e-82 301.2
Tan01g1777 . 4 232 SNARE and Associated Proteins AT1G79590 68.1 7.7e-82 301.2
Tan09g0537 . 56 246 SNARE and Associated Proteins AT1G28490 70.7 1.7e-65 246.5
Tan11g2093 . 56 246 SNARE and Associated Proteins AT1G28490 70.2 1.9e-64 243.0
Tan11g2090 . 56 246 SNARE and Associated Proteins AT1G28490 70.2 1.9e-64 243.0
Tan11g2091 . 56 192 SNARE and Associated Proteins AT1G28490 66.4 3.4e-42 169.1
Tan11g2092 . 56 192 SNARE and Associated Proteins AT1G28490 66.4 3.4e-42 169.1
Tan08g1893 . 1 264 SNARE and Associated Proteins AT3G09740 79.7 8.5e-113 404.1
Tan05g0265 . 1 265 SNARE and Associated Proteins AT3G09740 68.3 9.4e-96 347.4
Tan05g0265 . 1 265 SNARE and Associated Proteins AT3G45280 65.7 8.5e-89 324.3
Tan08g1893 . 1 264 SNARE and Associated Proteins AT3G45280 64.4 1.2e-87 320.5
Tan08g1893 . 1 261 SNARE and Associated Proteins AT3G61450 68.6 2.1e-95 346.3
Tan05g0265 . 1 262 SNARE and Associated Proteins AT3G61450 60.8 3.0e-86 315.8
Tan11g0243 . 65 310 SNARE and Associated Proteins AT1G51740 74.1 2.6e-92 335.9
       

Syn-Orthogroups

Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0011407 0 1 0 1 0 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 1 2 1 1 1 30