Gene search


Sequence information


Select Gene Cds Cds_length GC_content Pep Pep_length
Vvi13g422 ATGGCAAAAATTAGAGATAGAACTGAGGATTTCAAAGATGTGGTCCGCCAAACAGCACTTTCTTTGGGATATAACGAGTCCAAAATGGCATCCATACTGTCGTCTTTCATTATTCACAAACCTTTGCAAAGGACATCTTTTACCAAAGCTGCCCTAAAGACGCTTGAAAGCATCAGAACTTTGGAACAGTTCATCATGCAGCATCGGAAGGATTATGTTGATATGCACCGTACAACTGAACAGGAAAGAGATAGCATTGAACATGAAGTTACTATTTTTATTAAAGCATGTAAAGACCAAATAGATATTCTCAAGAATAGTATAAGTGGTGAAGAAGCTAACTCAAGGGGCTGGCTTGGCATTAGAGGTGATCATTCTAATGCTGATACTATTGCACACAAACATGGGGTGGTTTTGATTTTAAGTGAGAGGCTTCATTCAGTAACAGCCCAGTTTGATCAGCTAAGAGCTAGACGCTTTCAGGATGCGATTAATAGACGGATACCAAGAAAAAAAATGAACCGGGTGTCCAGTTCAAATGCTACAGAAATCCCTAAATCTATCAATTCAGAACTGAGGGAGCCTGATGAGCCTCAGCCAGAGCCTCTTAGAGTTCAACAACAACTCTTGGATGATGAAACACGTGCTCTTCAGGTAGAGTTGTCTAGCCTTCTAGATGCTGTTCAAGAAACAGAAACTCAGATGGTGGAGATGTCTGCATTGAATCACCTCATGTCCACCCATATTCTGCAACAAGCTCAACAGATAGAGCTTTTGTATGAGCAGGCAGTCGAAGCTACATCAAATGTGGAGCTTGGTAACAAAGAGCTGTCTCAAGCCATCCAGCGAAATAGCAGCAGCAGAACCTTTCTTTTGCTTTTTCTATTTGTACTTACCTTTTCAATCATCTTTCTTGATTGGTATAGTTAA 930 40.54 MAKIRDRTEDFKDVVRQTALSLGYNESKMASILSSFIIHKPLQRTSFTKAALKTLESIRTLEQFIMQHRKDYVDMHRTTEQERDSIEHEVTIFIKACKDQIDILKNSISGEEANSRGWLGIRGDHSNADTIAHKHGVVLILSERLHSVTAQFDQLRARRFQDAINRRIPRKKMNRVSSSNATEIPKSINSELREPDEPQPEPLRVQQQLLDDETRALQVELSSLLDAVQETETQMVEMSALNHLMSTHILQQAQQIELLYEQAVEATSNVELGNKELSQAIQRNSSSRTFLLLFLFVLTFSIIFLDWYS* 310
       

Gff information


Chromosome Start End Strand Old_gene Gene Num
13 4299874 4306061 + Vvi13g422 Vvi13g422 774208

Annotation


Select Seq ID Length Analysis Description Start End IPR GO
Vvi13g422 309 SUPERFAMILY t-snare proteins 55 273 IPR010989 GO:0016020|GO:0016192
Vvi13g422 309 Gene3D - 211 306 - -
Vvi13g422 309 Pfam SNARE-complex protein Syntaxin-18 N-terminus 6 86 IPR019529 -
Vvi13g422 309 MobiDBLite consensus disorder prediction 173 202 - -
Vvi13g422 309 Coils Coil 94 114 - -
Vvi13g422 309 PANTHER SYNTAXIN-18 5 309 - -
Vvi13g422 309 PANTHER SYNTAXIN-18 5 309 - -
       

Pathway


Select Query KO Definition Second KO KEGG Genes ID GHOSTX Score
Vvi13g422 K08492 STX18; syntaxin 18 - vvi:104881127 585.874
       

Deco-Alignment


Select Vvi1 Blo1 Blo2 Bda1 Bda2 Bpe1 Bpe2 Bma1 Bma2 Cmo1 Cmo2 Cma1 Cma2 Car1 Car2 Sed1 Cpe1 Cpe2 Bhi1 Tan1 Cmetu1 Lac1 Hepe1 Mch1 Lcy1 Cla1 Cam1 Cec1 Cco1 Clacu1 Cmu1 Cre1 Cone1 Cone2 Cone3 Cone4 Lsi1 Csa1 Chy1 Cme1 Blo3 Blo4 Bda3 Bda4 Bpe3 Bpe4 Bma3 Bma4 Sed2 Cmo3 Cmo4 Cma3 Cma4 Car3 Car4 Cpe3 Cpe4 Bhi2 Tan2 Cmetu2 Lac2 Hepe2 Mch2 Lcy2 Cla2 Cam2 Cec2 Cco2 Clacu2 Cmu2 Cre2 Lsi2 Csa2 Chy2 Cme2
Vvi13g422 . . . . . . . . . . . . . . Sed03g0404 Cpe13g01079 . Bhi04g02346 Tan11g0243 Cmetu03g1342 . Hepe02g3337 . Lcy10g2218 . . . . . . . . . . Cone18ag0421 Lsi03g00333 Csa06g00159 . . . . . . . . . . . Cmo04g03046 Cmo15g00129 Cma04g02924 Cma15g00119 Car04g02811 Car15g00129 . Cpe01g02531 . . . . . . . Cla11g00615 Cam11g0668 Cec11g0667 Cco11g0653 Clacu11g0790 Cmu11g0646 Cre11g1122 . . Chy03g00164 Cme03g00216
       

Syn-Families


Select Gene Event_type S_start S_end Function Ath_gene Identity(%) E-value Score
Vvi4g377 ECH 1 341 SNARE and Associated Proteins AT3G24350 65.7 9.0e-107 384.0
Vvi11g384 ECH 1 339 SNARE and Associated Proteins AT3G24350 66.0 6.4e-105 377.9
Vvi4g233 . 1 201 SNARE and Associated Proteins AT1G08560 64.5 4.9e-69 258.5
Vvi4g990 ECH 1 259 SNARE and Associated Proteins AT2G18260 53.3 5.5e-73 271.6
Vvi12g501 . 24 282 SNARE and Associated Proteins AT3G11820 64.1 6.0e-91 331.3
Vvi12g501 . 1 282 SNARE and Associated Proteins AT3G52400 54.1 2.4e-77 286.2
Vvi12g501 . 1 297 SNARE and Associated Proteins AT4G03330 68.1 1.6e-104 376.3
Vvi8g156 . 1 285 SNARE and Associated Proteins AT4G03330 50.2 8.5e-66 247.7
Vvi12g501 . 1 297 SNARE and Associated Proteins AT1G61290 75.3 1.8e-116 416.0
Vvi12g501 . 1 297 SNARE and Associated Proteins AT1G11250 75.1 4.3e-115 411.4
Vvi8g156 . 1 308 SNARE and Associated Proteins AT3G03800 76.7 2.5e-118 422.2
Vvi12g523 . 97 399 SNARE and Associated Proteins AT3G03800 58.4 1.8e-87 319.7
Vvi8g156 . 1 203 SNARE and Associated Proteins AT5G08080 78.3 5.8e-80 294.3
Vvi12g523 . 97 302 SNARE and Associated Proteins AT5G08080 62.6 4.8e-58 221.5
Vvi16g114 ECH 1 262 SNARE and Associated Proteins AT5G16830 61.7 6.1e-79 291.2
Vvi2g709 ECH 1 262 SNARE and Associated Proteins AT5G16830 59.7 2.0e-77 286.2
Vvi2g709 ECH 1 262 SNARE and Associated Proteins AT5G46860 67.6 2.1e-84 309.3
Vvi16g114 ECH 1 262 SNARE and Associated Proteins AT5G46860 58.0 1.0e-67 253.8
Vvi14g1065 . 1 184 SNARE and Associated Proteins AT5G46860 58.5 1.1e-48 190.7
Vvi2g709 ECH 1 257 SNARE and Associated Proteins AT4G17730 63.0 3.0e-75 278.9
Vvi16g114 ECH 1 261 SNARE and Associated Proteins AT4G17730 52.6 2.6e-63 239.2
Vvi14g1065 . 1 184 SNARE and Associated Proteins AT4G17730 54.4 6.4e-46 181.4
Vvi2g709 ECH 65 256 SNARE and Associated Proteins AT1G32270 65.1 2.5e-58 223.0
Vvi16g114 ECH 14 260 SNARE and Associated Proteins AT1G32270 50.4 6.0e-52 201.8
Vvi13g19 . 61 396 SNARE and Associated Proteins AT5G05760 66.0 2.4e-114 409.1
Vvi4g377 ECH 1 341 SNARE and Associated Proteins AT3G24350 65.7 9.0e-107 384.0
Vvi11g384 ECH 1 339 SNARE and Associated Proteins AT3G24350 66.0 6.4e-105 377.9
Vvi14g133 ECH 1 328 SNARE and Associated Proteins AT5G26980 78.4 2.3e-130 462.2
Vvi7g353 ECH 1 319 SNARE and Associated Proteins AT5G26980 74.6 3.7e-120 428.3
Vvi7g353 ECH 1 316 SNARE and Associated Proteins AT4G02195 68.8 2.4e-111 399.1
Vvi14g133 ECH 1 326 SNARE and Associated Proteins AT4G02195 67.7 2.7e-110 395.6
Vvi14g133 ECH 1 328 SNARE and Associated Proteins AT3G05710 76.9 1.1e-130 463.4
Vvi7g353 ECH 1 319 SNARE and Associated Proteins AT3G05710 70.7 2.0e-116 416.0
Vvi19g583 . 3 233 SNARE and Associated Proteins AT1G16240 72.3 2.1e-88 322.4
Vvi19g583 . 2 233 SNARE and Associated Proteins AT1G79590 73.3 1.4e-88 323.2
Vvi5g1352 . 110 290 SNARE and Associated Proteins AT1G28490 70.2 1.8e-64 242.7
Vvi8g590 ECH 1 264 SNARE and Associated Proteins AT3G09740 79.3 9.5e-114 406.8
Vvi6g289 ECH 1 265 SNARE and Associated Proteins AT3G09740 70.9 2.8e-97 352.1
Vvi6g289 ECH 1 265 SNARE and Associated Proteins AT3G45280 68.3 4.2e-93 338.2
Vvi8g590 ECH 1 264 SNARE and Associated Proteins AT3G45280 66.3 5.7e-90 327.8
Vvi8g590 ECH 1 261 SNARE and Associated Proteins AT3G61450 70.1 2.3e-96 349.0
Vvi6g289 ECH 1 261 SNARE and Associated Proteins AT3G61450 63.6 1.8e-85 312.8
Vvi13g422 . 65 310 SNARE and Associated Proteins AT1G51740 75.8 2.0e-94 342.4
       

Syn-Orthogroups


Select Orthogroup Bda Bhi Blo Bma Bpe Cam Car Cco Cec Chy Cla Clacu Cma Cme Cmetu Cmo Cmu Cone Cpe Cre Csa HCH Hepe Lac Lcy Lsi Mch Sed Tan Vvi Total
OG0011407 0 1 0 1 0 1 1 1 1 1 1 1 1 1 1 1 1 2 2 1 1 1 1 1 1 1 2 1 1 1 30